The Enzymatic Activity of CEM15/Apobec-3G Is Essential for the Regulation of the Infectivity of HIV-1 Virion but Not a Sole Determinant of Its Antiviral Activity

Abstract

Human immunodeficiency virus, type 1 (HIV-1) Vif protein plays an essential role in the regulation of the infectivity of HIV-1 virion. Vif functions to counteract an anti-HIV-1 cellular factor in non-permissive cells, CEM15/Apobec-3G, which shares a cytidine deaminase motif. CEM15/Apobec-3G deaminates dC to dU in the minus strand DNA of HIV-1, resulting in G to A hypermutation in the plus strand DNA. In this study, we have done the mutagenesis analysis on two cytidine deaminase motifs in CEM15/Apobec-3G and examined their antiviral functions as well as the DNA editing activity. Point mutations in the C-terminal active site such as E259Q and C291A almost completely abrogated the antiviral function, while those in the N-terminal active site such as E67Q and C100A retained this activity to a lesser extent as compared with that of the wild type. The DNA editing activities of E67Q and E259Q mutants were both retained but impaired to the same extent. This indicates that the enzymatic activity of this protein is essential but not a sole determinant of the antiviral activity. Furthermore, all the deletion mutants tested in this study lost the antiviral activity because of the loss of the activity for dimerization, suggesting that the entire protein structure is necessary for the antiviral function. Human immunodeficiency virus, type 1 (HIV-1) Vif protein plays an essential role in the regulation of the infectivity of HIV-1 virion. Vif functions to counteract an anti-HIV-1 cellular factor in non-permissive cells, CEM15/Apobec-3G, which shares a cytidine deaminase motif. CEM15/Apobec-3G deaminates dC to dU in the minus strand DNA of HIV-1, resulting in G to A hypermutation in the plus strand DNA. In this study, we have done the mutagenesis analysis on two cytidine deaminase motifs in CEM15/Apobec-3G and examined their antiviral functions as well as the DNA editing activity. Point mutations in the C-terminal active site such as E259Q and C291A almost completely abrogated the antiviral function, while those in the N-terminal active site such as E67Q and C100A retained this activity to a lesser extent as compared with that of the wild type. The DNA editing activities of E67Q and E259Q mutants were both retained but impaired to the same extent. This indicates that the enzymatic activity of this protein is essential but not a sole determinant of the antiviral activity. Furthermore, all the deletion mutants tested in this study lost the antiviral activity because of the loss of the activity for dimerization, suggesting that the entire protein structure is necessary for the antiviral function. HIV-1 Vif protein plays a crucial role to regulate the virion infectivity (1Simon J.H. Sheehy A.M. Carpenter E.A. Fouchier R.A. Malim M.H. J. Virol. 1999; 73: 2675-2681Crossref PubMed Google Scholar, 2Simon J.H. Miller D.L. Fouchier R.A. Soares M.A. Peden K.W. Malim M.H. EMBO J. 1998; 17: 1259-1267Crossref PubMed Scopus (122) Google Scholar) and in vivo pathogenesis (3Desrosiers R.C. Lifson J.D. Gibbs J.S. Czajak S.C. Howe A.Y. Arthur L.O. Johnson R.P. J. Virol. 1998; 72: 1431-1437Crossref PubMed Google Scholar). Vif plausibly acts at a late stage of the viral life cycle to enhance the infectivity of progeny virions 10–100-fold. Viruses deficient in vif (Δvif) display their non-infectious phenotype when produced by primary human T cells and a restricted number of cell lines such as H9 and CEM. These cells are termed non-permissive, whereas many other cell lines, such as SupT1 and 293T, which support the production of infectious Δvif virions, are termed permissive (1Simon J.H. Sheehy A.M. Carpenter E.A. Fouchier R.A. Malim M.H. J. Virol. 1999; 73: 2675-2681Crossref PubMed Google Scholar, 2Simon J.H. Miller D.L. Fouchier R.A. Soares M.A. Peden K.W. Malim M.H. EMBO J. 1998; 17: 1259-1267Crossref PubMed Scopus (122) Google Scholar). Previous studies suggested that non-permissive cells possess certain cellular anti-HIV-1 factor(s) to suppress the virion infectivity, which is overcome by Vif (4Simon J.H. Gaddis N.C. Fouchier R.A. Malim M.H. Nat. Med. 1998; 4: 1397-1400Crossref PubMed Scopus (244) Google Scholar, 5Madani N. Kabat D. J. Virol. 1998; 72: 10251-10255Crossref PubMed Google Scholar). Recently a candidate of this host factor, referred to as CEM15, has been identified (6Sheehy A.M. Gaddis N.C. Choi J.D. Malim M.H. Nature. 2002; 418: 646-650Crossref PubMed Scopus (1914) Google Scholar), which turned out identical to Apobec-3G (7Jarmuz A. Chester A. Bayliss J. Gisbourne J. Dunham I. Scott J. Navaratnam N. Genomics. 2002; 79: 285-296Crossref PubMed Scopus (590) Google Scholar). Expression of CEM15/Apobec-3G in permissive cells could give non-permissive phenotype, suggesting that this protein is essential and sufficient for non-permissive phenotype in these cells (6Sheehy A.M. Gaddis N.C. Choi J.D. Malim M.H. Nature. 2002; 418: 646-650Crossref PubMed Scopus (1914) Google Scholar). CEM15/Apobec-3G is homologous to an RNA editing enzyme, Apobec-1, and belongs to the Apobec superfamily, which shares a cytidine deaminase motif and consists of Apobec-1 (8Teng B. Burant C.F. Davidson N.O. Science. 1993; 260: 1816-1819Crossref PubMed Scopus (496) Google Scholar, 9Navaratnam N. Morrison J.R. Bhattacharya S. Patel D. Funahashi T. Giannoni F. Teng B.B. Davidson N.O. Scott J. J. Biol. Chem. 1993; 268: 20709-20712Abstract Full Text PDF PubMed Google Scholar, 10Anant S. MacGinnitie A.J. Davidson N.O. J. Biol. Chem. 1995; 270: 14762-14767Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), AID (11Muramatsu M. Sankaranand V.S. Anant S. Sugai M. Kinoshita K. Davidson N.O. Honjo T. J. Biol. Chem. 1999; 274: 18470-18476Abstract Full Text Full Text PDF PubMed Scopus (946) Google Scholar, 12Muramatsu M. Kinoshita K. Fagarasan S. Yamada S. Shinkai Y. Honjo T. Cell. 2000; 102: 553-563Abstract Full Text Full Text PDF PubMed Scopus (2703) Google Scholar), Apobec-2 (13Anant S. Mukhopadhyay D. Sankaranand V. Kennedy S. Henderson J.O. Davidson N.O. Am. J. Physiol. 2001; 281: C1904-C1916Crossref PubMed Google Scholar), and Apobec-3 (7Jarmuz A. Chester A. Bayliss J. Gisbourne J. Dunham I. Scott J. Navaratnam N. Genomics. 2002; 79: 285-296Crossref PubMed Scopus (590) Google Scholar, 14Harris R.S. Petersen-Mahrt S.K. Neuberger M.S. Mol. Cell. 2002; 10: 1247-1253Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar). This sequence similarity leads us to ask whether CEM15/Apobec-3G acts as an RNA editing enzyme to regulate the virion infectivity, although it has not been demonstrated to have any RNA editing activity. On the other hand, CEM15/Apobec-3G has been shown to act as a DNA mutator (14Harris R.S. Petersen-Mahrt S.K. Neuberger M.S. Mol. Cell. 2002; 10: 1247-1253Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar). In fact, several recent studies have revealed that CEM15/Apobec-3G deaminates dC to dU in the newly synthesized minus strand DNA of HIV-1, resulting in G to A hypermutation of the viral plus strand DNA (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar, 16Mangeat B. Turelli P. Caron G. Friedli M. Perrin L. Trono D. Nature. 2003; 424: 99-103Crossref PubMed Scopus (1248) Google Scholar, 17Harris R.S. Bishop K.N. Sheehy A.M. Craig H.M. Petersen-Mahrt S.K. Watt I.N. Neuberger M.S. Malim M.H. Cell. 2003; 113: 803-809Abstract Full Text Full Text PDF PubMed Scopus (1144) Google Scholar). However, precise mechanisms how exactly the enzymatic activity of CEM15/Apobec-3G regulates the virion infectivity and how Vif protein overcomes the function of this protein remain unclear. Since point mutations in essential amino acids in a cytidine deaminase motif of Apobec-1 abolished a cytidine deaminase activity as well as RNA editing activity (18Navaratnam N. Bhattacharya S. Fujino T. Patel D. Jarmuz A.L. Scott J. Cell. 1995; 81: 187-195Abstract Full Text PDF PubMed Scopus (157) Google Scholar, 19Yamanaka S. Poksay K.S. Balestra M.E. Zeng G.Q. Innerarity T.L. J. Biol. Chem. 1994; 269: 21725-21734Abstract Full Text PDF PubMed Google Scholar, 20MacGinnitie A.J. Anant S. Davidson N.O. J. Biol. Chem. 1995; 270: 14768-14775Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), we have examined the involvement of the enzymatic activity of CEM15/Apobec-3G in the regulation of the virion infectivity of HIV-1 using site-directed mutagenesis. Expression Vectors and Molecular Clones—The human CEM15/Apobec-3G cDNA was amplified from H9 cDNA by reverse transcription-PCR method and cloned into pcDNA4/HisMax vector (Invitrogen) for expression of His-tagged CEM15/Apobec-3G (His-CEM15). pDON/EGFP 1The abbreviations used are: EGFP, enhanced green fluorescent protein; HIV-1, human immunodeficiency virus, type 1; mAb, monoclonal antibody; Ab, antibody; WT, wild type. vector was created for expression of N-terminal EGFP fusion protein by cloning EGFP cDNA into pDON-AI vector (Takara Bio Inc., Otsu, Japan). Complementary DNA for CEM15/Apobec-3G was also cloned into pDON/EGFP for expression of EGFP-fused CEM15/Apobec-3G (EGFP-CEM15). Expression vectors for point mutants as shown in Fig. 2A and deletion mutants as shown in Fig. 4A were generated by PCR methods and cloned into pcDNA4/HisMax and/or pDON/EGFP vectors. pNL43-Luc was constructed from pNL4-3 (21Adachi A. Gendelman H.E. Koenig S. Folks T. Willey R. Rabson A. Martin M.A. J. Virol. 1986; 59: 284-291Crossref PubMed Google Scholar) and pNL4-3.Luc.R–E– (22He J. Choe S. Walker R. Di Marzio P. Morgan D.O. Landau N.R. J. Virol. 1995; 69: 6705-6711Crossref PubMed Scopus (0) Google Scholar). pNL43/Δvif-Luc was constructed as described previously (2Simon J.H. Miller D.L. Fouchier R.A. Soares M.A. Peden K.W. Malim M.H. EMBO J. 1998; 17: 1259-1267Crossref PubMed Scopus (122) Google Scholar).Fig. 4Deletion mutants lost the antiviral activity because of the loss of the activity for dimerization. A, protein structure of CEM15/Apobec-3G and deletion mutants. B, all the deletion mutants lost the antiviral activity on Δvif virions as well as WT virions. We transfected pNL43-Luc (WT) or pNL43/Δvif-Luc (Δvif) together with a series of pDON/EGFP-based vectors for deletion mutants. Infectivity assay was done, and values are presented as described in the legend to Fig. 1. C, analysis of homodimerization of point and deletion mutants by coimmunoprecipitation assay. We transfected pcDNA4/His-CEM15 together with pDON/EGFP-based vectors for wild type and mutants. Cell lysates were immunoprecipitated with anti-EGFP mAbs and subjected to immunoblotting with anti-His tag Ab.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Cell Lines—HEK293T cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal calf serum and penicillin, streptomycin, and glutamine (Invitrogen). M8166 cells were maintained in RPMI 1640 (Sigma) containing 10% fetal calf serum and penicillin, streptomycin, and glutamine. Infectivity Assay—Luciferase reporter viruses with or without Vif were prepared in HEK293T cells by cotransfection of pNL43-Luc or pNL43/Δvif-Luc together with a mock-vector or expression vectors for CEM15/Apobec-3G or its mutants by the calcium phosphate method. Viruses in the supernatants were collected after 48 h of transfection and virus titers were measured with an enzyme-linked immunosorbent assay kit for the p24 antigen (RETRO-TEK, ZeptoMetrix Corporation, Buffalo, NY). An adjusted amount of viruses was challenged to target cells, M8166. On day 2 postinfection, the cells were lysed in passive lysis buffer (Promega, Madison, WI), and the luciferase activity was measured with a Luminometer (EG&G Berthold, Bad Wildbad, Germany). Values were presented as percent infectivity relative to the value of wild type virus without expression of CEM15/Apobec-3G. Coimmunoprecipitation Assay—To see protein-protein interaction in vivo, we performed an immunoprecipitation assay as described previously (23Takaori-Kondo A. Hori T. Fukunaga K. Morita R. Kawamata S. Uchiyama T. Biochem. Biophys. Res. Commun. 2000; 272: 856-863Crossref PubMed Scopus (31) Google Scholar). In brief, an expression vector for His-CEM15 was cotransfected with EGFP-CEM15 and various mutants into HEK293T cells by calcium phosphate method. Two days after transfection, cells were lysed with lysing buffer. Cell lyates were immunoprecipitated with anti-EGFP monoclonal antibodies (mAbs) (kindly provided by Dr. A. Imura, Kyoto University) and protein G-Sepharose™ beads and subjected to immunoblotting with anti-His tag Ab (Babco, Berkeley, CA). His-CEM15 was visualized by ECL detection system (Amersham Biosciences). Detection of Hypermutation in the Viral DNA—Hypermutation of HIV-1 DNA was detected using endogenous reverse transcription as described previously (24Lecossier D. Bouchonnet F. Clavel F. Hance A.J. Science. 2003; 300: 1112Crossref PubMed Scopus (588) Google Scholar). In brief, after treated with DNase I, viral stocks were incubated at 39 °C for 120 min. DNA was purified and amplified using the following primer pairs: op-6.4 (CCATGCTCCTTGGGATATTG) and op-29.10 (CCTCCTGAGGATTGCTTAAA). The PCR products were cloned into pT7-Blue (Novagen, Madison, WI), and the inserts of individual clones were sequenced. Expression of CEM15/Apobec-3G Is Sufficient for Non-permissive Phenotype—First, we transfected pcDNA4/His-CEM15 or pDON/EGFP-CEM15 together with pNL43/Luc (WT) or pNL43/Δvif-Luc (Δvif) into HEK293T cells, prepared viruses, and tested the infectivity. As shown in Fig. 1, transient expression of His-CEM15 or EGFP-CEM15 clearly suppressed the infectivity of Δvif virions in a dose-dependent manner as reported previously (6Sheehy A.M. Gaddis N.C. Choi J.D. Malim M.H. Nature. 2002; 418: 646-650Crossref PubMed Scopus (1914) Google Scholar). This indicated that His- and EGFP-tagged protein could suppress the infectivity of Δvif virions and that expression of CEM15/apobec-3G was sufficient to give non-permissive phenotype to HEK293T cells. Interestingly, the infectivity of WT virions was also suppressed by CEM15/Apobec-3G in a dose-dependent manner to a lesser extent. Site-directed Mutagenesis of CEM15/Apobec-3G—CEM15/Apobec-3G has sequence similarity with Apobec-1 that shares a conserved active site motif, designated as H-X-E-(X)24–30-P-C-X-X-C, in which a histidine and two cysteines coordinate Zn2+ and a glutamate serves as a proton donor in the deamination reaction (Fig. 2A). Replacement of any of these four amino acids results in a catalytic mutant with the complete loss of its cytidine deaminase activity (18Navaratnam N. Bhattacharya S. Fujino T. Patel D. Jarmuz A.L. Scott J. Cell. 1995; 81: 187-195Abstract Full Text PDF PubMed Scopus (157) Google Scholar, 19Yamanaka S. Poksay K.S. Balestra M.E. Zeng G.Q. Innerarity T.L. J. Biol. Chem. 1994; 269: 21725-21734Abstract Full Text PDF PubMed Google Scholar, 20MacGinnitie A.J. Anant S. Davidson N.O. J. Biol. Chem. 1995; 270: 14768-14775Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Since CEM15/apobec-3G protein has two conserved active sites, we generated a series of point mutants as shown in Fig. 2A to determine whether the enzymatic activity is necessary for the regulation of the virion infectivity and which active site is involved in this antiviral function. First, we tested the antiviral function of His-tagged H257R. An H257R mutant did not suppress the infectivity of HIV-1 virions. However, expression level of this mutant was quite lower (about 1/10) than that of the wild type (data not shown). Because we also experienced poor expression of some mutants as His-tagged proteins, we instead generated these mutants as EGFP fusion proteins and obtained similar levels of expression of all the mutants (data not shown). We then examined the antiviral function of these mutants. As shown in Fig. 2B, E259Q and C291A mutants lost the suppressive effect on the infectivity of Δvif virions entirely, while E67Q and C100A mutants showed the similar, but slightly reduced, antiviral effect as compared with the wild type. This indicates that the enzymatic activity of the C-terminal active site containing Glu259 and Cys291 is necessary for the antiviral function, while that of the N-terminal active site containing Glu67 and Cys100 dispensable, suggesting two possibilities as follows. One is that the N-terminal active site does not possess the catalytic activity itself. Another is that the activity of this site is dispensable for the antiviral function, although it possesses the enzymatic activity. The DNA Editing Activities of E67Q and E259Q Mutants Were Both Retained but Impaired to the the we examined the of hypermutation in the viral DNA by expression of these recent showed that expression of CEM15/Apobec-3G G to A hypermutation in the viral DNA in the of Vif protein (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar, 16Mangeat B. Turelli P. Caron G. Friedli M. Perrin L. Trono D. Nature. 2003; 424: 99-103Crossref PubMed Scopus (1248) Google Scholar, 17Harris R.S. Bishop K.N. Sheehy A.M. Craig H.M. Petersen-Mahrt S.K. Watt I.N. Neuberger M.S. Malim M.H. Cell. 2003; 113: 803-809Abstract Full Text Full Text PDF PubMed Scopus (1144) Google Scholar). As shown in Fig. the wild type CEM15/Apobec-3G clearly G to A hypermutation in the viral DNA (Fig. but vector did not (data not as described previously (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar, 16Mangeat B. Turelli P. Caron G. Friedli M. Perrin L. Trono D. Nature. 2003; 424: 99-103Crossref PubMed Scopus (1248) Google Scholar). this assay revealed that of E67Q and E259Q mutants retained the activity to some mutations in the viral but the of mutations was lower than that of the wild type. (Fig. and These results that both mutants retained some enzymatic this enzymatic activity did not the antiviral activity of these mutants. Interestingly, CEM15/Apobec-3G could G to A mutations in the viral DNA of WT virus to a lesser extent to the virion infectivity 1 and Mutants to the of the for generated a series of deletion mutants as shown in Fig. 4A to the whether the C-terminal active site is for the antiviral function. However, as shown in Fig. all the deletion mutants lost the antiviral effect on Δvif virions as well as WT virions. of the cytidine act as or A. C. L. S. A. 1994; PubMed Scopus Google Scholar, N. Fujino T. Bayliss J. Jarmuz A. A. N. A. Bhattacharya S. C. Scott J. J. Mol. Biol. 1998; PubMed Scopus Google Scholar), and deletion mutants of have lost their RNA editing to the loss of activity N. Fujino T. Bayliss J. Jarmuz A. A. N. A. Bhattacharya S. C. Scott J. J. Mol. Biol. 1998; PubMed Scopus Google Scholar). we that deletion mutants lost the antiviral activity because these not the this we performed an immunoprecipitation assay to the protein-protein interaction His-CEM15 and As shown in Fig. EGFP-CEM15 and EGFP point mutants His-CEM15 2 and but EGFP deletion mutants did not This that the deletion of this protein the interaction CEM15/Apobec-3G but point did the entire protein structure of CEM15/Apobec-3G necessary for the antiviral activity and the loss of the for by deletion to the loss of this function as reported with In this study, we demonstrated that the antiviral function of the C-terminal active site of CEM15/Apobec-3G is than that of the N-terminal active both active have similar DNA editing on mutagenesis studies on Apobec-1 (18Navaratnam N. Bhattacharya S. Fujino T. Patel D. Jarmuz A.L. Scott J. Cell. 1995; 81: 187-195Abstract Full Text PDF PubMed Scopus (157) Google Scholar, 19Yamanaka S. Poksay K.S. Balestra M.E. Zeng G.Q. Innerarity T.L. J. Biol. Chem. 1994; 269: 21725-21734Abstract Full Text PDF PubMed Google Scholar, 20MacGinnitie A.J. Anant S. Davidson N.O. J. Biol. Chem. 1995; 270: 14768-14775Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), we generated a series of point mutants and examined their antiviral function as well as the DNA editing activity. was the and those reported in the studies (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar, 16Mangeat B. Turelli P. Caron G. Friedli M. Perrin L. Trono D. Nature. 2003; 424: 99-103Crossref PubMed Scopus (1248) Google Scholar). Zhang (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar) reported that point mutants such as and with the cytidine deaminase activity (about to of the wild showed the impaired activity to G to A hypermutation as well as to suppress the infectivity of Δvif virion. B. Turelli P. Caron G. Friedli M. Perrin L. Trono D. Nature. 2003; 424: 99-103Crossref PubMed Scopus (1248) Google Scholar) reported that point mutants such as and showed the impaired antiviral activity on Δvif virion. Both showed that point mutants in any of four amino of active site lost their antiviral However, we clearly demonstrated that the C-terminal active site is for its antiviral while the N-terminal active site is dispensable for this function. We also clearly demonstrated that point mutants in active site retained the DNA editing activity but impaired as compared with that of the wild type. These DNA editing activities of E67Q and E259Q mutants were similar, although an E67Q mutant was than an E259Q mutant for its antiviral activity. These results that both active possess the DNA editing activity and that the of active site by point but retained the DNA editing which from the other active Furthermore, active site has a to suppress the virion infectivity. We have several for this and One is that all mutants have N-terminal while both by Zhang and (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar, 16Mangeat B. Turelli P. Caron G. Friedli M. Perrin L. Trono D. Nature. 2003; 424: 99-103Crossref PubMed Scopus (1248) Google Scholar) used C-terminal and The of C-terminal or tag the antiviral activity of point mutants in the N-terminal active or the of tag on the the antiviral effect of mutants in the N-terminal active The is that it was to the the of mutants we and and those and and mutations completely the DNA editing activity. mutant study revealed that the entire protein structure is necessary for the function of CEM15/Apobec-3G. Previous studies on Apobec-1 demonstrated that deletion of amino acids at or amino at not activity but also RNA activity and the for suggesting that homodimerization of Apobec-1 is necessary for its catalytic activity. In study, deletion of amino acids at the or amino acids at the abolished the antiviral activity as well as the for dimerization. This that the loss of the for homodimerization leads to the loss of the antiviral function as in the with Interestingly, CEM15/Apobec-3G also suppressed the infectivity of wild type virus to a lesser which was also abolished in catalytic mutants. We have also shown that CEM15/Apobec-3G G to A mutations in the viral DNA of wild type HIV-1 These that CEM15/Apobec-3G acts on wild type virus to a lesser in the of Vif This is with that reported by Zhang (15Zhang H. Yang B. Pomerantz R.J. Zhang C. Arunachalam S.C. Gao L. Nature. 2003; 424: 94-98Crossref PubMed Scopus (919) Google Scholar), in which the viral DNA of the wild type HIV-1 after several in non-permissive cells. it how wild type virus and in vivo in primary T cells CEM15/Apobec-3G. study clearly showed that the enzymatic activity of CEM15/Apobec-3G is essential but not a sole determinant of its antiviral function. However, it how HIV-1 Vif protein and the function of CEM15/Apobec-3G to infectious viruses from non-permissive cells. this could give us in the regulation of the virion infectivity by Vif protein and us to a for HIV-1 We are to Dr. for anti-EGFP The following were obtained the and of of pNL4-3 from Dr. Martin and from