Role of vav1- and src-related Tyrosine Kinases in Macrophage Activation by CpG DNA

Abstract

Macrophage activation by CpG DNA requires toll-like receptor 9 and the adaptor protein MyD88. Gram-negative bacterial lipopolysaccharide also activates macrophages via a toll-like receptor pathway (TLR-4), but we and others have reported that lipopolysaccharide also stimulates tyrosine phosphorylation in macrophages. Herein we report that exposure of RAW 264.7 murine macrophages to CpG DNA (but not non-CpG DNA) provoked the rapid tyrosine phosphorylation of vav1. PP1, a selective inhibitor of src-related tyrosine kinases, blocked both the CpG DNA-mediated tyrosine phosphorylation of vav1 and the CpG DNA-mediated up-regulation of macrophage tumor necrosis factor secretion and inducible nitric-oxide synthase protein accumulation. Furthermore, we found that the inducible expression of any of three dominant interfering mutants of vav1 (a truncated protein, vavC; a form containing a point mutation in the regulatory tyrosine residue, vavYF174; and a form with an in-frame deletion of six amino acids required for the guanidine nucleotide exchange factor (GEF) activity of vav1 for rac family GTPases, vavGEFmt) consistently inhibited CpG DNA-mediated up-regulation of tumor necrosis factor secretion and inducible nitric-oxide synthase protein accumulation in RAW-TT10 macrophages. Finally, we determined that CpG DNA-mediated up-regulation of NF-κB activity (but not mitogen-activated protein kinase activation) was inhibited by preincubation with PP1 or by expression of the truncated vavC mutant. Taken together, our results indicate that the tyrosine phosphorylation of vav1 by a src-related tyrosine kinase or kinases plays an important role in the macrophage response to CpG DNA. Macrophage activation by CpG DNA requires toll-like receptor 9 and the adaptor protein MyD88. Gram-negative bacterial lipopolysaccharide also activates macrophages via a toll-like receptor pathway (TLR-4), but we and others have reported that lipopolysaccharide also stimulates tyrosine phosphorylation in macrophages. Herein we report that exposure of RAW 264.7 murine macrophages to CpG DNA (but not non-CpG DNA) provoked the rapid tyrosine phosphorylation of vav1. PP1, a selective inhibitor of src-related tyrosine kinases, blocked both the CpG DNA-mediated tyrosine phosphorylation of vav1 and the CpG DNA-mediated up-regulation of macrophage tumor necrosis factor secretion and inducible nitric-oxide synthase protein accumulation. Furthermore, we found that the inducible expression of any of three dominant interfering mutants of vav1 (a truncated protein, vavC; a form containing a point mutation in the regulatory tyrosine residue, vavYF174; and a form with an in-frame deletion of six amino acids required for the guanidine nucleotide exchange factor (GEF) activity of vav1 for rac family GTPases, vavGEFmt) consistently inhibited CpG DNA-mediated up-regulation of tumor necrosis factor secretion and inducible nitric-oxide synthase protein accumulation in RAW-TT10 macrophages. Finally, we determined that CpG DNA-mediated up-regulation of NF-κB activity (but not mitogen-activated protein kinase activation) was inhibited by preincubation with PP1 or by expression of the truncated vavC mutant. Taken together, our results indicate that the tyrosine phosphorylation of vav1 by a src-related tyrosine kinase or kinases plays an important role in the macrophage response to CpG DNA. Certain bacterial DNA sequences are recognized by the vertebrate immune system as foreign and directly activate B lymphocytes and macrophages (1Krieg A.M. Yi A.K. Matson S. Waldschmidt T.J. Bishop G.A. Teasdale R. Koretzky G.A. Klinman D.M. Nature. 1995; 374: 546-549Google Scholar, 2Stacey K.J. Sweet M.J. Hume D.A. J. Immunol. 1996; 157: 2116-2122Google Scholar, 3Weiner G.J. J. Leukocyte Biol. 2000; 68: 455-463Google Scholar). Unmethylated CpG dinucleotides in particular sequence contexts (CpG motifs, e.g. CACGTT for murine cells, GTCGTT for human cells) occur frequently in bacterial DNA but not in vertebrate DNA (3Weiner G.J. J. Leukocyte Biol. 2000; 68: 455-463Google Scholar). Synthetic oligodeoxynucleotides containing these sequences (CpG DNA) stimulate macrophages to produce important inflammatory mediators such as tumor necrosis factor (TNF) 1The abbreviations used are: TNF, tumor necrosis factor; nCpG, non-CpG; TLR, toll-like receptor; LPS, lipopolysaccharide; GEF, guanidine nucleotide exchange factor; iNOS, inducible nitric-oxide synthase; MAP, mitogen-activated protein; rIFNγ, recombinant interferon-γ; JNK, c-Jun NH2-terminal kinase; ERK, extracellular signal-regulated kinase; ODN, oligodeoxynucleotide. and nitric oxide (NO) (2Stacey K.J. Sweet M.J. Hume D.A. J. Immunol. 1996; 157: 2116-2122Google Scholar, 3Weiner G.J. J. Leukocyte Biol. 2000; 68: 455-463Google Scholar, 4Utaisincharoen P. Anuntagool N. Chaisuriya P. Pichyangkul S. Sirisinha S. Clin. Exp. Immunol. 2002; 128: 467-473Google Scholar). Although exposure of animals to CpG DNA also leads to a robust T helper cell 1 cytokine response in most cases, the effects of CpG DNA on T cells are indirect, resulting from the production of innate cytokines such as type I interferons, interleukin-12, and interleukin-18 (3Weiner G.J. J. Leukocyte Biol. 2000; 68: 455-463Google Scholar). We and others have implicated hck and other src-related tyrosine kinases (5Weinstein S.L. Gold M.R. De Franco A.L. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4148-4152Google Scholar, 6English B.K. Ihle J.N. Myracle A. Yi T. J. Exp. Med. 1993; 178: 1017-1022Google Scholar, 7Beaty C.D. Franklin T.L. Uehara Y. Wilson C.B. Eur. J. Immunol. 1994; 24: 1278-1284Google Scholar, 8Orlicek S.L. Meals E. English B.K. J. Infect. Dis. 1996; 174: 638-642Google Scholar, 9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar) and substrates of these kinases, including vav1 (10Geng Y. Gulbins E. Altman A. Lotz M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8602-8606Google Scholar, 11English B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar), in the macrophage response to Gram-negative bacterial LPS. Although targeted disruption of three src family kinases (hck, lyn, fgr), alone or in combination, has failed to demonstrate an essential role for this pathway in macrophage activation by LPS (12Meng F. Lowell C.A. J. Exp. Med. 1997; 185: 1661-1670Google Scholar), this may be due to compensation by other src family members. Recent studies with highly src family-selective tyrosine kinase inhibitors (13Hanke J. Gardner J.P. Dow R.L. Changelian P.S. Brissett W.H. Weringer E.J. Pollok B.A. Connelly P.A. J. Biol. Chem. 1996; 271: 695-701Google Scholar) provide additional evidence that these kinases are involved in macrophage responses to LPS and other stimuli (9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar, 14Choi K.S. Jun H.S. Kim H.N. Park H.J. Eom Y.W. Noh H.L. Kwon H. Kim H.M. Yoon J.W. J. Virol. 2001; 75: 1949-1957Google Scholar). However, little attention has been paid to the potential role of these tyrosine phosphorylation pathways in macrophage activation by bacterial DNA. In the present study, we examined the ability of CpG DNA to provoke the tyrosine phosphorylation of vav1 in macrophages and used complementary strategies to determine whether vav1 phosphorylation played a critical role in CpG DNA-mediated macrophage activation. Reagents—Dulbecco's modified Eagle's medium was purchased from Mediatech Inc. (Herndon, VA). Penicillin/streptomycin and l-glutamine were obtained from Invitrogen. Fetal bovine serum was purchased from HyClone Laboratories (Logan, UT). Nuclease-resistant phosphorothioate oligodeoxynucleotides (S-ODN) were purchased from Operon (Valencia, CA) and had no detectable endotoxin activity by Limulus assay. The sequences of the S-ODN used were 5′-TCCATGACGTTCCTGACGTT-3′ (CpG DNA, ODN1826) and 5′TCCAGGACTTCTCTTCAGGTT3′ (nCpG DNA, ODN1982). LPS purified from Escherichia coli strain O111:B4 and rIFNγ were obtained from Sigma. Zeocin and tetracycline were purchased from Invitrogen. PP1, a src family-selective tyrosine kinase inhibitor, was purchased from Calbiochem. vav1 Constructs—We obtained c-myc epitope-tagged constructs encoding (a) vavC, a truncated form of vav1, comprising amino acids 538–845, including the C-terminal SH2 and SH3 domains; (b) vavYF174, a tyrosine to phenylalanine point mutant at position 174; and (c) vavGEFmt, a mutant containing an in-frame deletion of six amino acids in the GEF domain, as generous gifts from A. Weiss (University of California, San Francisco) (15Wu J. Katzav S. Weiss A. Mol. Cell. Biol. 1995; 15: 4337-4346Google Scholar, 16Kuhne M. Ku G. Weiss A. J. Biol. Chem. 2000; 275: 2185-2190Google Scholar). The vav1 constructs were subcloned into the expression vector pTet/Zeo, a tetracycline operator (tetO) expression plasmid that also encodes resistance to the antibiotic Zeocin (D. Underhill, The Institute for Systems Biology, Seattle, WA). Creation of Stably Transfected Cell Lines—RAW-TT10 cells (17Underhill D.M. Ozinsky A. Hajjar A.M. Stevens A. Wilson C.B. Bassetti M. Aderem A. Nature. 1999; 401: 811-815Google Scholar) (D. Underhill and A. Aderem, The Institute for Systems Biology, Seattle, WA) are RAW 264.7 murine macrophages (ATCC, Manassas, VA) that have been engineered to express the tetracycline-controlled transactivator (tTA) (18Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Google Scholar, 19Shockett P. Difilippantonio M. Hellman N. Schatz D.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6522-6526Google Scholar) from a tetracycline-regulated promoter. RAW-TT10 cells were transfected with the subcloned expression constructs using electroporation as described by Underhill et al. (20Underhill D.M. Chen J. Allen L.A. Aderem A. J. Biol. Chem. 1998; 273: 33619-33623Google Scholar). In this tetracycline-regulatable “Tet-Off” system, the promoter is quiescent in the presence of low doses of tetracycline; in the absence of tetracycline, there is a marked increase in the expression of cDNAs directed by the tetracycline operator (tetO)-promoter sequence (17Underhill D.M. Ozinsky A. Hajjar A.M. Stevens A. Wilson C.B. Bassetti M. Aderem A. Nature. 1999; 401: 811-815Google Scholar). Cells expressing the indicated pTet/Zeo-based constructs were selected in the presence of Zeocin (1 mg/ml for 1 week and then 500 μg/ml). All stable cell lines were stored in liquid nitrogen and were cultured for less than 4 weeks prior to study. Cells and Cell Culture—RAW 264.7 murine macrophages were obtained from ATCC. RAW 264.7 cells and RAW-TT10 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum, 2 mm l-glutamine, 50 units/ml penicillin G, and 50 μg/ml streptomycin. RAW-TT10/vavC, RAW-TT10/vavYF174, and RAW-TT10/vavGEFmt cells were selected and maintained in medium containing both Zeocin (300–1000 μg/ml) and tetracycline (1–5 μg/ml). In the experimental conditions, RAW-TT10 subclones expressing the mutant forms of vav1 were grown in tetracycline 1 μg/ml (control) or in the absence of tetracycline (allowing construct expression) for 48–72 h prior to stimulation. Experiments were performed in 6-well (BD Biosciences) or 100-mm (Corning, Corning, NY) tissue culture dishes. The cells were grown to 60–70% confluence prior to stimulation. The cells were stimulated with either CpG DNA or nCpG DNA (range of concentrations, 0.1–12 μg/ml) alone or in the presence of rIFNγ. studies of secretion and inducible synthase protein cells were for h the cell were cell were the of vav1 tyrosine phosphorylation or kinase cells were stimulated for prior to of the cell vav1 and cells were with mm mm 50 μg/ml 1 mm mm μg/ml and μg/ml of protein in cell the were on to blocked with in and then with a murine for at a of for 2 The were then with a Biosciences) at a of for and were by of kinases was by of cell using an to or of the truncated vav1 construct in cell was by with a for vav1 expression of the and constructs was by with a murine for the c-myc vav1 protein tyrosine phosphorylation was by were with serum prior to with for vav1 or were with protein to to and then with the murine cell were to to and with a for vav1 on tyrosine In the were then with the and were then by The of were using a of were and stored at protein were determined by a for murine as by the NF-κB and RAW 264.7 cells and cells were grown to in 6-well Cells were transfected with a of and constructs using The transfected cells were and into at a of RAW 264.7 cells were then with medium alone or PP1 at the indicated for 1 h prior to stimulation. cells were cultured in the presence or absence of tetracycline (1 μg/ml) for h prior to and maintained in the presence or absence of tetracycline The cells were then stimulated with medium CpG DNA or LPS (1 μg/ml) for activity in the cell was to the using the The activity was using activity in CpG DNA the of vav1 in RAW 264.7 Cells in a and and others have reported that LPS stimulates the tyrosine phosphorylation of vav1 in macrophages (10Geng Y. Gulbins E. Altman A. Lotz M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8602-8606Google Scholar, 11English B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar) and have implicated hck other src-related tyrosine kinases in this (9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar, 11English B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar). In this study, we found that exposure of RAW 264.7 cells to CpG DNA μg/ml) to the rapid and phosphorylation of vav1 on as by either of vav1 with a murine for and or by of cell with a for vav1 on tyrosine is of RAW cells to nCpG DNA μg/ml) for failed to detectable vav1 phosphorylation is PP1, a of src-related CpG DNA-mediated and vav1 in RAW 264.7 PP1 is a and highly selective inhibitor of src-related tyrosine kinases (13Hanke J. Gardner J.P. Dow R.L. Changelian P.S. Brissett W.H. Weringer E.J. Pollok B.A. Connelly P.A. J. Biol. Chem. 1996; 271: 695-701Google Scholar) and activity other of tyrosine kinases kinases, report that may also be the kinase R. A. J. Biol. Chem. Scholar). We have reported that PP1 activation of the src-related kinase hck and the tyrosine phosphorylation of vav1 (a of hck and other src-related in RAW 264.7 cells (9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar). the potential role of src-related tyrosine kinases in CpG DNA-mediated macrophage activation and vav1 tyrosine we RAW 264.7 cells to a of of PP1 for 1 h prior to with CpG DNA rIFNγ as indicated CpG DNA has been reported to stimulate macrophage production of in the presence of iNOS, and (2Stacey K.J. Sweet M.J. Hume D.A. J. Immunol. 1996; 157: 2116-2122Google Scholar, 3Weiner G.J. J. Leukocyte Biol. 2000; 68: 455-463Google Scholar, 4Utaisincharoen P. Anuntagool N. Chaisuriya P. Pichyangkul S. Sirisinha S. Clin. Exp. Immunol. 2002; 128: 467-473Google Scholar, Yoon Yi A.K. J. Immunol. Scholar). We that exposure of RAW 264.7 cells to a of μg/ml) of CpG DNA (but not nCpG DNA) to secretion in the presence of low of rIFNγ protein accumulation In the absence of rIFNγ, CpG DNA alone μg/ml) failed to stimulate detectable accumulation with PP1 to marked of CpG DNA-mediated performed in and production by RAW 264.7 cells and blocked CpG DNA-mediated vav1 tyrosine phosphorylation The PP1 for and accumulation were and The PP1 for vav1 phosphorylation was less than PP1 inhibited CpG DNA-mediated secretion by and CpG DNA-mediated protein accumulation by of of of vav1 and in RAW-TT10 directly the role of vav1 in macrophage activation by CpG DNA, we a of dominant interfering mutants vav1 in RAW 264.7 Cell lines were in the presence of tetracycline (1–5 μg/ml) to construct expression prior to the of the experimental All three mutant forms of vav1 were in a tetracycline-regulatable in RAW-TT10/vavC, RAW-TT10/vavYF174, and RAW-TT10/vavGEFmt cells B and is expression of three mutant forms of vav1 was from cells grown in cell tissue culture medium tetracycline for 48–72 h with from cells maintained in the presence of μg/ml of as in of cell with either a for vav1 the truncated vavC construct of or a murine for the c-myc the and of the vav1 constructs was both and tetracycline expression be h of the cells from tetracycline, and expression was by 48–72 h expression was in cells cultured in of tetracycline We found that RAW-TT10 macrophages expressing of the three mutant forms of vav1 the absence of consistently less and less protein with CpG DNA rIFNγ. Cells cultured in tetracycline (1–5 μg/ml) construct expression) as the in in the of had no on the of secretion or protein accumulation in response to with CpG DNA or LPS rIFNγ in either RAW 264.7 macrophages or RAW-TT10 cells not expression of of three vav1 mutants in RAW-TT10 macrophages inhibited CpG DNA-mediated protein accumulation. Cells were cultured in the presence of tetracycline μg/ml (control) or absence of tetracycline (allowing construct expression) for h prior to with rIFNγ CpG DNA for h cell were Cells were stimulated with the of medium alone 1 and rIFNγ units/ml 2 and CpG DNA μg/ml and or rIFNγ units/ml CpG DNA μg/ml 4 and medium alone 1 and rIFNγ units/ml nCpG DNA, μg/ml 2 and or rIFNγ units/ml CpG DNA μg/ml and 1 μg/ml 4 and μg/ml and or μg/ml and rIFNγ units/ml alone and or rIFNγ units/ml CpG DNA μg/ml and to protein for these of the protein from and were to and for of protein by with an that kinase CpG secretion was by in RAW-TT10 cells expressing the vavC mutant of experimental of by in the cells expressing the mutant of of and by in the cells expressing the of 4 RAW-TT10 cells stimulated with rIFNγ alone of protein, and secretion was not consistently inhibited by expression of any of the three vav1 constructs and is CpG DNA-mediated protein accumulation was by in the RAW-TT10 cells expressing the vavC mutant by in the cells expressing the mutant and by in the cells expressing the tetracycline-regulated in the expression of of three dominant interfering mutant forms of vav1 consistently inhibited the CpG DNA-mediated up-regulation of production and secretion in RAW-TT10 directly vav1 in the of macrophage activation by CpG DNA. of PP1 or of of vav1 on CpG DNA-mediated NF-κB and of RAW 264.7 macrophages for 1 h with PP1 (1–5 inhibited CpG DNA-mediated NF-κB activation a performed in expression of the truncated vavC mutant in cells cultured in the absence of tetracycline consistently inhibited the up-regulation of NF-κB activity by CpG DNA or by LPS a performed in In preincubation with PP1 is expression of the truncated vavC construct a inhibited the activation of ERK, or kinases in response to with CpG DNA. Furthermore, expression of the and constructs also failed to CpG DNA-mediated in the activity of ERK, or kinases In this study, we that exposure of RAW 264.7 murine macrophages to CpG DNA the rapid tyrosine phosphorylation of vav1. We of evidence that this plays an important role in macrophage responses to CpG DNA. we that a selective inhibitor of src-related tyrosine kinases, PP1 (13Hanke J. Gardner J.P. Dow R.L. Changelian P.S. Brissett W.H. Weringer E.J. Pollok B.A. Connelly P.A. J. Biol. Chem. 1996; 271: 695-701Google Scholar), CpG DNA-mediated secretion and protein up-regulation in macrophages at with to CpG DNA-mediated vav1 tyrosine Furthermore, we that the tetracycline-regulatable expression of any of three dominant interfering mutants of vav1 in stable subclones of RAW-TT10 macrophages both secretion and protein accumulation in response to the with CpG DNA. results indicate that the phosphorylation of vav1 by or src-related kinases plays a role in the macrophage response to CpG DNA. et al. (5Weinstein S.L. Gold M.R. De Franco A.L. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 4148-4152Google Scholar) reported that macrophage activation by Gram-negative bacterial LPS provoked tyrosine phosphorylation and that an inhibitor of tyrosine kinases the production of inflammatory mediators by macrophages to LPS. we B.K. Ihle J.N. Myracle A. Yi T. J. Exp. Med. 1993; 178: 1017-1022Google Scholar, 8Orlicek S.L. Meals E. English B.K. J. Infect. Dis. 1996; 174: 638-642Google Scholar, 9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar, 11English B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar) and others C.D. Franklin T.L. Uehara Y. Wilson C.B. Eur. J. Immunol. 1994; 24: 1278-1284Google Scholar, Y. Gulbins E. Altman A. Lotz M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8602-8606Google Scholar, J. Gardner J.P. Dow R.L. Changelian P.S. Brissett W.H. Weringer E.J. Pollok B.A. Connelly P.A. J. Biol. Chem. 1996; 271: 695-701Google Scholar) have and evidence that tyrosine kinases of the src family are in response to LPS and in macrophage activation. We have also vav1 as a of hck and other src family kinases in (9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar, 11English B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar). The role of src-related kinases in macrophage activation targeted disruption of to three src-related kinases (hck, lyn, in failed to LPS (12Meng F. Lowell C.A. J. Exp. Med. 1997; 185: 1661-1670Google Scholar) and the toll-like via a that not tyrosine kinases 2002; Scholar, T. T. S. 1999; Scholar, H. T. T. S. H. M. H. S. Nature. 2000; Scholar). However, the of highly src family-selective tyrosine kinase such as PP1 and (9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar, J. Gardner J.P. Dow R.L. Changelian P.S. Brissett W.H. Weringer E.J. Pollok B.A. Connelly P.A. J. Biol. Chem. 1996; 271: 695-701Google Scholar), has additional for the role of these kinases in macrophage responses to LPS. we found that PP1 inhibited the up-regulation of and production in macrophages at with to the activation of hck and the phosphorylation of vav1 (9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar). vav1, as a in cells, is a protein containing a src 2 domain, src a domain, and a found in that as for Mol. Cell. Biol. 2000; Scholar). vav1 in as a GEF for P. Nature. 1997; Scholar) and also for other family The GEF activity of vav1 is required for Mol. Cell. Biol. 2000; Scholar, J. Exp. Med. 1998; Scholar), but not (15Wu J. Katzav S. Weiss A. Mol. Cell. Biol. 1995; 15: 4337-4346Google Scholar), of the of this protein in We B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar) and others (10Geng Y. Gulbins E. Altman A. Lotz M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8602-8606Google Scholar) have reported that vav1 rapid tyrosine phosphorylation in response to macrophage activation by LPS. In we that vav1 was with the src-related tyrosine kinase hck B.K. Orlicek S.L. Mei Z. Meals E.A. J. Leukocyte Biol. 1997; 62: 859-864Google Scholar) in macrophages and that both and src family-selective tyrosine kinase inhibitors blocked hck activation and vav1 tyrosine phosphorylation at that also inhibited macrophage production of and S.L. Meals E. English B.K. J. Infect. Dis. 1996; 174: 638-642Google Scholar, 9Orlicek S.L. Hanke J.H. English B.K. Shock. 1999; 12: 350-354Google Scholar). of vav1 on tyrosine is to activate the GEF activity of the protein P. Nature. 1997; Scholar), and the for this of of the of has been Cell. 2000; Scholar). In the present study, we found that the tetracycline-regulatable expression of any of three mutant forms of vav1 vavYF174, or vavGEFmt) in stable cell lines from RAW-TT10 macrophages inhibited protein accumulation and secretion in response to CpG DNA that the of vav1 in this macrophage pathway GEF role in T Weiss and M. Ku G. Weiss A. J. Biol. Chem. 2000; 275: 2185-2190Google Scholar) report that of the truncated vavC construct inhibited the activation of T cells but that expression of vav1, vavYF174, or was to T cell activation and factor of activity (15Wu J. Katzav S. Weiss A. Mol. Cell. Biol. 1995; 15: 4337-4346Google Scholar, 16Kuhne M. Ku G. Weiss A. J. Biol. Chem. 2000; 275: 2185-2190Google Scholar). Macrophage responses to bacterial are by 2002; Scholar, H. T. T. S. H. M. H. S. Nature. 2000; Scholar) and the adaptor protein, T. T. S. 1999; Scholar, H. S. H. J. Exp. Med. 2000; Scholar, Yoon Yi A.K. J. Biol. Chem. Scholar, M. S. R. Biol. 2000; Scholar). are in and and for than of the to have have been 2002; Scholar), including Gram-negative bacterial LPS, recognized by bacterial recognized by recognized by recognized by and bacterial DNA (CpG recognized by H. T. T. S. H. M. H. S. Nature. 2000; Scholar). with CpG DNA, via an the C-terminal receptor to that the activation of kinases 1 and 4 and tumor necrosis factor factor to up-regulation of NF-κB activity as as the activation of and c-Jun NH2-terminal kinase kinase responses to CpG DNA M. S. R. Biol. 2000; Scholar), both and has been for and S. J. Infect. Dis. Scholar). mediators of the response to CpG DNA the ERK, JNK, and kinases, are at in via H. S. H. J. Exp. Med. 2000; Scholar, Yoon Yi A.K. J. Biol. Chem. Scholar). We found that an inhibitor of src-related tyrosine kinases or the expression of mutants of vav1 blocked the up-regulation of NF-κB activity by CpG DNA in RAW 264.7 cells but failed to CpG DNA-mediated kinase activation in these indicate that or src-related tyrosine kinases and a of these kinases, vav1, also a role in the up-regulation of inflammatory production in macrophages to bacterial DNA. studies in our to the at these tyrosine phosphorylation pathways from the pathway in macrophages stimulated with CpG DNA, to the src-related that are by CpG DNA, and to the by vav1 to and production in macrophages to bacterial DNA and other bacterial