Biochemical Evidence for the Co-association of Three N-Methyl-d-aspartate (NMDA) R2 Subunits in Recombinant NMDA Receptors

Abstract

Functional characterization of wild-type and mutant cloned N-methyl-d-aspartate (NMDA) receptors has been used to deduce their subunit stoichiometry and quaternary structure. However, the results reported from different groups have been at variance and are thus inconclusive. This study has employed a biochemical approach to determine the number of NMDA R2 (NR2) subunits/receptor together with the NMDA R1 (NR1)/NR2 subunit ratio of both cloned and native NMDA receptors. Thus, human embryonic kidney 293 cells were transfected with the NR1-1a and NR2A NMDA receptor subunits in combination with both FLAG- and c-Myc epitope-tagged NR2B subunits. The expressed receptors were detergent-extracted and subjected to double immunoaffinity purification using anti-NR2A and anti-FLAG antibody immunoaffinity columns in series. Immunoblotting of the double immunopurified NR2A/NR2BFLAG-containing material demonstrated the presence of anti-NR1, anti-NR2A, anti-FLAG, and, more important, anti-c-Myc antibody immunoreactivities. The presence of anti-c-Myc antibody immunoreactivity in the double immunoaffinity-purified material showed the co-assembly of three NR2 subunits, i.e. NR2A/NR2BFLAG/NR2Bc-Myc, within the same NMDA receptor complex. Control experiments excluded the possibility that the co-immunopurification of the three NR2 subunits was an artifact of the solubilization procedure. These results, taken together with those previously described that showed two NR1 subunits/oligomer, suggest that the NMDA receptor is at least pentameric. Functional characterization of wild-type and mutant cloned N-methyl-d-aspartate (NMDA) receptors has been used to deduce their subunit stoichiometry and quaternary structure. However, the results reported from different groups have been at variance and are thus inconclusive. This study has employed a biochemical approach to determine the number of NMDA R2 (NR2) subunits/receptor together with the NMDA R1 (NR1)/NR2 subunit ratio of both cloned and native NMDA receptors. Thus, human embryonic kidney 293 cells were transfected with the NR1-1a and NR2A NMDA receptor subunits in combination with both FLAG- and c-Myc epitope-tagged NR2B subunits. The expressed receptors were detergent-extracted and subjected to double immunoaffinity purification using anti-NR2A and anti-FLAG antibody immunoaffinity columns in series. Immunoblotting of the double immunopurified NR2A/NR2BFLAG-containing material demonstrated the presence of anti-NR1, anti-NR2A, anti-FLAG, and, more important, anti-c-Myc antibody immunoreactivities. The presence of anti-c-Myc antibody immunoreactivity in the double immunoaffinity-purified material showed the co-assembly of three NR2 subunits, i.e. NR2A/NR2BFLAG/NR2Bc-Myc, within the same NMDA receptor complex. Control experiments excluded the possibility that the co-immunopurification of the three NR2 subunits was an artifact of the solubilization procedure. These results, taken together with those previously described that showed two NR1 subunits/oligomer, suggest that the NMDA receptor is at least pentameric. N-methyl-d-aspartate NMDA R1 NMDA R2 human embryonic kidney The N-methyl-d-aspartate (NMDA)1 subtype of the excitatory glutamate receptor is a hetero-oligomeric protein composed of the two classes of NMDA receptor subunits, namely, NR1 and NR2. The NR1 subunit is encoded by a single gene, which undergoes extensive alternative splicing to generate eight different splice forms. The NR2 subunit class consists of four genes encoding the subunits NR2A–NR2D. The subunits are thought to co-assemble in different combinations to form functionally distinct NMDA receptors (1Sucher N.J. Awobuluyi M. Choi Y. Lipton S.A. Trends Pharmacol. Sci. 1996; 17: 348-355Abstract Full Text PDF PubMed Scopus (253) Google Scholar). Biochemical and functional studies reported to date are ambiguous with regard to both NMDA receptor subunit stoichiometry and quaternary structure. Functional studies indicate that the binding of at least two molecules of both glutamate and glycine is required for NMDA receptor activation (2Patneau D.K. Mayer M.L. J. Neurosci. 1990; 10: 2385-2399Crossref PubMed Google Scholar, 3Benveniste M. Mayer M.L. Biophys. J. 1991; 59: 560-573Abstract Full Text PDF PubMed Scopus (174) Google Scholar, 4Clements J.D. Westbrook G.L. Neuron. 1991; 7: 605-613Abstract Full Text PDF PubMed Scopus (270) Google Scholar). The glutamate- and glycine-binding sites have been localized to the NR2 (5Laube B. Hirai H. Sturgess M. Betz H. Kuhse J. Neuron. 1997; 18: 493-503Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar) and NR1 (6Kuryatov A. Laube B. Betz H. Kuhse J. Neuron. 1994; 12: 1291-1300Abstract Full Text PDF PubMed Scopus (336) Google Scholar, 7Hirai H. Kirsch J. Laube B. Betz H. Kuhse J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6031-6036Crossref PubMed Scopus (195) Google Scholar) subunits, respectively, by in vitro mutagenesis, thus suggesting that at least four subunits must co-assemble to allow binding and activation of the receptor by both coagonists. The molecular size of native NMDA receptors, as determined by both gel filtration and native polyacrylamide gel electrophoresis, is in the range of 605–850 kDa (8Brose N. Gasic G.P. Vetter D.E. Sullivan J.M. Heinemann S.F. J. Biol. Chem. 1993; 268: 22663-22671Abstract Full Text PDF PubMed Google Scholar, 9Chazot P.L. Coleman S.K. Cik M. Stephenson F.A. J. Biol. Chem. 1994; 269: 24403-24409Abstract Full Text PDF PubMed Google Scholar, 10Blahos J., II Wenthold R.J. J. Biol. Chem. 1996; 271: 15669-15674Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar), which is consistent with the co-assembly of between four and six subunits. Immunopurification studies of native NMDA receptors have identified a population of receptors containing at least two different NR1 splice variants (10Blahos J., II Wenthold R.J. J. Biol. Chem. 1996; 271: 15669-15674Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 11Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 68: 507-516Crossref PubMed Scopus (66) Google Scholar). Furthermore, several groups have demonstrated the co-immunoprecipitation of anti-NR2A and anti-NR2B antibody immunoreactivities from rat forebrain, indicating the co-association of at least two NR2 subunits within an NMDA receptor complex (12Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 69: 2138-2144Crossref PubMed Scopus (127) Google Scholar, 13Sheng M. Cummings J. Roldan L.A. Jan Y.N. Jan L.Y. Nature. 1994; 368: 144-147Crossref PubMed Scopus (1109) Google Scholar, 14Luo J. Wang Y. Yasuda R.P. Dunah A.W. Wolfe B.B. Mol. Pharmacol. 1997; 51: 79-86Crossref PubMed Scopus (348) Google Scholar). The determination of the subunit copy number has also been addressed by the coexpression of wild-type and mutant forms of either the NR1 or NR2 subunit. These results have been inconclusive, with reports of two or three NR1 subunits and two or three NR2 subunits/functional NMDA receptor complex (15Béhé P. Stern P. Wyllie D.J.A. Nassar M. Schoepfer R. Colquhoun D. Proc. R. Soc. Lond. 1995; 262: 205-213Crossref PubMed Scopus (118) Google Scholar, 16Premkumar L.S. Auerbach A. J. Gen. Physiol. 1997; 110: 485-502Crossref PubMed Scopus (100) Google Scholar, 17Laube B. Kuhse J. Betz H. J. Neurosci. 1998; 18: 2954-2961Crossref PubMed Google Scholar). In this study, human embryonic kidney (HEK) 293 cells were transfected with the NR1-1a and NR2A NMDA receptor subunits in combination with both FLAG- and c-Myc epitope-tagged forms of the NR2B subunit. The expressed receptors were purified by anti-NR2A and anti-FLAG antibody immunoaffinity chromatography in series. Immunoblots of the double immunoaffinity-purified material demonstrated the presence of anti-c-Myc antibody immunoreactivity. This is presented as evidence for the co-association of three NR2 subunits, i.e. NR2A/NR2BFLAG/NR2Bc-Myc, within the same NMDA receptor complex. Additionally, the NR1/NR2 subunit ratio in both native and cloned NMDA receptors was determined, which further substantiated a 2:3 NR1/NR2 subunit ratio/receptor. The mouse NR2B subunit was epitope-tagged with either the FLAG epitope (DYKDDDDK) or the c-Myc epitope (EQKLISEEDL) using oligonucleotide-directed mutagenesis (SculptorTM in vitro mutagenesis system, Amersham Pharmacia Biotech). All tags were positioned between amino acids 53 and 54 of the NR2B subunit using the following oligonucleotides: FLAG, GTCATCTTTCTCGTGCTTGTCATCGTCGTCCTTGTAGTCGGCATCTTTTATGGC; and c-Myc, GTCATCTTTCTCGTGTAGGTCTTCTTCTGATATTAGCTTTTGTTCGGCATCTTTTATGGC. The position of the tag was confirmed by DNA sequencing. The cDNAs encoding the FLAG- and c-Myc-tagged NR2B subunits were subcloned into the mammalian expression vector pCIS for transfection into HEK 293 cells. The peptide corresponding to amino acids 1381–1394 (RCPSDPYKHSLPSQ) of the mouse NR2A subunit with an N-terminal K was conjugated to thyroglobulin by the glutaraldehyde method. The resultant conjugate was used to generate polyclonal antibodies in rabbits. Antibody production and affinity purification were carried out as described previously (18Chazot P.L. Cik M. Stephenson F.A. J. Neurochem. 1992; 59: 1176-1178Crossref PubMed Scopus (66) Google Scholar). Immunoblots probed with affinity-purified anti-NR2A-(1381–1394) antibodies detected a single polypeptide species with a molecular mass of 180 kDa in HEK 293 cells transfected with pCISNR2A (see Fig. 1 A). The 180-kDa species is coincident with that previously identified as the NR2A subunit (19Cik M. Chazot P.L. Stephenson F.A. Biochem. J. 1993; 296: 877-883Crossref PubMed Scopus (104) Google Scholar). This band was abolished by the prior incubation of the antibody with peptide-(1381–1394). Anti-NR2A-(1381–1394) antibodies displayed no immunocross-reactivity with other NMDA receptor subunits when used against HEK 293 cells transfected with the cDNAs encoding the NR1-1a, NR2B, NR2C, or NR2D subunit (see Fig.1 A). Anti-NR1 C2-(911–920), anti-NR2A/2B-(1435–1445), and anti-NR2B-(46–60) antibodies were as described previously (11Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 68: 507-516Crossref PubMed Scopus (66) Google Scholar, 18Chazot P.L. Cik M. Stephenson F.A. J. Neurochem. 1992; 59: 1176-1178Crossref PubMed Scopus (66) Google Scholar,19Cik M. Chazot P.L. Stephenson F.A. Biochem. J. 1993; 296: 877-883Crossref PubMed Scopus (104) Google Scholar). The anti-FLAG M2 and anti-c-Myc 9E10 mouse monoclonal antibodies were purchased from Sigma-Aldrich (Dorset, United Kingdom). HEK 293 cells were cultured and transfected using the calcium phosphate method as described previously (19Cik M. Chazot P.L. Stephenson F.A. Biochem. J. 1993; 296: 877-883Crossref PubMed Scopus (104) Google Scholar). Post-transfection, the cells were grown in the presence of 1 mm ketamine (Research Biochemicals International, Natick, MA) and harvested 24 h later. The NMDA receptor subunit clones pCISNR1-1a, pCISNR2A, and pCISNR2B were transfected at a ratio of 1:3:3, where the DNA encoding the NR2B subunit was represented by both the FLAG-tagged and c-Myc-tagged forms at a 1:1 ratio. HEK 293 cells were transfected with pCISNR1-1a in combination with pCISNR2B, pCISNR2BFLAG, or pCISNR2Bc-Myc. Twenty hours post-transfection, cell cytotoxicity was determined using the Promega CytoTox 96TM cytotoxicity assay according to the manufacturer's instructions and as described previously (9Chazot P.L. Coleman S.K. Cik M. Stephenson F.A. J. Biol. Chem. 1994; 269: 24403-24409Abstract Full Text PDF PubMed Google Scholar). [3H]Ro 25-6981 binding (20Mutel V. Buchy D. Klingelschmidt A. Messer J. Bleuel Z. Kemp J.A. Richards J.G. J. Neurochem. 1998; 70: 2147-2155Crossref PubMed Scopus (159) Google Scholar) was performed with both well washed cell homogenates prepared from HEK 293 cells transfected with either NR1-1a/NR2B or NR1-1a/NR2BFLAG and immunoaffinity-purified NMDA receptors. The assay was performed in 50 mm Tris citrate, pH 7.1, containing 5 mm EGTA and 5 mm EDTA. Aliquots (100 μl) of the cell homogenate or immunoaffinity-purified NMDA receptor preparations were incubated in the presence of 0.1–50 nm [3H]Ro 25-6981 at 4 °C for 2 h. Nonspecific binding was defined by 1 mm spermidine. The reaction was terminated by rapid filtration through either GF/B filters (cell homogenates) or GF/B filters pretreated with 1% polyethyleneimine for 2 h immediately prior to assay (purified samples), followed by five washes with phosphate buffer, pH 7.4, at 4 °C using a Brandel cell harvester. anti-NR2A antibody immunoaffinity was by the of affinity-purified anti-NR2A-(1381–1394) antibodies to protein using an The anti-FLAG M2 monoclonal antibody immunoaffinity was purchased from HEK 293 cells with NR1-1a, and clones were with 1% and in the presence of a of as described (11Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 68: 507-516Crossref PubMed Scopus (66) Google Scholar). antibody immunoaffinity purification was performed as described for native NMDA receptors (12Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 69: 2138-2144Crossref PubMed Scopus (127) Google Scholar), with of the affinity with 50 mm pH containing of 1 were and immediately to a pH with 2 The were and for [3H]Ro 25-6981 binding or were to the anti-FLAG antibody affinity for 2 at at 4 The was washed in 50 mm pH 7.4, containing 5 mm 5 mm and 1% at for 2 h at 4 of the anti-FLAG antibody affinity was as described The NR2A/NR2BFLAG-containing were by using the different NMDA receptor antibodies Additionally, the co-association of NR2A and NR2B subunits in the cells was determined by Thus, of the cell homogenates and the anti-NR2A antibody affinity were by using anti-NR2A, and anti-FLAG The NR2 subunit by the anti-NR2A antibody immunoaffinity was and the immunoreactivities in the anti-NR2A antibody affinity were expressed as a of the in the prepared from rat were with 1% and pH for at and NMDA receptors were purified and anti-NR2A antibody affinity columns in as described (12Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 69: 2138-2144Crossref PubMed Scopus (127) Google Scholar). The double immunoaffinity-purified material was by using affinity-purified and anti-NR2A-(1381–1394) Thus, a (100 μl) of the double purified material was and by using a range of antibody and the ratio of NR1 to NR2 subunits was determined at the antibody i.e. 50 for that the antibody have been used for this when the antibody in was was gel was carried out using polyacrylamide were prepared using the method of protein (19Cik M. Chazot P.L. Stephenson F.A. Biochem. J. 1993; 296: 877-883Crossref PubMed Scopus (104) Google Scholar). Anti-NR1 anti-NR2A, and anti-NR2B antibodies were used at a of 1 and anti-c-Myc antibodies were used at of and and mouse antibodies Pharmacia were used at a of were detected using the Pharmacia Biotech). were by using in the range of the (12Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 69: 2138-2144Crossref PubMed Scopus (127) Google Scholar). of the FLAG-tagged and c-Myc forms of the NR2B subunit was by The anti-FLAG and anti-c-Myc antibodies both a species with a molecular mass of 180 kDa in HEK 293 cells transfected with the NR2B subunit 1 2 and The 180-kDa species is consistent with that previously identified as the NR2B subunit (11Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 68: 507-516Crossref PubMed Scopus (66) Google Scholar). In the anti-c-Myc antibody detected with molecular that described for the NR2B subunit. These were also in HEK 293 cells and thus are that are with the anti-c-Myc The anti-NR2B-(46–60) antibody a single polypeptide species of 180 kDa in HEK 293 cells transfected with the wild-type NR2B subunit 1 However, anti-NR2B-(46–60) antibody immunoreactivity was detected in HEK 293 cells transfected with either of the epitope-tagged forms of the NR2B subunit and The of the epitope tags between amino acids 53 and 54 of the NR2B subunit was coincident with the peptide used to the anti-NR2B-(46–60) the epitope by the anti-NR2B-(46–60) antibody was However, of HEK 293 cells transfected with either or probed with the antibody showed that the two 180-kDa epitope-tagged forms of the NR2B subunit were expressed to 1 cytotoxicity was used to the epitope-tagged NR2B subunits were of with the NR1-1a subunit to form functional receptors. was that HEK 293 cells transfected with NR1-1a/NR2BFLAG or and of the cytotoxicity with Furthermore, HEK 293 cells transfected with either NR1-1a/NR2B or NR1-1a/NR2BFLAG displayed for the [3H]Ro with of and nm the for the binding of [3H]Ro 25-6981 to wild-type and receptors. These results the epitope-tagged NR2B subunits with the NR1-1a subunit to form receptors that no in from wild-type NR1-1a/NR2B receptors. In this study, consistent with results previously reported (11Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 68: 507-516Crossref PubMed Scopus (66) Google Scholar), 1% and of the NR1 and NR2 subunit immunoreactivities expressed in HEK 293 cells transfected with The material was subjected to immunoaffinity chromatography as in Fig. and was used to the purified receptors. the was to an anti-NR2A antibody immunoaffinity and the material and affinity was for receptor subunit antibody immunoreactivities. The anti-NR2A antibody was of the anti-NR2A antibody immunoreactivity was 1 and of the that of the anti-FLAG antibody 1 and and of the anti-c-Myc antibody immunoreactivities were by the anti-NR2A antibody immunoaffinity In the anti-NR2A antibody immunoreactivity was detected in to anti-FLAG, and antibody immunoreactivities and 5 and The presence of antibody immunoreactivity in anti-NR2A antibody immunoaffinity-purified material is consistent with the co-association of NR1 and NR2 subunits within the same NMDA receptor of the of three NR2 subunits in the same NMDA receptor complex. NMDA receptors were purified by anti-NR2A and anti-FLAG antibody immunoaffinity chromatography in series. The double immunoaffinity-purified material was by as described and and anti-NR2A antibody immunoaffinity-purified and antibody immunoaffinity-purified were with the anti-NR2A with the anti-c-Myc with the anti-FLAG and with the The of the molecular mass are the This is of at least three immunoaffinity from three The material was subjected to further using the anti-FLAG antibody affinity The results are in Fig. that the anti-FLAG antibody immunoreactivity was by the anti-FLAG antibody immunoaffinity and The affinity was further by anti-FLAG, and antibody immunoreactivities were detected in the double immunoaffinity-purified and important, the also demonstrated in the the presence of anti-c-Myc antibody immunoreactivity The of anti-c-Myc antibody immunoreactivity in material that has been purified anti-NR2A and anti-FLAG antibody immunoaffinity columns in the presence of a population of NMDA receptors that the NR2A subunit with NR1-1a and both the FLAG- and c-Myc-tagged forms of the NR2B i.e. in this receptor three NR2 subunits are within receptor complex. when the anti-NR2A, anti-FLAG, and anti-c-Myc antibody in the double immunopurified material were a ratio of and that were using different antibodies at single antibody Full required to this ratio. The results that three NR2 subunits co-assemble within an NMDA receptor the NMDA receptor has a quaternary this two NR1 this the ratio of NR1 to NR2 subunits in NMDA receptors was determined by as described previously for the determination of receptor subunit stoichiometry S. Stephenson F.A. J. Biol. Chem. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar). Thus, cloned NR1-1a/NR2BFLAG receptors were purified by followed by anti-FLAG antibody immunoaffinity from the double immunoaffinity-purified material were and by using a of the antibody i.e. and anti-FLAG antibody and corresponding are in Fig. the the at 50 antibody was a of The NR1/NR2 subunit ratio for cloned receptors determined at 50 antibody was for three double immunoaffinity-purified preparations of cloned NR1-1a/NR2BFLAG receptors is to determine the NR1/NR2 subunit in native receptors to that the for the cloned receptors was an artifact of the expression Thus, NMDA receptors were purified from rat by followed by anti-NR2A antibody immunoaffinity described for cloned receptors, the double immunoaffinity-purified material was by using and anti-NR2A antibodies The NR1/NR2 subunit ratio determined at 50 antibody was for two double immunoaffinity-purified preparations this receptor population a of and receptors, the to the antibody double purified population (12Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 69: 2138-2144Crossref PubMed Scopus (127) Google Scholar). Thus, this ratio is an the NR2 subunit to determined using an anti-NR2A antibody (see of and NMDA thus into the NR2B subunits in receptors. receptor composed of two NR1 subunits and three NR2 subunits have an NR1/NR2 subunit i.e. This is for native receptors. important, in double immunoaffinity-purified receptor NR2 immunoreactivity was that for the possibility that the co-immunopurification of three NR2 subunits is an artifact of the solubilization experiments were carried out in which the NMDA receptor subunits NR1-1a, and were expressed in HEK 293 cells. prepared from cells transfected with the different subunits were and subjected to anti-NR2A antibody immunoaffinity purification as described The results of experiments are in Fig. that anti-NR2A antibody immunoreactivity was detected in the anti-NR2A antibody immunoaffinity In anti-FLAG, and anti-c-Myc antibody detected in the both and anti-NR2A antibody immunoaffinity detected in the anti-NR2A antibody immunoaffinity and This that the co-immunopurification of three NR2 subunits is to to the of NMDA receptor subunits the solubilization procedure. the that NR2 and, more important, NR1-1a subunits are both by the different antibody immunoaffinity columns in that the co-association of the NR1 and three NR2 subunits an artifact of the expression In the transfected HEK 293 the subunits are and is a for subunit The purified receptor preparations of native NMDA receptors. this the binding of the [3H]Ro 25-6981 to immunopurified receptors was [3H]Ro 25-6981 is an has been in functional studies to receptors with a with other subunit combinations V. P. Kemp J.A. J. Pharmacol. 1997; Google Scholar). [3H]Ro 25-6981 binding was carried out in HEK 293 cells transfected with either single or double combinations of NMDA receptor affinity [3H]Ro 25-6981 binding to NR1-1a/NR2B receptors, with no binding to NR1-1a, or NR2B subunits expressed or to or the by V. P. Kemp J.A. J. Pharmacol. 1997; Google Scholar) and Chazot P.L. Stephenson F.A. J. Pharmacol. PubMed Scopus Google Scholar). In this study, have determined the NR2 subunit copy number of NMDA receptors. receptors, a subunit combination that is to in as a (12Chazot P.L. Stephenson F.A. J. Neurochem. 1997; 69: 2138-2144Crossref PubMed Scopus (127) Google Scholar), the to [3H]Ro that receptors must Thus, HEK 293 cells were with NR1-1a, and NR2B homogenates were prepared and with 1% and and receptors were purified by anti-NR2A antibody affinity The i.e. NR2A NMDA receptors that and were by both and [3H]Ro 25-6981 results are in Fig. In Fig. that [3H]Ro 25-6981 binding was detected in the from the affinity Furthermore, the of [3H]Ro binding that for the and NR2B which were detected in the purified receptor The of the NR2B subunit the anti-NR2A antibody affinity is an artifact of receptor or immunocross-reactivity experiments as described showed that no anti-NR2B antibody immunoreactivity was and from an anti-NR2A antibody affinity when HEK 293 cells transfected with single subunit NMDA receptor clones were and purified (see the of NR2 an of the that [3H]Ro 25-6981 with a single affinity nm to the anti-NR2A receptors Thus, the of affinity binding of the NMDA receptor to receptors purified by anti-NR2A antibody affinity chromatography binding to receptors the other subunit combinations this affinity [3H]Ro 25-6981 A). These receptors must functional to [3H]Ro the receptor must This study reports the of NMDA receptors in which three NR2 subunits are within the same NMDA receptor complex. Furthermore, the NR1/NR2 subunit ratio was determined for both native and this ratio a number of NR2 with NR1 subunits Thus, in with studies that the that at least two of the NR1 subunit co-assemble within the NMDA receptor complex (15Béhé P. Stern P. Wyllie D.J.A. Nassar M. Schoepfer R. Colquhoun D. Proc. R. Soc. Lond. 1995; 262: 205-213Crossref PubMed Scopus (118) Google Scholar, 16Premkumar L.S. Auerbach A. J. Gen. Physiol. 1997; 110: 485-502Crossref PubMed Scopus (100) Google Scholar, 17Laube B. Kuhse J. Betz H. J. Neurosci. 1998; 18: 2954-2961Crossref PubMed Google Scholar), results suggest that the NMDA receptor is at least in structure. This at variance with the NR2 subunit copy number reported from In study, wild-type and mutant NR2B subunits were with wild-type NR1 in activation of the resultant receptors identified three receptor that to and receptors. of the of the three receptor by the ratio of the mutant to the wild-type NR2B subunit clones transfected was of two NR2 receptor complex B. Kuhse J. Betz H. J. Neurosci. 1998; 18: 2954-2961Crossref PubMed Google Scholar). an alternative mutant NR2B, and Auerbach L.S. Auerbach A. J. Gen. Physiol. 1997; 110: 485-502Crossref PubMed Scopus (100) Google Scholar) also that are two of the NR2 receptor complex. However, (15Béhé P. Stern P. Wyllie D.J.A. Nassar M. Schoepfer R. Colquhoun D. Proc. R. Soc. Lond. 1995; 262: 205-213Crossref PubMed Scopus (118) Google Scholar) that their results from studies by the presence of two NR2 subunits. were used to determine the number of NR1 The results were inconclusive, with either two (15Béhé P. Stern P. Wyllie D.J.A. Nassar M. Schoepfer R. Colquhoun D. Proc. R. Soc. Lond. 1995; 262: 205-213Crossref PubMed Scopus (118) Google Scholar, 17Laube B. Kuhse J. Betz H. J. Neurosci. 1998; 18: 2954-2961Crossref PubMed Google Scholar) or three L.S. Auerbach A. J. Gen. Physiol. 1997; 110: 485-502Crossref PubMed Scopus (100) Google Scholar) NR1 receptor complex. to subunit copy by the of is by the of defined for subunit combinations which the different results in the In this study, biochemical were used to the subunit of NMDA and the of functional are is to that a population of NMDA receptors in which three NR2 subunits are the of solubilization and immunoaffinity purification that receptors are of the receptor Furthermore, results have that when three NMDA receptor subunit clones are the is a population of receptors with regard to their subunit This is in with a study in which cells were transfected with the and NR2B subunit the displayed distinct from those of either or receptors, consistent with the co-association of subunits within the same receptor complex F.A. Proc. Natl. Acad. Sci. U. S. A. 1997; PubMed Scopus Google Scholar). that expressed NMDA receptors are also with to subunit within receptors, and excluded that a of receptors that two of NR2 is is the further possibility that the receptors an of subunits by their expression in transfected cells. the in the in the determination of NR1/NR2 subunit is that native NMDA receptors NR1 and NR2 subunits. NR1 and NR2 subunits are both in the double immunoaffinity-purified preparations described the that subunit antibody affinity columns are used for NMDA receptor Furthermore, the experiments that were carried out the possibility of between NR1 and NR2 subunits solubilization and have also demonstrated that HEK 293 cells transfected with NR1-1a, and NR2B clones and purified by anti-NR2A antibody affinity chromatography the to with affinity the [3H]Ro Thus, the of affinity [3H]Ro 25-6981 binding to receptors purified by anti-NR2A antibody affinity chromatography binding to receptors and that receptors are for the of [3H]Ro 25-6981 and S. and M. for the of the NMDA receptor