Characterization of Regulatory Elements and Methylation Pattern of the Autoimmune Regulator (AIRE) Promoter

Abstract

Defects in the AIRE gene cause a monogenic autoimmune syndrome APECED (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy), which is characterized by loss of self-tolerance to multiple organs. In concordance with its role in immune tolerance, AIRE is most strongly expressed in thymic epithelial cells and in cells of monocytic-dendritic lineage. The AIRE protein has been shown to function as a transcriptional regulator, however, the mechanisms regulating AIRE gene expression are not known. Here we have characterized the AIRE promoter region by identifying a minimal promoter region within 350 bp of the translation initiation codon. Electrophoretic mobility shift assays and transient transfections with mutated promoter constructs revealed a functional TATA box (-163 to -153) and binding sites for transcription complexes AP-1 (-307 to -296), NF-Y (-213 to -202), and Sp1 (-202 to -189). The presence of a 390-bp CpG island within the proximal promoter suggested that cytosine methylation has a role in transcriptional regulation of AIRE, which was supported by in vitro methylation experiments of promoter constructs. Sodium bisulfite sequencing showed a less methylated status of AIRE promoter in the thymic epithelial cell line TEC1A3 compared with HeLa and monocytic cells U937 and THP-1. Real-time PCR analysis showed that treatment with 5-aza-2′-deoxycytidine (5-azaCdR), a DNA methyltransferase inhibitor, up-regulated AIRE transcript levels in TEC1A3, U937, and HeLa cells and that even greater activations in TEC1A3 and U937 cells were observed using combined treatments with deacetylase inhibitor trichostatin A. These results suggest that AIRE gene expression is modulated through modifications in chromatin methylation and acetylation. Defects in the AIRE gene cause a monogenic autoimmune syndrome APECED (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy), which is characterized by loss of self-tolerance to multiple organs. In concordance with its role in immune tolerance, AIRE is most strongly expressed in thymic epithelial cells and in cells of monocytic-dendritic lineage. The AIRE protein has been shown to function as a transcriptional regulator, however, the mechanisms regulating AIRE gene expression are not known. Here we have characterized the AIRE promoter region by identifying a minimal promoter region within 350 bp of the translation initiation codon. Electrophoretic mobility shift assays and transient transfections with mutated promoter constructs revealed a functional TATA box (-163 to -153) and binding sites for transcription complexes AP-1 (-307 to -296), NF-Y (-213 to -202), and Sp1 (-202 to -189). The presence of a 390-bp CpG island within the proximal promoter suggested that cytosine methylation has a role in transcriptional regulation of AIRE, which was supported by in vitro methylation experiments of promoter constructs. Sodium bisulfite sequencing showed a less methylated status of AIRE promoter in the thymic epithelial cell line TEC1A3 compared with HeLa and monocytic cells U937 and THP-1. Real-time PCR analysis showed that treatment with 5-aza-2′-deoxycytidine (5-azaCdR), a DNA methyltransferase inhibitor, up-regulated AIRE transcript levels in TEC1A3, U937, and HeLa cells and that even greater activations in TEC1A3 and U937 cells were observed using combined treatments with deacetylase inhibitor trichostatin A. These results suggest that AIRE gene expression is modulated through modifications in chromatin methylation and acetylation. Mutations in the autoimmune regulator (AIRE) 1The abbreviations used are: AIRE, autoimmune regulator promoter; APECED, autoimmune polyendocrinopathy candidiasis ectodermal dystrophy; 5-azaCdR, 5-aza-2′-deoxycytidine; TSA, trichostatin A; EMSA, electrophoretic mobility shift assay; DTT, dithiothreitol; RT, real-time; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.1The abbreviations used are: AIRE, autoimmune regulator promoter; APECED, autoimmune polyendocrinopathy candidiasis ectodermal dystrophy; 5-azaCdR, 5-aza-2′-deoxycytidine; TSA, trichostatin A; EMSA, electrophoretic mobility shift assay; DTT, dithiothreitol; RT, real-time; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. gene cause an autosomal recessive disease called APECED (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy) (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar, 2The Finnish-German APECED Consortium Nat. Genet. 1997; 17: 399-403Crossref PubMed Scopus (1015) Google Scholar). The syndrome, occurring as a result of defective tolerance to self-antigens, is characterized by endocrine organ-specific autoimmunity and chronic mucocutaneous candidiasis and ectodermal disorders (3Ahonen P. Myllärniemi S. Sipilä I. Perheentupa J. N. Engl. J. Med. 1990; 322: 1829-1836Crossref PubMed Scopus (859) Google Scholar). AIRE encodes a 58-kDa protein with structural motifs indicative of a transcriptional regulator having a conserved nuclear localization signal, two plant homeodomain zinc-finger motifs, four LXXLL or nuclear receptor box motifs, a proline-rich region, a SAND domain, and an HSR domain (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar, 2The Finnish-German APECED Consortium Nat. Genet. 1997; 17: 399-403Crossref PubMed Scopus (1015) Google Scholar, 4Gibson T.J. Ramu C. Gemund C. Aasland R. Trends Biochem. Sci. 1998; 23: 242-244Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). The protein has a tissue-specific expression pattern, being mainly expressed in the thymus, lymph nodes, the spleen, and fetal liver (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar, 2The Finnish-German APECED Consortium Nat. Genet. 1997; 17: 399-403Crossref PubMed Scopus (1015) Google Scholar, 5Heino M. Peterson P. Kudoh J. Nagamine K. Lagerstedt A. Ovod V. Ranki A. Rantala I. Nieminen M. Tuukkanen J. Scott H.S. Antonarakis S.E. Shimizu N. Krohn K. Biochem. Biophys. Res. Commun. 1999; 257: 821-825Crossref PubMed Scopus (235) Google Scholar, 6Heino M. Peterson P. Sillanpää N. Guerin S. Wu L. Anderson G. Scott H.S. Antonarakis S.E. Kudoh J. Shimizu N. Jenkinson E.J. Naquet P. Krohn K.J. Eur. J. Immunol. 2000; 30: 1884-1893Crossref PubMed Scopus (154) Google Scholar). In the thymus, AIRE is expressed in medullary epithelial cells and cells of monocyte-dendritic lineage (5Heino M. Peterson P. Kudoh J. Nagamine K. Lagerstedt A. Ovod V. Ranki A. Rantala I. Nieminen M. Tuukkanen J. Scott H.S. Antonarakis S.E. Shimizu N. Krohn K. Biochem. Biophys. Res. Commun. 1999; 257: 821-825Crossref PubMed Scopus (235) Google Scholar, 7Björses P. Pelto-Huikko M. Kaukonen J. Aaltonen J. Peltonen L. Ulmanen I. Hum. Mol. Genet. 1999; 8: 259-266Crossref PubMed Scopus (123) Google Scholar). Subcellularly, AIRE is located in the cell nucleus and in nuclear dots resembling promyelocytic leukemia bodies (7Björses P. Pelto-Huikko M. Kaukonen J. Aaltonen J. Peltonen L. Ulmanen I. Hum. Mol. Genet. 1999; 8: 259-266Crossref PubMed Scopus (123) Google Scholar, 8Pitkänen J. Vähämurto P. Krohn K. Peterson P. J. Biol. Chem. 2001; 276: 19597-19602Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). Supporting AIRE subcellular location and its structural features, AIRE has been shown to act as a transcriptional activator, the process that is mediated through the plant homeodomain zinc fingers (8Pitkänen J. Vähämurto P. Krohn K. Peterson P. J. Biol. Chem. 2001; 276: 19597-19602Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). AIRE also interacts with the common transcriptional coactivator CREB-binding protein (CBP) through the CH1 and CH3 conserved domains (9Pitkänen J. Doucas V. Sternsdorf T. Nakajima T. Aratani S. Jensen K. Will H. Vähämurto P. Ollila J. Vihinen M. Scott H.S. Antonarakis S.E. Kudoh J. Shimizu N. Krohn K. Peterson P. J. Biol. Chem. 2000; 275: 16802-16809Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar). Recent findings in AIRE-deficient mice suggest that the protein influences expression of peripheral self-antigens in the thymus, explaining the mechanism through which immune tolerance can be broken in multiorgan endocrine autoimmune diseases (10Anderson M.S. Venanzi E.S. Klein L. Chen Z. Berzins S.P. Turley S.J. von Boehmer H. Bronson R. Dierich A. Benoist C. Mathis D. Science. 2002; 298: 1395-1401Crossref PubMed Scopus (1867) Google Scholar, 11Ramsey C. Winqvist O. Puhakka L. Halonen M. Moro A. Kampe O. Eskelin P. Pelto-Huikko M. Peltonen L. Hum. Mol. Genet. 2002; 11: 397-409Crossref PubMed Scopus (390) Google Scholar). The role of AIRE in tolerance mechanisms led us to investigate the transcriptional regulation of the AIRE gene. Here we have characterized the human AIRE gene promoter structure identifying a minimal promoter and its transcriptional control elements. We describe the methylation status of the AIRE promoter in several cell lines and demonstrate the up-regulation of AIRE mRNA as a response to 5-aza-2′-deoxycytidine (5-azaCdR) and trichostatin A (TSA) treatments. Cell Culture—COS-7 cells were maintained in Dulbecco's modified Eagle's medium. HeLa and TEC 1A3 (human thymic epithelial cell line) cells were maintained in Eagle's minimum essential medium. Human monocytoid cell lines, THP-1 and U937, were cultured in RPMI 1640. Media was supplemented with 10% fetal calf serum and a 100 units/ml penicillin-streptomycin mixture (BioWhittaker, Europe). Isolation of AIRE Promoter—A 1.2-kb genomic fragment containing the 5′-end region of the AIRE gene was isolated by PCR amplification from human genomic DNA. Nucleotide sequences for primers are listed in Table I. The 5′-flanking region of AIRE promoter was subcloned into the pHIV-LTR-luc plasmid (Prof. Kalle Saksela, University of Tampere, Finland) encoding firefly luciferase reporter gene and named as pAP1235. The promoter region in the pAP1235 construct was verified by sequencing.Table IPrimer sequences used in this studyNameSequence (5′ → 3′)PurposeaEMSA, electrophoretic mobility shift assay; BS, bisulfite sequencingGR1/1FCGAGGCCAAGCGAGGGGCTGCCAGCloningGR1/1RGGACTATCCCTGGCTCACAGGGCCCloningPA1FTTTGCGGCCGCGAACACTCGTGCCCAGAGACCCloningPA2FTTTGCGGCCGCCCTGTCCAGGCCACAGCATCCCloningPA3FTTTGCGGCCGCTAGGGGCTCTCAGCTTGTGTGCloningPA4FTTTGCGGCCGCCACAGAGCGAGTCTCTGTCCCCloningPA5FTTTGCGGCCGCCCTCCATCACAGGGAAGTGTCCloningPA6FTTTGCGGCCGCGGAGCGGCCTTTGCTCTTTGCCloningPA1RTTTGGATCCGGGCGCGGGGACCCGGGGCTGCloningAIRE TATA boxGGTCGCGGGGGTCGAACAGCGGCGCGmutagenesisAIRE AP-1CTGGTGGGTGAGCAAGGCCAGGCCCGmutagenesisAIRE NF-YCTGGCCCTGATTAAGCGCCGGGGCGGAGmutagenesisAIRE Sp1GATTGGGCGCCGAAGCGAAGCGGCCTTTGCmutagenesisAIRE AP-1TGGTGGGTGAGTCAGGCCAGGCEMSAAIRE AP-1 mut.TGGTGGGAAAGTCAGGCCAGGCEMSAAP-1 consensusCGCTTGATGAGTCAGCCGGAAEMSAAIRE NF-YGAGGCCCTGGCCCTGATTGGGCGCCGEMSAAIRE NF-Y mut.GGCCCTGATTAAGCGCCGGGGCEMSANF-Y consensusGAGATTAACCAATCACGTACGGTEMSAAIRE Sp1GGCGCCGGGGCGGAGCGGCCTTEMSAAIRE Sp1 mut.GGCGCCGAAGCGAAGCGGCCTTEMSASp1 consensusATTCGATCGGGGCGGGGCGAGCEMSABITSA 1 fwdGGATAGGGTTATATTTGGAAGTGABSBITSA 1 revCTAACTCACAAAACCTAAAAACAABSBITSA 2 fwdTGTTTTTAGTTTTTAAGGTAGTTGBSBITSA 2 revTACAACAATAAAAAAACACTATCCBSa EMSA, electrophoretic mobility shift assay; BS, bisulfite sequencing Open table in a new tab Computer Analysis—Transcription factor binding sites were predicted by using the MatchTM program, which uses TRANSFAC 5.0 matrices (core similarity 1.0 and matrix similarity 0.9). The presence of CpG islands was analyzed with the EMBOSS program CpGplot using the algorithms of Gardiner-Garden and Frommer (12Gardiner-Garden M. Frommer M. J. Mol. Biol. 1987; 196: 261-282Crossref PubMed Scopus (2652) Google Scholar). According to this analysis, a CpG-rich region is defined as stretches of DNA in which both the moving average of percentage of G plus C nucleotides is greater than 50 and the moving average of observed/expected CpG is greater than 0.6. Construction of Deletion and Mutant Reporter Plasmids—The pAP1235 plasmid construct containing the 5′-flanking region was used as a template to synthesize a series of deletion reporter gene constructs. The forward and reverse primers containing NotI and BamHI restriction sites, respectively, were used in cloning of deletion constructs (Table I and Fig. 1). Site-directed mutagenesis of the pAP1235 construct was performed using the GeneEditor in vitro site-directed mutagenesis system (Promega). Mutations were introduced into putative DNA binding sites for the AP-1, NF-Y, and Sp1 transcription factors, as well as into the putative TATA sequences used in site-directed mutagenesis are in Table I. were by DNA and Reporter were with of DNA of luciferase reporter of expression (Prof. Kalle Saksela, University of Tampere, using the the cells were to the luciferase using the (Promega). The luciferase were for to The transfections were performed in Electrophoretic were from HeLa and TEC1A3 cells with the of the of PubMed Scopus Google Scholar). cells were with and in A DTT, 1 and 2 and for The were several through a The were by and in C 1 DTT, 1 and 2 by and for The was for and the was and were using the protein The used in are listed in Table I. of nuclear to was in a for in a containing DTT, 1 and were in was in the was to the and for The were to the the was and for The Sp1 and AP-1 were from The and were from and were a from of In DNA was used to AIRE promoter luciferase reporter construct pAP1235. plasmid DNA was with 1 of 1 of DNA in 50 1 DTT, supplemented with were The methylated plasmid DNA was through a DNA system and into TEC1A3 and cells in with the pAP1235 DNA DNA was from TEC1A3, and U937 cells to J. T. A Scholar). the genomic DNA was isolated by cell with and with the the genomic DNA was with restriction and a with 1 and with the to the genomic to and the were to Sodium DNA genomic sequencing was performed as M. F. Sci. S. A. PubMed Scopus Google Scholar, C. S.J. A. Res. 2001; PubMed Scopus Google Scholar). The genomic DNA was in for the of bisulfite and were with and 50 for The modified DNA was through the DNA system and by of for The DNA was and in 1 and used or The of in the DNA was by PCR in a mixture containing of and 1 of amplification of a by of 1 1 and a for sequences are listed in Table I. The modified DNA was by DNA were with a and into were cell and methyltransferase inhibitor, was to cells from to for inhibitor, was for or the of the cells were used for using the Isolation system and of was to using the Real-time PCR was performed with the using a were in of containing 2 of or and of The amplification program for AIRE an for by of for for and for was The of amplification was to The of the AIRE transcript was to the of human glyceraldehyde-3-phosphate transcript in The PCR for in that the was and amplification of AIRE and were used as for sequences to the AIRE or were as and of the PCR assays was in and the AIRE and were from the amplification using with the AIRE isolated the human AIRE gene 5′-flanking region using PCR amplification of genomic DNA. The of the was to be with the genomic in The transcription initiation bp of the by amplification of has been (1Nagamine K. Peterson P. Scott H.S. Kudoh J. Minoshima S. Heino M. Krohn K.J. Lalioti M.D. Mullis P.E. Antonarakis S.E. Kawasaki K. Asakawa S. Ito F. Shimizu N. Nat. Genet. 1997; 17: 393-398Crossref PubMed Scopus (1121) Google Scholar). demonstrate the of the AIRE the fragment was in of a luciferase reporter gene and into and TEC1A3 cell The luciferase with the pAP1235 reporter construct was and in and TEC1A3 respectively, compared with a control plasmid in the AIRE promoter the for transcriptional control we deletion constructs of the pAP1235 plasmid from the 5′-end of the promoter assays with the deletion constructs and in the construct in of the to in cells compared with the pAP1235 even of the luciferase was with the deletion results were using the TEC1A3 cell a of deletion construct analysis, the results showed that the for the minimal AIRE promoter within the 350 bp of the translation of to the of the promoter region with the MatchTM program the presence of binding sites for transcription factor complexes as a box to an box to and a binding for transcription factor AP-1 to the transcription that with putative binding sites in the AIRE promoter region, EMSA, with was A with the AP-1 to as a The by the of a of the was not by of the of to the as a The mutated from the AP-1 was to the the of the AP-1 the we performed a by using and The that with the AIRE AP-1 was by the of however, not by complexes and results were observed in both cell a control we used a AP-1 in and analysis The of the box in AIRE gene regulation was with for the box showed a which was by of a of a the of the was not by a as a In as an of protein binding introduced into the AIRE box the protein within the was in NF-Y, assays were performed with A and of the NF-Y transcription and were to the resembling the with the the of the box in the AIRE promoter was The with the AIRE Sp1 was to the with a control Sp1 The with the of the was not by of The mutated AIRE Sp1 used as in The of the was using an for the Sp1 transcription The Sp1 was to with the of the protein with the AIRE promoter as well as with the Sp1 in results that the AIRE promoter which complexes with AP-1, NF-Y, and Sp1 transcription of TATA AP-1, NF-Y, and Sp1 to the AP-1, NF-Y, and Sp1 the AIRE promoter a TATA box located the bp of the transcriptional the functional of the TATA box and transcriptional complexes in the AIRE were introduced into the pAP1235 luciferase reporter construct using site-directed mutagenesis and into the and TEC1A3 cell lines The introduced into the TATA box AIRE promoter to in and to in TEC1A3 Mutations in the box the promoter to in compared with in TEC1A3 Nucleotide within the box in in and in TEC1A3 cells compared with the pAP1235 in the AP-1 binding the promoter to in and to in TEC1A3 the results of experiments showed that the TATA the AP-1 binding the and the box are the binding to sites are essential for the AIRE gene AIRE CpG and the by in that the region the AIRE proximal promoter is The CpG within the 1.2-kb genomic fragment was analyzed as by the of Gardiner-Garden and Frommer (12Gardiner-Garden M. Frommer M. J. Mol. Biol. 1987; 196: 261-282Crossref PubMed Scopus (2652) Google Scholar). a 390-bp CpG island was located the AIRE promoter region, from bp of the and the The of in vitro methylation the promoter of the AIRE gene was in a transient expression using the pAP1235 promoter methylation with which within CpG the methylated and reporter constructs were into TEC1A3 cells and for a result in vitro methylation AIRE promoter compared with the promoter construct results were with experiments using the cell line not AIRE in the Cell methylation status of CpG sites in the AIRE promoter region was in TEC1A3 and THP-1 cell line genomic DNA using the restriction of a fragment the AIRE with the AIRE revealed methylated status of the sites not The DNA from TEC1A3, and from two cell lines, THP-1 and U937, was analyzed by bisulfite genomic DNA was with bisulfite are to methylated The promoter region CpG sites, a 390-bp fragment of the AIRE CpG sites showed a methylation in monocytic cell lines and U937 Fig. from HeLa cells were with the results from THP-1 and U937 CpG sites a methylation In in epithelial TEC1A3 CpG sites of were and CpG sites a methylation The results a methylation of AIRE promoter in TEC1A3 cells compared with the cell and AIRE the role of DNA methylation and chromatin in the control of AIRE a and a deacetylase inhibitor, TSA, were TEC1A3 cells were in the presence of and was analyzed by PCR for AIRE expression in cell lines U937, and The treatment with the was to AIRE expression levels and compared with the cells also of the AIRE the of and was even to the expression of AIRE in TEC1A3 and U937 this was not observed in HeLa The of AIRE by a was also by treatment The results showed that methylation and deacetylase treatments are to the AIRE promoter and in TEC1A3 and U937 the of the two treatments in AIRE transcript expression levels that both methylation and are for the of the AIRE gene. The AIRE expression is in thymic epithelial cells (5Heino M. Peterson P. Kudoh J. Nagamine K. Lagerstedt A. Ovod V. Ranki A. Rantala I. Nieminen M. Tuukkanen J. Scott H.S. Antonarakis S.E. Shimizu N. Krohn K. Biochem. Biophys. Res. Commun. 1999; 257: 821-825Crossref PubMed Scopus (235) Google Scholar, 6Heino M. Peterson P. Sillanpää N. Guerin S. Wu L. Anderson G. Scott H.S. Antonarakis S.E. Kudoh J. Shimizu N. Jenkinson E.J. Naquet P. Krohn K.J. Eur. J. Immunol. 2000; 30: 1884-1893Crossref PubMed Scopus (154) Google Scholar). L. C. Heino M. Peterson P. Krohn K.J. A. Kudoh J. Shimizu N. Antonarakis S.E. Scott H.S. Biochem. Biophys. Res. Commun. 1999; PubMed Scopus Google from human and AIRE promoter analysis that both human and conserved binding sites for and transcription of the human AIRE promoter not binding sites for tissue-specific transcription the that tissue-specific transcription in AIRE transcriptional regulation be with protein complexes binding to AIRE promoter or transcription to the that AIRE the expression of we to the mechanisms the AIRE gene transcriptional The fragment of the initiation showed promoter in and in the thymic epithelial cell line TEC1A3 for the expression of reporter gene. The analysis of the 5′-flanking AIRE promoter region that the proximal region for minimal promoter the construct luciferase results with and pAP1235 deletion constructs. promoter within a region suggested the presence of transcription factor binding sites, which was also supported by analysis binding sites for transcription as AP-1, NF-Y, and We also that the luciferase expression in TEC1A3 was being of the expression in this be to the of however, the luciferase expression of the proximal fragment was in two cell lines DNA binding within the to The in this region was the AP-1 that expression of this transcription in cells be the for the luciferase expression in the two cell The deletion to the promoter the role of this in AIRE promoter The experiments and mutated construct analysis four for AIRE promoter the of the AP-1 the most of the promoter by to and the of AIRE expression from AP-1 The AP-1 of or of of the and M. Z. Cell Biol. 1997; PubMed Scopus Google Scholar). and in EMSA, we that within the AP-1 binding to the AIRE to the not to the transcription factor we showed that the and located to bp and to respectively, are in AIRE The NF-Y transcription factor binding to the box of and and of are for DNA binding R. 1999; PubMed Scopus Google Scholar). The and of this with and binding to in DNA Wu L. F. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar). assays with two of this and to the of a NF-Y the AIRE AIRE promoter is also mediated by the Sp1 transcription the with the and the mutated Sp1 binding construct strongly transcriptional in the and TEC1A3 cell be that two were predicted by analysis, with a nucleotides to and to the AIRE promoter a TATA box for of a containing the protein and L. K. 1999; PubMed Scopus Google Scholar, 2000; PubMed Scopus Google Scholar). the within the TATA AIRE promoter with its predicted functional The presence of a CpG island suggested the that the AIRE gene be through in methylation which was by in vitro methylation of the pAP1235 promoter The four cell lines a methylated CpG by bisulfite and this was in DNA from HeLa and monocytic cell lines THP-1 and In TEC1A3 cell several CpG sites or of the Sp1 has been shown to cause gene Biochem. J. 2000; PubMed Scopus Google Scholar, S. R. S. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus Google and CpG sites within the Sp1 binding box methylated in TEC1A3 cells of the sites was methylated AIRE expression is in epithelial cells (5Heino M. Peterson P. Kudoh J. Nagamine K. Lagerstedt A. Ovod V. Ranki A. Rantala I. Nieminen M. Tuukkanen J. Scott H.S. Antonarakis S.E. Shimizu N. Krohn K. Biochem. Biophys. Res. Commun. 1999; 257: 821-825Crossref PubMed Scopus (235) Google the thymic epithelial cell line the cell for AIRE with was to AIRE mRNA expression levels in TEC1A3 and U937 and the was the cells were in with deacetylase inhibitor A in mRNA treatment was also observed in the HeLa cell however, the treatment not the expression that chromatin in the AIRE promoter region cell of and in of several was by S. Nat. Genet. 1999; PubMed Scopus Google Scholar). The of CpG methylation and chromatin modifications has been in experiments that the deacetylase is to chromatin by methylated D. N. J. Nat. Genet. 1998; PubMed Scopus Google Scholar, A. 1998; PubMed Scopus Google Scholar). is the to the functional control of the AIRE In results demonstrate that the AIRE promoter binding sites for transcription factor AP-1, NF-Y, and and a functional TATA In results of methylation a methylated CpG island the AIRE promoter in several cell lines, of methylation in thymic epithelial cell line DNA. an of AIRE mRNA was the cells were with and TSA, that chromatin methylation most combined with have an role in AIRE transcriptional We the of and of the We also and for of the