The Pro-apoptotic Ras Effector Nore1 May Serve as a Ras-regulated Tumor Suppressor in the Lung

Abstract

Ras oncoproteins mediate multiple biological effects by activating multiple effectors. Classically, Ras activation has been associated with enhanced cellular growth and transformation. However, activated forms of Ras may also inhibit growth by inducing senescence, apoptosis, and differentiation. Induction of apoptosis by Ras may be mediated by its effector RASSF1, which appears to function as a tumor suppressor. We now show that the Ras effector Nore1, which is structurally related to RASSF1, can also mediate a Ras-dependent apoptosis. Moreover, an analysis of Nore1 protein expression showed that it is frequently down-regulated in lung tumor cell lines and primary lung tumors. Like RASSF1, this correlates with methylation of the Nore1 promoter rather than gene deletion. Finally, re-introduction of Nore1, driven by its own promoter, impairs the growth in soft agar of a human lung tumor cell line. Consequently, we propose that the Ras effector Nore1 is a member of a family of Ras effector/tumor suppressors that includes RASSF1. Ras oncoproteins mediate multiple biological effects by activating multiple effectors. Classically, Ras activation has been associated with enhanced cellular growth and transformation. However, activated forms of Ras may also inhibit growth by inducing senescence, apoptosis, and differentiation. Induction of apoptosis by Ras may be mediated by its effector RASSF1, which appears to function as a tumor suppressor. We now show that the Ras effector Nore1, which is structurally related to RASSF1, can also mediate a Ras-dependent apoptosis. Moreover, an analysis of Nore1 protein expression showed that it is frequently down-regulated in lung tumor cell lines and primary lung tumors. Like RASSF1, this correlates with methylation of the Nore1 promoter rather than gene deletion. Finally, re-introduction of Nore1, driven by its own promoter, impairs the growth in soft agar of a human lung tumor cell line. Consequently, we propose that the Ras effector Nore1 is a member of a family of Ras effector/tumor suppressors that includes RASSF1. Ras proteins are small GTPases that regulate the flow of mitogenic signals from cell surface receptors to the internal cell signaling machinery (1Malumbres M. Pellicer A. Front. Biosci. 1998; 3: d887-d912Crossref PubMed Scopus (12) Google Scholar, 2Campbell S.L. Khosravi-Far R. Rossman K.L. Clark G.J. Der C.J. Oncogene. 1998; 17: 1395-1413Crossref PubMed Scopus (920) Google Scholar). To achieve this, Ras proteins shuttle between an active, GTP-bound form and an inactive GDP-bound form under the influence of guanine nucleotide exchange factors and GTPase activating proteins (3Bollag G. McCormick F. Semin. Cancer Biol. 1992; 3: 199-208PubMed Google Scholar, 4Quilliam L.A. Khosravi-Far R. Huff S.Y. Der C.J. Bioessays. 1995; 17: 395-404Crossref PubMed Scopus (193) Google Scholar, 5Boguski M.S. McCormick F. Nature. 1993; 366: 643-654Crossref PubMed Scopus (1761) Google Scholar). Activated Ras proteins induce a wide variety of biological phenotypes associated with the loss of normal growth control. These include loss of contact inhibition (6Huber B.E. Cordingley M.G. Oncogene. 1988; 3: 245-256PubMed Google Scholar), resistance to differentiation (7Yuspa S.H. Kilkenny A.E. Stanley J. Lichti U. Nature. 1985; 314: 459-462Crossref PubMed Scopus (88) Google Scholar, 8Olson E.N. Spizz G. Tainsky M.A. Mol. Cell. Biol. 1987; 7: 2104-2111Crossref PubMed Scopus (145) Google Scholar), disruption of cytoskeletal architecture (9Hall A. Annu. Rev. Cell Biol. 1994; 10: 31-54Crossref PubMed Scopus (768) Google Scholar), reduced requirement for growth factors (10Andrejauskas E. Moroni C. EMBO J. 1989; 8: 2575-2581Crossref PubMed Scopus (40) Google Scholar), enhanced invasiveness (11Van Roy F.M. Messiaen L. Liebaut G. Gao J. Dragonetti C.H. Fiers W.C. Mareel M.M. Cancer Res. 1986; 46: 4787-4795PubMed Google Scholar, 12Gelmann E.P. Thompson E.W. Sommers C.L. Int. J. Cancer. 1992; 50: 665-669Crossref PubMed Scopus (26) Google Scholar), resistance to apoptosis (13Khwaja A. Rodriguez-Viciana P. Wennstrom S. Warne P.H. Downward J. EMBO J. 1997; 16: 2783-2793Crossref PubMed Scopus (939) Google Scholar), and tumorigenic transformation (1Malumbres M. Pellicer A. Front. Biosci. 1998; 3: d887-d912Crossref PubMed Scopus (12) Google Scholar, 14Clark G.J. Der C.J. Dickey B.F. Birnbaumer L. GTPases in Biology. Springer-Verlag, New York1993: 259-287Google Scholar). However, activated Ras may also induce senescence (15Serrano M. Lin A.W. McCurrach M.E. Beach D. Lowe S.W. Cell. 1997; 88: 593-602Abstract Full Text Full Text PDF PubMed Scopus (3965) Google Scholar), differentiation (16Bar-Sagi D. Feramisco J.R. Cell. 1985; 42: 841-848Abstract Full Text PDF PubMed Scopus (569) Google Scholar), cell cycle arrest (17Shao J. Sheng H. DuBois R.N. Beauchamp R.D. J. Biol. Chem. 2000; 275: 22916-22924Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar), or apoptosis (18Chen C.Y. Faller D.V. Oncogene. 1995; 11: 1487-1498PubMed Google Scholar, 19Joneson T. Bar-Sagi D. Mol. Cell. Biol. 1999; 19: 5892-5901Crossref PubMed Scopus (153) Google Scholar). Thus, paradoxically, Ras can drive processes that either are normally associated with the acquisition of a transformed phenotype or that promote growth arrest and death. The normal role of Ras in vivo must involve a fine balance of these properties (20Frame S. Balmain A. Curr. Opin. Genet. Dev. 2000; 10: 106-113Crossref PubMed Scopus (87) Google Scholar). The ability of Ras to produce such a range of apparently contradictory biological effects may be derived from its ability to interact with a diverse array of effector proteins (2Campbell S.L. Khosravi-Far R. Rossman K.L. Clark G.J. Der C.J. Oncogene. 1998; 17: 1395-1413Crossref PubMed Scopus (920) Google Scholar). Although effectors mediating the positive growth effects of Ras have been relatively well characterized, the effectors mediating the negative growth aspects remain relatively poorly defined. Recently, we demonstrated that the tumor suppressor RASSF1 (21Dammann R. Li C. Yoon J.H. Chin P.L. Bates S. Pfeifer G.P. Nat. Genet. 2000; 25: 315-319Crossref PubMed Scopus (1006) Google Scholar) has the potential to serve as a Ras effector mediating Ras-dependent apoptosis (22Vos M.D. Ellis C.A. Bell A. Birrer M.J. Clark G.J. J. Biol. Chem. 2000; 275: 35669-35672Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). At the time we speculated that Nore1, which bears considerable resemblance to RASSF1 (see Fig. 1), might also be a Ras-regulated tumor suppressor. Khokhlatchev et al. (23Khokhlatchev A. Rabizadeh S. Xavier R. Nedwidek M. Chen T. Zhang X.F. Seed B. Avruch J. Curr. Biol. 2002; 12: 253-265Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar) have now shown that Nore1 can induce apoptosis, and Tommasi et al. (24Tommasi S. Dammann R. Jin S.G. Zhang X.X. Avruch J. Pfeifer G.P. Oncogene. 2002; 21: 2713-2720Crossref PubMed Scopus (94) Google Scholar) have shown that some forms of the Nore1 mRNA are down-regulated in a lung tumor cell line. We now show that Nore1-mediated apoptosis is Ras-dependent. Moreover, using a polyclonal antibody, we show that Nore1 protein expression is frequently down-regulated, both in human lung tumor cell lines and in primary tumors. Although Tommasi et al. (24Tommasi S. Dammann R. Jin S.G. Zhang X.X. Avruch J. Pfeifer G.P. Oncogene. 2002; 21: 2713-2720Crossref PubMed Scopus (94) Google Scholar) were unable to determine a mechanism for the down-regulation, we have found evidence of epigenetic inactivation of Nore1 by promoter methylation. Furthermore, by reintroducing Nore1 under the control of its own promoter, we were able to impair the ability of a human lung tumor cell line to grow in soft agar. Consequently, we propose that, like RASSF1, Nore1 may function as a Ras-regulated tumor suppressor. Cloning of Nore1/Maxp1—The Rat ortholog of Nore1 (Maxp1) was identified by a tBlastn search of the GenBank™ data base using the amino acid sequence of murine Nore1 as the query. Maxp1 shows over 94% identity to Nore1. The Maxp1 coding sequence was isolated by PCR from a Rat brain cDNA library, using the following primers to introduce convenient restriction sites (BglII/EcoRI) at the 5′ and 3′ ends: ggggagatctatggcgtccccggccattg and ggggaattccttacccaggcttcccttgg. We have confirmed that the Rat Maxp1 protein binds Ras in a GTP-dependent manner (data not shown). To reduce confusion, we will subsequently refer to this protein as Nore1. The Nore1 gene was cloned as a BglII/EcoRI fragment into the BamHI/EcoRI sites of pcDNAF, a modified version of pcDNA3 (Invitrogen) that adds a FLAG epitope tag to the insert. Nore1 was also cloned via the BamHI/EcoRI sites into pZIP-NeoHA, 1The abbreviations used are: HA, hemagglutinin; CRD, cysteine-rich domain; RA, Ras association; 5-AzaC, 5′-aza-2′-deoxycytidine. a modified version of pZIP-Neo SV(X)1 (25Fiordalisi J.J. Johnson R.L. Ulku A.S. Der C.J. Cox A.D. Methods Enzymol. 1901; 332: 3-36Crossref Scopus (46) Google Scholar), which adds a hemagglutinin epitope tag to the inserted gene. The immediate 1.6-kb 5′ promoter region was amplified from the human Nore1BAC clone (GenBank™ accession number AL354681.2) by PCR using the primers ggtaccggcagaggactatgattaccgtga and ctcgaggggtccaatagtagcgggtacg. These primers introduce a KpnI and an XhoI restriction site at the 5′ and 3′ ends, respectively (shown underlined). After sequence confirmation, the 1.6-kb promoter fragment was cloned into the KpnI/XhoI sites in the vector pGL3-Luc (Promega). The luciferase gene was then excised from this vector and replaced with a full-length BglII/SalI fragment of Nore1. For fluorescent analyses Nore1 was cloned into the BglII/EcoRI sites of the pHcRedC vector (Clontech). Cell Culture and Transfections—NIH 3T3 cells were grown in 10% calf serum and Dulbecco's modified Eagle's medium. 293-T and 293 cells were grown in Dulbecco's modified Eagle's medium and 10% fetal bovine serum. Human lung tumor cells were grown in RPMI with 10% fetal bovine serum. NIH 3T3 and 293-T cells were transfected using the calcium phosphate technique (26Clark G.J. Cox A.D. Graham S.M. Der C.J. Methods Enzymol. 1995; 255: 395-412Crossref PubMed Scopus (182) Google Scholar). Cell selection experiments were performed using pZIP-NeoHA vectors, with the cells selected in medium supplemented with 0.5 mg/ml G418 for 2 weeks. Cells were then fixed and stained in 10% methanol, 10% acetic acid, and 0.5% crystal violet before counting. Soft agar assays were performed as described previously (27Sabichi A.L. Hendricks D.T. Bober M.A. Birrer M.J. J. Natl. Cancer Inst. 1998; PubMed Scopus Google Scholar). Human lung tumor cell lines were from the cells were with of and of using (Invitrogen) and selected in Cell cells were with of the fluorescent expression described and fluorescent (Clontech). of the protein in cells was by fluorescent 293 cells were transfected with of or After was in at a of Cells were then under and of Human Nore1 human Nore1 fragment was isolated by PCR from the clone and used as a in of human normal mRNA (Clontech). analysis was performed as described previously (22Vos M.D. Ellis C.A. Bell A. Birrer M.J. Clark G.J. J. Biol. Chem. 2000; 275: 35669-35672Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). of Nore1 to the Nore1 were by is in the of Nore1 and is between the and human were performed using the at a of by with a was via an were and with for was reduced by the in normal serum for at were in the primary at at The the were for to and then for to the was with and the were with of the primary by serum was used as a negative control. of the primary with of of was used as a control. were in a with a was and with or restriction to and The full-length Nore1 cDNA was used as a to for gene deletion. The 1.6-kb promoter region was used as a to the methylation of sites in the were performed by the cells in growth medium supplemented with for Cells were then and for of Nore1 by were with for before to analysis using Nore1 of Nore1 and Nore1 described as Maxp1 in and murine Nore1 show amino acid proteins are to the tumor suppressor of an a cysteine-rich shown in an shown and a shown The region is and of is in Nore1 than Nore1 and a potential is also found in the family of Ras effectors it in the of by to and Khosravi-Far R. M.A. Der C.J. S.L. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, S. L. Bell J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, G.J. Rossman K.L. H. Der C.J. S.L. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar). RASSF1 and Nore1 may produce that are and not the (24Tommasi S. Dammann R. Jin S.G. Zhang X.X. Avruch J. Pfeifer G.P. Oncogene. 2002; 21: 2713-2720Crossref PubMed Scopus (94) Google Scholar). The of Rat and murine Nore1 amino acid identity to the of human and amino acid to the of the Ras effector The region has been shown to be a site of and S. Khokhlatchev A. Nedwidek M. Zhang Dammann R. Pfeifer G.P. Avruch J. Oncogene. 2002; 21: PubMed Scopus Google Scholar). of Nore1 a of Cell the biological properties of Nore1, we to cell lines that Nore1. human lung cells were transfected with Nore1 in a expression vector After 2 of selection in were and Fig. 2 shows that vector cells with the full-length Nore1. with activated Ras not cell growth (data not shown). were with multiple cell lines lung cell lines and NIH 3T3 cells (data not shown). Nore1-mediated Ras-dependent and determine the effects of Ras the growth properties of Nore1, 293-T cells were transfected with Nore1 and The growth inhibition mediated by Nore1 was in the of activated in the of the negative negative of Ras was not as it is growth The growth inhibition to be in as with the it be with 293 cells (data not shown). that Nore1 cell in these was used to the of cells in the Nore1 transfected the effects of Nore1 expression activation were using the (Clontech). this the protein to the the Cells the fluorescent Nore1 protein were found to have the fluorescent protein in the and cells the protein not cell in 293 293 cells were transfected with of vector or Nore1. cells were was in to a of 10% in both cell death. cells were transfected with either of or and fluorescent After cells were using fluorescent to the of the protein in positive Nore1 mRNA in Human the expression of Nore1 mRNA in normal human we performed analysis using a fragment of the human cDNA as a Nore1 was in to some was in and of Nore1 in Human Cell Nore1 at a protein we a polyclonal (see The can both and (24Tommasi S. Dammann R. Jin S.G. Zhang X.X. Avruch J. Pfeifer G.P. Oncogene. 2002; 21: 2713-2720Crossref PubMed Scopus (94) Google Scholar, S. Khokhlatchev A. Nedwidek M. Zhang Dammann R. Pfeifer G.P. Avruch J. Oncogene. 2002; 21: PubMed Scopus Google Scholar). from a of human lung tumor cell lines and lung cell line were and protein were to analysis for Nore1 of cell was used as an internal control for protein The primary lung and the cells not the However, the of tumor cell lines have The was at in tumor cell line. experiments were performed to the of the Nore1 (data not shown). Nore1 in the of the in that the loss of Nore1 expression was not of the of cells in we a of primary lung tumor by with Nore1 Nore1 expression can be in the normal expression appears to be reduced or in the of the Furthermore, a of primary small cell lung demonstrated that were also negative for Nore1 expression with small cell lung that showed Nore1 of the of these experiments are and shown in Fig. Nore1 by in is related structurally to the Ras effector/tumor suppressor RASSF1. Although the RASSF1 gene is in a region of the are in lung RASSF1 is of promoter methylation not G.P. Yoon J.H. L. Tommasi S. Dammann R. Biol. Chem. 2002; PubMed Scopus Google Scholar, A. S. A. A. J. P. A. R. S. F. Oncogene. PubMed Scopus Google Scholar, E. S. L. Gao B. D. M. A. S. F. S. S. E. M. J. Natl. Cancer Inst. PubMed Scopus Google Scholar). Nore1 is also at a region of the which has been to tumor G. P. D. M. Cancer Res. Google Scholar). To determine Nore1 is in Nore1 negative tumor cell lines we with and it to analysis using the Nore1 cDNA as a internal fragment was in cell lines we to loss of the Nore1 gene. To determine the of Nore1 expression in and cells might be of promoter we the methylation of a of the of region a restriction site for was with and to analysis using a of the 1.6-kb promoter region of the of GenBank™ version of the site is to a fragment that with the The was in the and cell for Nore1 not in the or cell for Nore1 To that epigenetic effects were for the loss of Nore1 expression in lung tumor cells we the human lung tumor cell line with the We also the cells with a A. We then the effects of Nore1 protein expression by an in Nore1 expression Nore1 it Thus, promoter by methylation rather than or gene is the mechanism the of Nore1 expression in lung tumor of cells with not Nore1 cells were and for Nore1 expression using as a positive control for gene of Nore1 into Human Cells to in Soft human lung cells are negative for the expression of Nore1 (see Fig. of Nore1 driven by a promoter in cell death. Moreover, to Nore1 cell of cell in the of (data not shown). Consequently, to determine the effects of Nore1 to we cloned the Nore1 promoter from the clone into (Promega). We then replaced the luciferase gene with Nore1 with the Nore1 cDNA under the control of its own promoter, was then into cells in with the vector (25Fiordalisi J.J. Johnson R.L. Ulku A.S. Der C.J. Cox A.D. Methods Enzymol. 1901; 332: 3-36Crossref Scopus (46) Google Scholar). After of cells normally and were for the expression of Nore1 and for ability to in soft agar. Fig. shows that the of the that in soft agar was reduced in the of Nore1. Fig. shows that the number of that in agar was also The of Nore1 expression by the promoter fragment are shown in Fig. were from (data not shown). Thus, re-introduction of Nore1 expression under the control of its promoter the tumorigenic properties of a tumor cell line that Nore1 Activated forms of Ras can both positive and cellular growth and (20Frame S. Balmain A. Curr. Opin. Genet. Dev. 2000; 10: 106-113Crossref PubMed Scopus (87) Google Scholar). Ras is not in this as a role has been described for the Genet. 1998; Full Text Full Text PDF PubMed Scopus Google Scholar). that and are and that this may an in the of The ability of activated Ras to induce senescence, cell cycle or apoptosis is well (15Serrano M. Lin A.W. McCurrach M.E. Beach D. Lowe S.W. Cell. 1997; 88: 593-602Abstract Full Text Full Text PDF PubMed Scopus (3965) Google Scholar, C.Y. Faller D.V. Oncogene. 1995; 11: 1487-1498PubMed Google Scholar, A. B. H. Mol. Cell. Biol. 1997; 17: PubMed Scopus Google Scholar, J. D. M. Dev. 1998; 12: PubMed Scopus Google Scholar, S. C. T. M. H. M. Chen A. M. S. Oncogene. 1999; PubMed Scopus Google Scholar). However, the these effects of Ras remain poorly Although activation of the protein can growth inhibition and J. D. M. Dev. 1998; 12: PubMed Scopus Google Scholar, M. J. Biol. Chem. PubMed Google Scholar), it is that such can under that Ras may also be able to may that of the Ras to cell must be a of the of a Ras-dependent Ras proteins can interact with a array of effector The effectors that mediate of the positive aspects of Ras function are relatively well and include the and the family (1Malumbres M. Pellicer A. Front. Biosci. 1998; 3: d887-d912Crossref PubMed Scopus (12) Google Scholar, 2Campbell S.L. Khosravi-Far R. Rossman K.L. Clark G.J. Der C.J. Oncogene. 1998; 17: 1395-1413Crossref PubMed Scopus (920) Google Scholar, C.A. Clark J. Cell. 2000; 12: PubMed Scopus Google Scholar). these effector proteins are oncoproteins in own However, we demonstrated that the tumor suppressor RASSF1 also serve as a potential Ras effector (22Vos M.D. Ellis C.A. Bell A. Birrer M.J. Clark G.J. J. Biol. Chem. 2000; 275: 35669-35672Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). Ras may regulate tumor suppressors as well as RASSF1 has related family described in the data such protein is the Ras effector Nore1. Consequently, we were in Nore1 also the properties of a tumor suppressor that can be activated by We found that cell lines the expression of Nore1. cells that produce protein are may be of a or of the to regulate Nore1 over the cell cycle from a 293-T Nore1 growth inhibition is Ras-dependent. activated Ras the and negative Ras Khokhlatchev et al. (23Khokhlatchev A. Rabizadeh S. Xavier R. Nedwidek M. Chen T. Zhang X.F. Seed B. Avruch J. Curr. Biol. 2002; 12: 253-265Abstract Full Text Full Text PDF PubMed Scopus (328) Google Scholar) have shown that Nore1, like RASSF1 (22Vos M.D. Ellis C.A. Bell A. Birrer M.J. Clark G.J. J. Biol. Chem. 2000; 275: 35669-35672Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar), can induce apoptosis in 293-T We have also found that the growth inhibition appears to in shows cell in Nore1 transfected the of the cells from growth and activation can be in Nore1 transfected 293-T Thus, like RASSF1, Nore1 has the potential to mediate some of the growth of Nore1 as a tumor suppressor in then we to a loss of Nore1 protein expression tumor We a Nore1 polyclonal and used it to a of human lung tumor cell lines for Nore1 we used a lung cell line and a of primary lung Nore1 has the potential to in to the full-length Nore1, and a Tommasi et al. (24Tommasi S. Dammann R. Jin S.G. Zhang X.X. Avruch J. Pfeifer G.P. Oncogene. 2002; 21: 2713-2720Crossref PubMed Scopus (94) Google Scholar) have shown that the expression of mRNA for is and that of reduced in lung tumor cell line. We have found that the not the appears to be in cells and that both are or reduced in lung tumor cell was between Nore1 expression and the or of a has been confirmed M. M. M.M. Oncogene. 2002; 21: PubMed Google Scholar) for and RASSF1. However, activation of the Ras can in the of a in Ras A. M.M. G. A. Oncogene. 1997; Scopus Google Scholar). Moreover, RASSF1 or Nore1 loss of function by Consequently, a between a of Ras function and loss of Nore1 function may be to To the that the loss of Nore1 expression was of the of cells grown in we also performed analysis of a of primary human lung We found that of these like the cell the expression of Nore1. was for the small cell lung The human Nore1 gene to is the site of a potential tumor suppressor in human as of loss of at this G. P. D. M. Cancer Res. Google Scholar). Moreover, analysis of the data base of at the Cancer showed that the in a wide variety of human of the these we evidence of of Nore1 in Nore1 negative lung tumor cell lines by However, these experiments not the of a the RASSF1 gene is a region of the that it appears that RASSF1 is not the of deletion. frequently by promoter methylation G.P. Yoon J.H. L. Tommasi S. Dammann R. Biol. Chem. 2002; PubMed Scopus Google Scholar). To the that Nore1 was down-regulated by promoter we an of the promoter of of the in a restriction with a we found enhanced methylation of the promoter in Moreover, of Nore1 protein expression be by the cells with a Nore1 and RASSF1 to a mechanism of Tommasi et al. (24Tommasi S. Dammann R. Jin S.G. Zhang X.X. Avruch J. Pfeifer G.P. Oncogene. 2002; 21: 2713-2720Crossref PubMed Scopus (94) Google Scholar) tumor cell lines and were unable to promoter methylation by PCR of that a was with the promoter, this was described as data not At it is to than the that was Finally, we to Nore1 expression in a Nore1 negative cell line to determine we a of the transformed phenotype of the we used a of vector the Nore1 vector to be growth using T. M. Res. 1997; PubMed Scopus Google Scholar), and J. H. Res. 25: Scopus Google Scholar). The that normally and not induce Nore1 protein (data not shown). To these we to the Nore1 promoter and the Nore1 cDNA under its control. of transfected lung tumor cells as well as a line Nore1, and normal and growth (data not shown). However, these cells showed growth in soft agar. The of this promoter fragment is for the relatively of Nore1 expression in the transfected cloned cells were not for Nore1 expression and expression and to a Nore1 negative phenotype (data not shown). mechanism for this be promoter methylation. Thus, we that Nore1 is a Ras-regulated tumor suppressor of the RASSF1 family that may a role in the of human tumors.