Integrase Mutants Defective for Interaction with LEDGF/p75 Are Impairedin Chromosome Tethering and HIV-1Replication

Abstract

The insertion of a DNA copy of its RNA genome into a chromosome of the hostcell is mediated by the viral integrase with the help of mostlyuncharacterized cellular cofactors. We have recently described that thetranscriptional co-activator LEDGF/p75 strongly interacts with HIV-1integrase. Here we show that interaction of HIV-1 integrase with LEDGF/p75 isimportant for viral replication. Using multiple approaches includingtwo-hybrid interaction studies, random and directed mutagenesis, we coulddemonstrate that HIV-1 virus harboring a single mutation that disruptsintegrase-LEDGF/p75 interaction, resulted in defective HIV-1 replication.Furthermore, we found that LEDGF/p75 tethers HIV-1 integrase to chromosomesand that this interaction may be important for the integration process and thereplication of HIV-1. The insertion of a DNA copy of its RNA genome into a chromosome of the hostcell is mediated by the viral integrase with the help of mostlyuncharacterized cellular cofactors. We have recently described that thetranscriptional co-activator LEDGF/p75 strongly interacts with HIV-1integrase. Here we show that interaction of HIV-1 integrase with LEDGF/p75 isimportant for viral replication. Using multiple approaches includingtwo-hybrid interaction studies, random and directed mutagenesis, we coulddemonstrate that HIV-1 virus harboring a single mutation that disruptsintegrase-LEDGF/p75 interaction, resulted in defective HIV-1 replication.Furthermore, we found that LEDGF/p75 tethers HIV-1 integrase to chromosomesand that this interaction may be important for the integration process and thereplication of HIV-1. Integration is an essential step inHIV-1 1The abbreviations used are: HIV-1, human immunodeficiency virus, type 1;IN, integrase; PIC, preintegration complex; LTR, long terminal repeat; HA,hemagglutinin; WT, wild type; GFP, green fluorescent protein.1The abbreviations used are: HIV-1, human immunodeficiency virus, type 1;IN, integrase; PIC, preintegration complex; LTR, long terminal repeat; HA,hemagglutinin; WT, wild type; GFP, green fluorescent protein. replicationcatalyzed by the virus-encoded integrase (IN) protein. The choice ofintegration sites in cellular chromosomes is affected by the heterogeneousstructure of the chromatin. While in vivo HIV-1 integration is notsequence-specific, transcriptionally inactive regions of the genome, such ascentromeres and telomeres, are disfavored targets(1Carteau S. Hoffmann C. Bushman F. J. Virol. 1998; 72: 4005-4014Crossref PubMed Google Scholar, 2Jordan A. Defechereux P. Verdin E. EMBO J. 2001; 20: 1726-1738Crossref PubMed Scopus (357) Google Scholar, 3Jordan A. Bisgrove D. Verdin E. EMBO J. 2003; 22: 1868-1877Crossref PubMed Scopus (648) Google Scholar).Integration of proviral HIV-1 DNA occurs preferentially into transcriptionalunits of active genes while the oncoretrovirus murine leukemia virus prefersto integrate near the transcription start site of actively transcribed genes(4Schroder A.R. Shinn P. Chen H. Berry C. Ecker J.R. Bushman F. Cell. 2002; 110: 521-529Abstract Full Text Full Text PDF PubMed Scopus (1402) Google Scholar,5Wu X. Li Y. Crise B. Burgess S.M. Science. 2003; 300: 1749-1751Crossref PubMed Scopus (1133) Google Scholar). The differences observedbetween the integration profiles of these two viruses strongly suggest thatcellular cofactors actively tether proviral DNA to specific regions of thegenome (6Bushman F.D. Cell. 2003; 115: 135-138Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). In vivo,integration is mediated by a large nucleoprotein complex called preintegrationcomplex (PIC) containing the viral cDNA, together with viral proteins: matrix(MA), nucleocapsid (NC), reverse transcriptase VPR, and IN. The PIC carriesout DNA cutting and joining reactions(7Bukrinsky M.I. Sharova N. McDonald T.L. Pushkarskaya T. Tarpley W.G. Stevenson M. Proc. Natl.Acad. Sci. U. S. A. 1993; 90: 6125-6129Crossref PubMed Scopus (387) Google Scholar,8Miller M.D. Farnet C.M. Bushman F.D. J. Virol. 1997; 71: 5382-5390Crossref PubMed Google Scholar). In addition, severalcellular proteins join the PIC along its journey from the cytoplasm to thechromosomes such as the high mobility group protein HMGa1, which seemsrequired for integration in vitro(9Turlure F. Devroe E. Silver P.A. Engelman A. Front. Biosci. 2004; 9: 3187-3208Crossref PubMed Scopus (139) Google Scholar, 10Farnet C.M. Bushman F.D. Cell. 1997; 88: 483-492Abstract Full Text Full Text PDF PubMed Scopus (295) Google Scholar, 11Hindmarsh P. Ridky T. Reeves R. Andrake M. Skalka A.M. Leis J. J. Virol. 1999; 73: 2994-3003Crossref PubMed Google Scholar, 12Li L. Yoder K. Hansen M.S. Olvera J. Miller M.D. Bushman F.D. J. Virol. 2000; 74: 10965-10974Crossref PubMed Scopus (83) Google Scholar)by a still unknown mechanism, barrier to autointegration factor and Ku(13Chen H. Engelman A. Proc.Natl. Acad. Sci. U. S. A. 1998; 95: 15270-15274Crossref PubMed Scopus (164) Google Scholar, 14Lin C.W. Engelman A. J.Virol. 2003; 77: 5030-5036Crossref PubMed Scopus (120) Google Scholar, 15Li L. Olvera J.M. Yoder K.E. Mitchell R.S. Butler S.L. Lieber M. Martin S.L. Bushman F.D. EMBO J. 2001; 20: 3272-3281Crossref PubMed Scopus (290) Google Scholar).In addition, INI-1/SNF5, a component of the chromatin remodeling complexSWI/SNF, is a binding partner for IN(16Kalpana G.V. Marmon S. Wang W. Crabtree G.R. Goff S.P. Science. 1994; 266: 2002-2006Crossref PubMed Scopus (457) Google Scholar), and HIV-1 infection mayinduce the cytoplasmic relocation of INI-1/SNF5, leading to its associationwith the incoming PIC (17Turelli P. Doucas V. Craig E. Mangeat B. Klages N. Evans R. Kalpana G. Trono D. Mol.Cell. 2001; 7: 1245-1254Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). Werecently identified LEDGF/p75 as a new cellular binding partner for HIV-1 IN(18Cherepanov P. Maertens G. Proost P. Devreese B. VanBeeumen J. Engelborghs Y. De Clercq E. Debyser Z. J. Biol. Chem. 2003; 278: 372-381Abstract Full Text Full Text PDF PubMed Scopus (567) Google Scholar,19Maertens G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). LEDGF/p75, a member ofthe hepatoma-derived growth factor family is a transcriptional co-activatorwhich plays a protective role during stress-induced apoptosis(20Ganapathy V. Daniels T. Casiano C.A. Autoimmun. Rev. 2003; 2: 290-297Crossref PubMed Scopus (66) Google Scholar). LEDGF/p75 has beenreported as a component of the PIC, and when its expression is silenced IN isfound mostly in the cytoplasm(21Llano M. Vanegas M. Fregoso O. Saenz D. Chung S. Peretz M. Poeschla E.M. J. Virol. 2004; 78: 9524-9537Crossref PubMed Scopus (257) Google Scholar,22Maertens G. Cherepanov P. Debyser Z. Engelborghs Y. Engelman A. J. Biol. Chem. 2004; 279: 33421-33429Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Here, we report that the interaction of IN with LEDGF/p75 is involved inintegration and replication of HIV-1. A single mutation in IN,Gln168 to Ala, disrupted the interaction with LEDGF/p75 withoutaffecting its catalytic activity and abolished the chromosomal targeting of INresulting in integration and replication-deficient viruses. Furthermore, themutation did not affect the nuclear import of HIV-1 integrase. Taken together,our data indicate that integration of HIV-1 is under the control of thecellular cofactor LEDGF/p75. Integrase Mutant Library—Integrase bait plasmid wasamplified in mutagenic conditions (0.2 mm dGTP, 0.2 mmdATP, 1 mm dCTP, 1 mm dTTP, 3 mmMgCl2) according to Cadwell and Joyce(23Cadwell R.C. Joyce G.F. PCRMethods Appl. 1992; 2: 28-33Crossref PubMed Scopus (828) Google Scholar) using the followingoligonucleotides: GGGCTGGCGGTTGGGGTTATTCGCAACGGCGACTGGCTGGAATTC andATCATAAGAAATTCGCCCGGAATTAGCTTGGCTGCAGGTC. PCR product was digested by DpnI andtransformed in yeast with an open empty vector pB27 using classical lithiumacetate protocol. Mutant bait plasmids were obtained by homologousrecombination in yeast (GAP repair). 1.6 millions yeast clones were collected,pooled, and stored at –80 °C as equivalent aliquot fractions of thesame integrase mutant library. The mutation rate in the library was evaluatedby sequencing of 48 random non selected clones and was found to be of about0.5 mutation by the integrase clone. Yeast Two-hybrid Screening Procedure—Two-hybrid screens wereperformed using a cell-to-cell mating protocol(24Fromont-Racine M. Rain J.C. Legrain P. Methods Enzymol. 2002; 350: 513-524Crossref PubMed Scopus (45) Google Scholar). A test screen wasperformed for each bait to adapt the screening conditions. The selectivity ofthe HIS3 reporter gene was eventually modulated with 3-aminotriazole (Sigma)to obtain a maximum of 285 histidine-positive clones for 50 millions diploidsscreened. For all the selected clones, LacZ activity was estimated byoverlay assay on solid media in a 96-well plate format. Inserts of all thepositive clones were amplified by PCR(24Fromont-Racine M. Rain J.C. Legrain P. Methods Enzymol. 2002; 350: 513-524Crossref PubMed Scopus (45) Google Scholar) and then sequenced on anABI 3700 automatic sequencer (Applied Biosystem). Screening of integrasemutant library was based on the loss of β-galactosidase activity. (i)After the mating experiment, yeasts were plated on DO-2 to select diploidscontaining bait and prey plasmids, then LacZ activity was evaluatedby overlay assay. (ii) 192 white and light blue colonies were selected from11,000 diploid yeast cells (containing integrase as bait and LEDGF/p75 as prey(amino acids 168–473). (iii) Inserts were amplified by PCR, sequenced,and analyzed. (iiii) Plasmids of interesting mutants were extracted andphenotypes confirmed by retransformation. Plasmid Construction and Mutagenesis—All mutations weregenerated by using the QuikChange mutagenesis kit (Stratagene). Mutations ofthe pBru molecular clone were performed as described previously(25Petit C. Schwartz O. Mammano F. J. Virol. 1999; 73: 5079-5088Crossref PubMed Google Scholar). The IN synthetic gene(INs) (26Cherepanov P. Pluymers W. Claeys A. Proost P. De Clercq E. Debyser Z. FASEB J. 2000; 14: 1389-1399PubMed Google Scholar)was PCR-amplified using the following primers:5′-GAAGATCTGGCGCTGGTGCATTCCTGGACGGCATTG-3′ and5′-CGGAATTCTTAGTCCTCATCTTGACGAGAG-3′. The resulting PCR fragmentwas subcloned between the BglII and EcoRI sites of pEGFP-C1 vector (Clontech)thus generating the GFP-INs expression vector. The recombinantINQ168L and INQ168A mutants were generated by mutagenesis. The plasmid usedfor the PCR was pRP1012 coding for integrase with a N-terminalHis6-tag (R. Plasterk, Dutch Cancer Institute, Amsterdam, TheNetherlands). The following primers were used: INTQ168L,5′-GTAAGAGATCTGGCTGAAC-3′; INTQ168A,5′-GTAAGAGATGCGGCTGAAC-3′; and INTrev2,5′-TGCTGGTCCTTTCCAAACTGG-3′. The resulting PCR fragments were thendigested with DpnI, generating the pKBINQ168L and pKBINQ168A expressionvectors, respectively. In Vitro Integration Assay—The DNA substrate used in theenzymatic assay corresponds to the U5 LTR end of the HIV-1 genome. The INT1(5′-TGTGGAAAATCTCTAGCAGT) and INT2 (5′-ACTGCTAGAGATTTTCCACA)oligonucleotides were purified by gel electrophoresis on a denaturing ureagel. 5′-End labeling of INT1 was done using polynucleotide T4 kinase and[γ-32P]ATP (Amersham Biosciences), followed by annealingequimolar amounts of INT1 and INT2 in the presence of 100 mm NaCl.The final reaction mixture for the integration assay contained 20mm HEPES (pH 7.5), 5 mm dithiothreitol, 10 mmMgCl2, 75 mm NaCl, 15% (v/v) polyethylene glycol 8000,15% dimethyl sulfoxide, 20 nm oligonucleotide substrate, and 1μm His-tagged IN (final volume of 10 μl). Reactions werestarted by addition of the enzyme and allowed to proceed at 37 °C for 60min. To stop the reactions, formamide loading buffer (95% formamide, 30mm EDTA, 0.1% xylene cyanol, 0.1% bromphenol blue, 0.1% sodiumdodecyl sulfate) was added. Subsequent products were separated in a 15%denaturing polyacrylamide-urea gel and visualized with a PhosphorImager. Cells, Viruses, and Infections—HeLa and 293 cells were grownin Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetalcalf serum (Invitrogen), 100 units of penicillin/ml (Invitrogen), and 100μg of streptomycin/ml (Invitrogen). CEM-A301 cells were grown in RIPA(Invitrogen) supplemented with 10% fetal calf serum (Invitrogen), 100 units ofpenicillin/ml (Invitrogen), and 100 μg of streptomycin/ml (Invitrogen).Virus stocks were by 293 cells with were 3 of HIV-1 were by assay CEM-A301 cells were to of HIV-1 import assay of IN was performed as described C. A. H. E. D. S. C. J. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar) in the presence of and in the of with and LEDGF/p75 expression by on were with with 0.1% For were in by cells were by and for the with for 10 and with IN of J. F. were for followed by with DNA was with in in were with a with a by and were by with 10 μg of with 10 μg of a vector from C. Institute, cells were and in mm NaCl, (pH 5 mm EDTA, 1 mm and for on were for 20 then by at were protein with at The were in buffer and were separated by by using of DNA during cells were with HIV-1 viruses in presence of 1 to to a single and at and 48 were in and units of for 1 at 37 using a DNA The amounts of and HIV-1 DNA were PCR performed with the as described A. P. J.Virol. 2003; 77: PubMed Scopus Google Scholar). was the HIV-1 DNA copy was that in the U5 of the LTR and in the of the gene S.L. Hansen M.S. Bushman F.D. 2001; 7: PubMed Scopus Google Scholar). using primers the and A. P. J.Virol. 2003; 77: PubMed Scopus Google Scholar). DNA using an PCR In a HIV-1 were amplified with two and a HIV-1 containing a at the of the In of PCR, we used specific primers for the and the LTR A. P. J.Virol. 2003; 77: PubMed Scopus Google Scholar). To the to by the during the PCR, a control PCR assay was performed The the PCR obtained in the of primers was HIV-1 DNA of DNA DNA were in to of DNA with A. P. J.Virol. 2003; 77: PubMed Scopus Google Scholar). were the of cells and the of cellular DNA by PCR of gene according of IN in the role of the interaction IN with LEDGF/p75 in the viral replication we screening the IN on LEDGF/p75 to of acids in the of the between acids and not in with the from Cherepanov P. Devroe E. Silver P.A. Engelman A. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar) that binding of LEDGF/p75 with IN is between and we the for LEDGF/p75 IN using yeast screening of a complex library of fragments obtained of the HIV-1 DNA and prey plasmid not and in the this we the in the catalytic of IN between acids and to the acids of IN for interaction we by a library of HIV-1 IN random by PCR random mutagenesis using LEDGF/p75 as LEDGF/p75 interaction were in the of two mutants at were in molecular clones of HIV-1 and viral for replication in the of all the mutations affected the not we to on the and the of two mutants at is a the of this with LEDGF/p75. of these mutants were LEDGF/p75 interaction, as estimated by a and of of LEDGF/p75 with and data In addition, we generated a mutation that the of interaction with LEDGF/p75 is to the the A and We that these mutants for interaction with LEDGF/p75 were still to partner of IN We these mutants active in and mutant purified from and were in the presence of and INQ168A a wild the mutant activity to that of the mutant was defective for not To the of interaction of IN with LEDGF/p75 to a in HIV-1 the and mutations were molecular clones of HIV-1 and viral stocks in virus was between these the virus, that of these mutations not In of these viruses defective for replication in cells and data not Taken these that of the interaction by a in integrase the replication of HIV-1. for the LEDGF/p75 at in of interaction of IN with LEDGF/p75 the integration step during the replication of HIV-1, HIV-1 and of proviral DNA were PCR on from cells LEDGF/p75 interaction mutant viruses IN and IN and the IN inactive mutant were used as In HIV-1 replication was to a single infection of a reverse and of reverse transcriptase stop not reverse transcriptase were and that of the show that of these mutations reverse the of for the while the of high for We the of that to PIC nuclear viruses were at the at all were into the with the virus, in was for virus while the as as the virus, was defective for catalytic mutant 5 virus, as described A. Devroe E. R. Silver P.A. Engelman A. J. Virol. 2002; PubMed Scopus Google Scholar). by at and 48 mutants were for integration mutant show that the mutant a active integrase that not LEDGF/p75 is at the integration suggest that the interaction is involved in integration of the proviral In addition that this interaction not to of the LEDGF/p75 IN to that in the of LEDGF/p75, nuclear was G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google a role of LEDGF/p75 in IN nuclear that of LEDGF/p75 in the G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). Here we show by the a of in cells that were silenced for LEDGF/p75 in nuclear of of LEDGF/p75 expression be an of IN the in the Using an in nuclear import assay based C. A. H. E. D. S. C. J. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar), we found IN was with the in cells control and In addition, and IN mutants to in the is in that interaction with LEDGF/p75 not to be import of IN. LEDGF/p75, which is to be with chromosomes in G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Y. J. T. 2001; PubMed Scopus Google Scholar, S.M. Methods Enzymol. PubMed Scopus Google Scholar, M. Rain J.C. Legrain P. 1997; PubMed Scopus Google Scholar), at the of IN the at the of nuclear the IN is not to GFP, the mutant protein is between nuclear and cytoplasmic with the to the with LEDGF/p75 is not for nuclear of by specific not import in cells with as were with IN and an and were then expression was by was visualized by mutation not IN nuclear cells with coding for the wild type and as were then and IN was followed by To the role of LEDGF/p75 in the nuclear of the binding of the IN mutant to to chromosomes While with chromosomal DNA cells mutants and a to with In inactive of is still to these we is not involved in active nuclear import of IN IN to the chromosomes of the of this protein in the a of multiple approaches based on using random and directed mutagenesis, we of IN with LEDGF/p75 is important for integration and HIV-1. show that LEDGF/p75 plays the role of a the binding of IN to the chromosomes and be involved the HIV-1 PIC to chromatin F.D. Cell. 2003; 115: 135-138Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). The LEDGF/p75 the of IN catalytic site is Using we found of of IN LEDGF/p75 mutation that the interaction has catalytic activity of IN in the of these at in LEDGF/p75 is and the catalytic activity of IN(18Cherepanov P. Maertens G. Proost P. Devreese B. VanBeeumen J. Engelborghs Y. De Clercq E. Debyser Z. J. Biol. Chem. 2003; 278: 372-381Abstract Full Text Full Text PDF PubMed Scopus (567) Google P. Devroe E. Silver P.A. Engelman A. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar). we the mutant was still for IN to cellular the was still to be to that the of IN to thechromosomes and the catalytic activity of integration are by in the protein. of LEDGF/p75 in targeting IN to cellular step to the reaction that into the genome. HIV-1 preintegration complex is LEDGF/p75 at the site LEDGF/p75 as a cofactor for the of theenzymatic activity of HIV-1 integrase. on the nuclear import of IN using in import proteins indicate that LEDGF/p75 is for active nuclear import of IN. In we of to the of as as an of and is that with the catalytic mutant of which a of as as of LEDGF/p75 to of IN we a in the of IN and IN with the while IN S. and R. that by its interaction with LEDGF/p75, IN to in the leading to a of the with preintegration we that the IN and the PIC show that are at the integration that interaction is not the HIV-1 PIC in the Maertens G. Cherepanov P. Debyser Z. Engelborghs Y. Engelman A. J. Biol. Chem. 2004; 279: 33421-33429Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar) found that LEDGF/p75 in the nuclear resulted in of in the is with in of a role of LEDGF/p75 in of IN to chromatin in nuclear In of a nuclear mutant of LEDGF/p75 the still to to IN as a IN in the the nuclear import of IN is by interaction with LEDGF/p75. was recently that replication of HIV-1 in silenced for LEDGF/p75 was not the that in integrase was found in the cytoplasm(21Llano M. Vanegas M. Fregoso O. Saenz D. Chung S. Peretz M. Poeschla E.M. J. Virol. 2004; 78: 9524-9537Crossref PubMed Scopus (257) Google Scholar). of LEDGF/p75 in viral replication and chromosomal targeting be and that protein for has that growth factor protein hepatoma-derived is to with HIV-1 integrase be a for of LEDGF/p75 P. Devroe E. Silver P.A. Engelman A. J. Biol. Chem. 2004; 279: Full Text Full Text PDF PubMed Scopus Google Scholar). we for LEDGF/p75, and we a of HIV-1 replication in the of LEDGF/p75 that when the protein F. M. B. J. De C. and Z. for as we found that viruses were in mutations of IN interaction with LEDGF/p75 The mutation in the binding of to its for LEDGF/p75 in G. Cherepanov P. Pluymers W. Busschots K. DeClercq E. Debyser Z. Engelborghs Y. J.Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). was to be defective for LEDGF/p75 F. Devroe E. Silver P.A. Engelman A. Front. Biosci. 2004; 9: 3187-3208Crossref PubMed Scopus (139) Google Scholar). A virus harboring mutation was A. Devroe E. R. Silver P.A. Engelman A. J. Virol. 2002; PubMed Scopus Google Scholar). of the that and are the is the for interaction which is at the of these the that LEDGF/p75 is cofactor of HIV-1 integrase involved in its chromosomal for integration and replication of HIV-1. into in viral replication resulting from of interaction of IN that a of the interaction of IN with LEDGF/p75 a activity. We and for for of the and and and for with