The DEXH Protein Product of the DHX36 Gene Is the Major Source of Tetramolecular Quadruplex G4-DNA Resolving Activity in HeLa Cell Lysates

Abstract

G4-DNA is a highly stable alternative DNA structure that can form spontaneously in guanine-rich regions of single-stranded DNA under physiological conditions. Since a number of biological processes create such single-stranded regions, G4-DNA occurrence must be regulated. To date, resolution of tetramolecular G4-DNA into single strands (G4-resolvase activity) has been observed only in recombinant RecQ DNA helicases. We previously reported that human cell lysates possess tetramolecular G4-DNA resolving activity (Harrington, C., Lan, Y., and Akman, S. (1997) J. Biol Chem. 272, 24631–24636). Here we report the first complete purification of a major non-RecQ, NTP-dependent G4-DNA resolving enzyme from human cell lysates. This enzyme is identified as the DEXH helicase product of gene DHX36 (also known as RHAU). G4-DNA resolving activity was captured from HeLa cell lysates on G4-DNA affinity beads and further purified by gel filtration chromatography. The DHX36 gene product was identified by mass spectrometric sequencing of a tryptic digest from the protein band on SDS-PAGE associated with activity. DHX36 was cloned within a His6-tagging vector, expressed, and purified from Escherichia coli. Inhibition and substrate resolution assays showed that recombinant DHX36 protein displayed robust, highly specific G4-DNA resolving activity. Immunodepletion of HeLa lysates by a monoclonal antibody to the DHX36 product removed ca. 77% of the enzyme from lysates and reduced G4-DNA resolving activity to 46.0 ± 0.4% of control, demonstrating that DHX36 protein is responsible for the majority of tetramolecular G4-DNA resolvase activity. G4-DNA is a highly stable alternative DNA structure that can form spontaneously in guanine-rich regions of single-stranded DNA under physiological conditions. Since a number of biological processes create such single-stranded regions, G4-DNA occurrence must be regulated. To date, resolution of tetramolecular G4-DNA into single strands (G4-resolvase activity) has been observed only in recombinant RecQ DNA helicases. We previously reported that human cell lysates possess tetramolecular G4-DNA resolving activity (Harrington, C., Lan, Y., and Akman, S. (1997) J. Biol Chem. 272, 24631–24636). Here we report the first complete purification of a major non-RecQ, NTP-dependent G4-DNA resolving enzyme from human cell lysates. This enzyme is identified as the DEXH helicase product of gene DHX36 (also known as RHAU). G4-DNA resolving activity was captured from HeLa cell lysates on G4-DNA affinity beads and further purified by gel filtration chromatography. The DHX36 gene product was identified by mass spectrometric sequencing of a tryptic digest from the protein band on SDS-PAGE associated with activity. DHX36 was cloned within a His6-tagging vector, expressed, and purified from Escherichia coli. Inhibition and substrate resolution assays showed that recombinant DHX36 protein displayed robust, highly specific G4-DNA resolving activity. Immunodepletion of HeLa lysates by a monoclonal antibody to the DHX36 product removed ca. 77% of the enzyme from lysates and reduced G4-DNA resolving activity to 46.0 ± 0.4% of control, demonstrating that DHX36 protein is responsible for the majority of tetramolecular G4-DNA resolvase activity. G4-DNA is an alternative highly stable DNA structure forming within runs of guanine bases. It has been amply described previously (1.Arthanari H. Bolton P.H. Chem. Biol. 2001; 8: 221-230Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). G4-DNA structures have the potential to disrupt normal duplex DNA; therefore, it might be expected that the genome would have minimized the usage of runs of deoxyguanosine. On the contrary, a growing body of data support the hypothesis that formation of G4-DNA in vivo is a recognized structural motif of specialized utility for key biological processes. Recent studies with a fluorescent G4-DNA-binding ligand, as well as a specific G4-DNA-binding protein, support the presence of G4-DNA structures located at human telomeres in vivo (2.Chang C.-C. Kuo I.-C. Ling I.-F. Chen C.-T. Chen H.-C. Lou P.-J. Lin J.-J. Chang T.-C. Anal. Chem. 2004; 76: 4490-4494Crossref PubMed Scopus (154) Google Scholar, 3.Patel S.D. Isalan M. Gavory G. Ladame S. Choo Y. Balasubramanian S. Biochemistry. 2004; 43: 13452-13458Crossref PubMed Scopus (45) Google Scholar). In addition to the aforementioned telomeres, other guanine-rich regions in human DNA readily form G4-DNA structures in vitro and make up specific genetic control elements, including the immunoglobin heavy chain switch region (4.Sen D. Gilbert W. Nature. 1988; 28: 364-366Crossref Scopus (1425) Google Scholar), guanine-rich regions of ribosomal DNA (5.Hanakahi L.A. Sun H. Maizels N. J. Biol. Chem. 1999; 274: 15908-15912Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar), the d(pCGG) repeats of the fragile X mental retardation gene (6.Fry M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4950-4954Crossref PubMed Scopus (310) Google Scholar), promoters of proliferation-associated genes, such as the c-MYC (7.Simonsson T. Pecinka P. Kubista M. Nucleic Acids Res. 1998; 26: 1167-1172Crossref PubMed Scopus (519) Google Scholar, 8.Siddiqui-Jain A. Grand C.L. Bearss D.J. Hurley L.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11593-11598Crossref PubMed Scopus (1704) Google Scholar), PDGF-A (9.Rezler E.M. Qin Y. Hurley L.H. Clin. Cancer Res. 2003; 9: 6124SGoogle Scholar), RET (10.Sun D.Y. Pourpak A. Beetz K. Hurley L.H. Clin. Cancer Res. 2003; 9: 6122S-6123SGoogle Scholar), and the diabetes susceptibility locus IDDM2 promoter (11.Lew A. Rutter W.J. Kennedy G.C. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12508-12512Crossref PubMed Scopus (99) Google Scholar). It has been shown that a unimolecular G4-DNA structure has a repressor function in the c-MYC promoter (8.Siddiqui-Jain A. Grand C.L. Bearss D.J. Hurley L.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11593-11598Crossref PubMed Scopus (1704) Google Scholar). Compounds that stabilize G4-DNA in vivo have generated much interest because of their antitumor activity, suggesting that G4-DNA structures might be a general control motif utilized to inhibit cell growth, possibly by stabilizing repressor elements in growth related promoters (8.Siddiqui-Jain A. Grand C.L. Bearss D.J. Hurley L.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11593-11598Crossref PubMed Scopus (1704) Google Scholar, 10.Sun D.Y. Pourpak A. Beetz K. Hurley L.H. Clin. Cancer Res. 2003; 9: 6122S-6123SGoogle Scholar, 12.Mergny J.L. Helene C. Nat. Med. 1998; 4: 1366-1367Crossref PubMed Scopus (373) Google Scholar, 13.Gowan S.M. Harrison J.R. Patterson L. Valenti M. Read M.A. Neidle S. Kelland L.R. Mol. Pharmacology. 2002; 61: 1154-1162Crossref PubMed Scopus (257) Google Scholar, 14.Grand C.L. Powell T.J. Nagle R.B. Bearss D.J. Tye D. Gleason-Guzman M. Hurley L.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6140-6145Crossref PubMed Scopus (56) Google Scholar). In addition to possible functional roles of G4-DNA, given the concentrations of nucleic acids in the cell and the single-stranded nature of DNA involved in replication, transcription, and recombination, it is likely that aberrant G4 structures form spontaneously in vivo. In this regard, it has been recently shown that a recombinant transcription construct containing the mammalian immunoglobulin Sμ and Sγ3 switch regions formed intramolecular G4 structures in the non-transcribed DNA strand of the transcription unit upon induction of transcription (15.Duquette M.L. Handa P. Vincent J.A. Taylor A.F. Maizels N. Genes Dev. 2004; 18: 1618-1629Crossref PubMed Scopus (386) Google Scholar). Whether G4-DNA structures are formed for biological purpose or by stochastic accident, once present, G4-DNA structures are highly stable. In order for such structures to be dynamic and rapidly resolved, enzymes involved in the recognition of G4-DNA structures and their resolution back into separate nucleotide strands would be of great importance. To date, certain members of the RecQ family of DNA helicases have been observed to catalyze the resolution of G4-DNA structures back to single-stranded DNA (G4-DNA resolvase activity) (16.Hickson I.D. Nat. Rev. Cancer. 2003; 3: 169-178Crossref PubMed Scopus (575) Google Scholar, 17.Sun H. Karow J.K. Hickson I.D. Maizels N. J. Biol. Chem. 1998; 273: 27587-27592Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 18.Fry M. Loeb L.A. J. Biol. Chem. 1999; 274: 12797-12802Abstract Full Text Full Text PDF PubMed Scopus (312) Google Scholar). We previously reported that human cell lysates possess traceable tetramolecular G4-DNA resolvase activity that is separable from nuclease and double-stranded helicase activities (19.Harrington C. Lan Y. Akman S.A. J. Biol. Chem. 1997; 272: 24631-24636Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). In this study, we have utilized G4-DNA affinity chromatography and mass spectrometry to purify and identify the major contributing protein enabling tetramolecular G4-DNA resolvase activity in HeLa cell lysates. G4-DNA Substrate Generation and G4-DNA Resolution Activity Assay—To construct synthetic pure G4-DNA substrate for the activity assay or G4-DNA for affinity chromatography, a 1-μmol synthesis of either gel-purified 5 (and 6)-carboxytetramethylrhodamine-labeled Z33 oligomer DNA sequence: 5′-AAAGTGATGGTGGTGGGGGAAGGATTTCGAACCT or 3′-biotin-labeled Z33 oligomer was purchased from Oligos Etc. The procedures for tetramolecular G4-DNA formation and our standard G4-DNA resolution assay have been described previously (19.Harrington C. Lan Y. Akman S.A. J. Biol. Chem. 1997; 272: 24631-24636Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). To test the ability of recombinant DHX36 protein to resolve other known tetramolecular G4-DNA structures, we used a 1-μmol synthesis of gel-purified TP sequence of the immunoglobin heavy chain switch region (5′-TGGACCAGACCTAGCAGCTATGGGGGAGCTGGGGAAGGTGGGAATGTGA) and “rD4,” 3The abbreviations used are: rD4, an oligonucleotide sequence from the human 28 S ribosomal RNA gene (GenBank™ accession number M11167); βME, β-mercaptoethanol; GSPB, G4-DNA-bound streptavidin paramagnetic beads; G4R1, G4 Resolvase-1, a proposed name for the DHX36 gene product; AU, absorbance unit; RSB, resolvase salt buffer; Q-TOF, quadrupole time-of-flight; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; mAb, monoclonal antibody. an oligonucleotide sequence from the human 28 S ribosomal RNA gene (5′-TTGAAAATCCGGGGGAGAGGGTGTAAATCTCG, GenBank™ accession number M11167). After quadruplex DNA was formed and isolated as above, it was end-labeled with [γ-32P]dATP by T4 kinase (Promega) according to manufacturer's instructions and purified by G-25 Sephadex Microspin™ columns (Amersham Biosciences). Generation of G4-DNA-bound Streptavidin Paramagnetic Beads (GSPB)—Paramagnetic affinity beads were prepared by standard methods (see supplemental data). Isolation of G4-DNA Resolvase from HeLa Cells—Approximately 0.5 g of frozen HeLa cell pellet were thawed at 37 °C, and immediately an equal volume of ice-cold 2× lysis buffer (100 mm Tris acetate, pH 7.8, 0.4 mm EDTA, 40 mm βME, 0.02% Triton X-100, 20% glycerol, 50 μg/ml leupeptin, 100 μg/ml pepstatin; more recently we have found that leupeptin and pepstatin can be substituted with Sigma protease inhibitor mixture) was added. Lysates were sonicated on ice by a Branson Sonifier 4500. Supernatants were clarified by microcentrifugation. Lysates were preincubated with competitor DNA by combining 0.95 ml of HeLa cell lysate, 2 ml of RSB, 100 AU of randomized 33 base pair oligomers (HHN)11, 10 μlof0.5 m EDTA and then incubating on ice for 10 min. Fifty μl of GSPB were added, and material was incubated at 37 °C for 10 min (with mixing every 3 min) followed by cooling on ice and pelleting by magnet. Lysate-bound GSPB were then washed consecutively in 1-ml volumes of RSB, resolvase high salt buffer (consisting of 50 mm Tris acetate, pH 7.8, 3.0 m NaCl, 2.5 mm MgCl2, 10% glycerol), and finally RSB again. For ATP-dependent elution from beads, 60 μl of ATP-dependent elution buffer (CEB, consisting of RSB + 10 mm ATP) was prewarmed at 37 °C and added to washed GSPB. The material was incubated at 37 °C for 1 min, followed by addition of 6 μl of 5 m NaCl and further incubation at 37 °C for an additional minute. Beads were pelleted and supernatant collected. This elution process was repeated once. Gel filtration chromatography of ATP-dependent elution was done by standard methods on a tandem double Sephadex G-200 column with a running buffer of RSB made 300 mm in NaCl at a flow rate of 0.25 ml/min. One-half-ml fractions were collected; 5-μl aliquots were tested for G4-DNA resolvase activity. Pooled reactions were precipitated in acetone and assayed by SDS-PAGE with colloidal Coomassie G-250 stain. Bands excised from SDS gels were sent to the Keck Center (Yale University) for tryptic digest and quadrupole time-of-flight (Q-TOF) mass spectrometry analysis followed by Mascot analysis for protein matches. Cloning of DHX36 and the Isolation of Recombinant G4-DNA Resolvase—I.M.A.G.E. consortium clone 5273384 containing the DHX36 gene was purchased from Invitrogen Corp. The gene insert was corrected of errors and cloned into the PshAI-BamHI site of expression plasmid TriEx-4 (Novagen) by standard methods. Recombinant proteins were produced by transformation of Escherichia coli strain Rosetta 2 (Novagen) with either TriEx-4 DHX36 or TriEx-4 vector alone. Recombinant proteins were initially purified by means of a His6 tag by utilizing the TALON purification kit (Clontech). Rosetta 2 cell lysates were isolated and bound to TALON cobalt resin as recommended by the manufacturer. TALON resin (1 ml bed volume) was eluted twice with 1 ml of histidine elution buffer (0.7 m histidine, pH 6.0, 8.6 mm βME, Sigma protease inhibitor mixture), followed by 1 ml of 250 mm EDTA, pH 6.0. For the second phase of purification, eluates were combined and incubated with GSPB in 0.4% α-lactalbumin and 100 AU of 33-base randomized oligomer (HHN)11 at 37 °C for 10 min. Bound GSPB were washed two times in SSC (4×) with 0.1% α-lactalbumin. High purity recombinant DHX36 (20,000 units per μg, units defined previously (19.Harrington C. Lan Y. Akman S.A. J. Biol. Chem. 1997; 272: 24631-24636Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar)) was obtained by ATP-dependent elution of GSPB as described for HeLa α-lactalbumin and Sigma protease inhibitor of leupeptin and were added to the elution G4-DNA and Resolution G4-DNA, duplex and duplex were made utilizing oligomers that were previously used to helicase activity J.A. C. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar). G4-DNA used in tetramolecular and ribosomal of competitor structures were made from to an of competitor to In standard competitor were added first to on unit of recombinant DHX36 was added, and then the was by the addition of of 5 (and 6)-carboxytetramethylrhodamine-labeled were incubated at 37 °C for min and with 5 μl of mm antibody of HeLa cell and were done by standard means (see supplemental data). The of the DHX36 a G4-DNA this we report the purification, and of the major tetramolecular G4-DNA resolvase in HeLa cell lysates. the purification used for the protein responsible for G4-DNA resolvase activity. It is of that we initially used G4-DNA affinity chromatography to activity utilizing other activity to be captured by a from complete lysates. a standard G4-DNA resolvase activity assay a previously tetramolecular G4-DNA structure formed by Z33 as substrate (19.Harrington C. Lan Y. Akman S.A. J. Biol. Chem. 1997; 272: 24631-24636Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). In pure G4-DNA was to HeLa cell lysates in the presence of and the G4-DNA tetramolecular substrate of was to by activity. In the of or MgCl2, G4-DNA into DNA of HeLa cell lysates with GSPB HeLa lysates of G4-DNA resolvase activity and in GSPB with high of activity that be assayed on GSPB G4-DNA resolving activity bound to GSPB in the presence of EDTA, and of the enzyme with GSPB resolvase activity and of G4-DNA resolvase activity to GSPB to a 2 m NaCl to beads of other bound proteins the majority of G4-DNA resolvase activity on the GSPB ATP-dependent G4-DNA resolvase activity was eluted from GSPB into by 10 mm to beads and the NaCl to 300 mm previously up to 2 m The the in the that GSPB was by SDS-PAGE a number of protein were an in an protein band found to be associated with activity in gel filtration activity was this protein band was used for mass spectrometry a standard G4-DNA resolvase activity assay of ATP-dependent GSPB by gel filtration chromatography on Sephadex G4-DNA resolvase assays of from gel filtration chromatography only a single of resolvase activity, suggesting major of G4-DNA G4-DNA resolvase activity was in fractions and and elution with a mass of Gel filtration fractions were in in by in for analysis by band at mass of with the of G4-DNA resolvase activity observed in mass spectrometry of tryptic of this protein identified (see supplemental with the DEXH helicase DHX36 D.J. 1999; PubMed Scopus Google Scholar). The DHX36 protein has a mass of that well with the observed mass on SDS-PAGE of of the DHX36 sequence the protein to be a DEXH helicase with activity and we previously reported for G4-DNA resolvase activity in (19.Harrington C. Lan Y. Akman S.A. J. Biol. Chem. 1997; 272: 24631-24636Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). In the of DHX36 as a G4-DNA resolvase is by that expression and purification of recombinant DHX36 in coli is associated with G4-DNA resolving activity. The majority of material two of purification was a protein of mass mass spectrometry of tryptic of the protein it to be recombinant human DHX36 (see supplemental data). protein of was isolated by of the purification to lysates of by TriEx-4 vector insert recombinant DHX36 protein isolated from TriEx-4 coli G4-DNA resolvase activity material purified from TriEx-4 coli G4-DNA resolvase activity data G4-DNA resolvase activity to DHX36 G4-DNA to and the substrate of recombinant DHX36 product for G4-DNA with duplex DNA helicase G4-DNA resolution of G4-DNA, a of a form duplex was to have a of and of an In other resolution of form duplex DNA at more recombinant enzyme was for resolution of of Z33 G4-DNA data that DHX36 has high for the G4-DNA substrate in to other duplex DNA that substrate of recombinant DHX36 protein product other tetramolecular G4-DNA mammalian of TP G4-DNA, generated from the immunoglobulin switch and human ribosomal G4-DNA inhibit resolution of Z33 G4-DNA, single-stranded Z33 oligomer Activity assays the of resolution of that ribosomal G4-DNA is readily In TP G4-DNA structure is only The that TP G4-DNA is an is resolved, that DHX36 and TP G4-DNA well DHX36 an in HeLa Lysates for the of G4-DNA of DHX36 protein in HeLa lysates and to the to DHX36 gene product to the G4-DNA resolvase activity by specific of HeLa cell we a to that DHX36 protein for ± ± of protein mass in HeLa cell lysates (see supplemental data). a analysis of HeLa cell by protein product with by a control of a of DHX36 protein product the was and DHX36 protein were with a of the of DHX36 protein product was to be removed from the lysates with the In standard G4-DNA resolvase activity assays the for the DHX36 protein 46.0 ± 0.4% ± of the G4-DNA resolvase activity as lysates with a control DHX36 protein product is the the G4-DNA resolvase in HeLa cell lysates. of data that of DHX36 protein product of the G4-DNA resolvase activity from HeLa lysates. of G4-DNA resolvase activity of HeLa cell lysates Since the and of tetramolecular G4-DNA (4.Sen D. Gilbert W. Nature. 1988; 28: 364-366Crossref Scopus (1425) Google Scholar), has a it might be formed in a proteins to that RecQ a nuclease for DNA and RNA quadruplex that has been found in and identified as Gilbert W. 1994; Full Text PDF PubMed Scopus Google and an DNA quadruplex nuclease activity has been found in human H. A. Maizels N. Proc. Natl. Acad. Sci. U. S. A. 2001; PubMed Scopus Google Scholar). The protein responsible for the activity has to be and mammalian proteins have been found to G4-DNA by affinity chromatography Gilbert W. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, L.A. Sun H. L.A. Maizels N. J. Biol. Chem. 1999; 274: Full Text Full Text PDF PubMed Scopus Google Scholar), to our the DHX36 protein product is the first G4-DNA resolving enzyme to be isolated from human cell lysates. this protein a key for quadruplex Since G4-DNA resolving activity be a for this protein, we to the name G4 for the DHX36 gene is known as and RecQ helicases are ATP-dependent enzymes of resolving certain G4-DNA structures in vitro and have been identified by genetic studies from and that their It is that RecQ family proteins were identified by our G4-DNA affinity this be to of RecQ proteins the high salt of G4-DNA affinity beads a of activity is that a to G4-DNA resolving activity in HeLa lysates the RecQ protein The of DHX36 as responsible for a major G4-DNA resolvase activity on biological The of the gene have been previously H. M. C. D. Y. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google and are of helicases. helicases can be on DNA or RNA or nucleic The human protein to DHX36 by is the DEXH protein DNA helicase has with DHX36 J. W. D.J. Nucleic Acids Res. 1997; PubMed Scopus Google Scholar). This protein has roles in transcription, DNA and in with RNA T. Nat. 1998; PubMed Scopus Google Scholar, S. T. H. T. T. M. A. T. Mol. Biol. 2001; PubMed Scopus Google Scholar, S. J. Biol. Chem. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar). DEXH helicase from the for of certain guanine-rich DNA and has been to resolve G4-DNA on the strand of DNA replication, of activity M. A. Nat. 2002; 4: Scopus Google Scholar). of of was found to of telomeres and a high of in H. M. M. S. M. S. A. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). and DHX36 protein helicases are G4-DNA structures, certain DEXH proteins a family of DNA enzymes in quadruplex G4-DNA in the the function of the DHX36 protein H. M. C. D. Y. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). The DHX36 protein product was isolated from HeLa cell lysates as of a protein that bound proteins to the of (and for RNA helicase associated with including the responsible for of H. M. C. D. Y. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). of was associated with of certain AU containing H. M. C. D. Y. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). that the majority of HeLa cell DHX36 is a of H. M. C. D. Y. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). This that the of DHX36 protein have a key function in AU DHX36 expression in human is in 2002; Scholar), is with the protein utilized in with high of High of DHX36 be by rapidly growing including certain of DNA that single-stranded and transcription are to forming G4-DNA the that the DHX36 protein product is a major G4-DNA we are to that are likely to form structures activity is a of the biological function of and a of the roles and of formation in the We M. J. A. and M. for on the We M. W. and for with