Energetics and Topology of CzcA, a Cation/Proton Antiporter of the Resistance-Nodulation-Cell Division Protein Family

Abstract

The membrane-bound CzcA protein, a member of the resistance-nodulation-cell division (RND) permease superfamily, is part of the CzcCB2A complex that mediates heavy metal resistance in Ralstonia sp. CH34 by an active cation efflux mechanism driven by cation/proton antiport. CzcA was purified to homogeneity after expression in Escherichia coli, reconstituted into proteoliposomes, and the kinetics of heavy metal transport by CzcA was determined. CzcA is composed of 12 transmembrane α-helices and two large periplasmic domains. Two conserved aspartate and a glutamate residue in one of these transmembrane spans are essential for heavy metal resistance and proton/cation antiport but not for facilitated diffusion of cations. Generalization of the resulting model for the function of CzcA as a two-channel pump might help to explain the functions of other RND proteins in bacteria and eukaryotes. The membrane-bound CzcA protein, a member of the resistance-nodulation-cell division (RND) permease superfamily, is part of the CzcCB2A complex that mediates heavy metal resistance in Ralstonia sp. CH34 by an active cation efflux mechanism driven by cation/proton antiport. CzcA was purified to homogeneity after expression in Escherichia coli, reconstituted into proteoliposomes, and the kinetics of heavy metal transport by CzcA was determined. CzcA is composed of 12 transmembrane α-helices and two large periplasmic domains. Two conserved aspartate and a glutamate residue in one of these transmembrane spans are essential for heavy metal resistance and proton/cation antiport but not for facilitated diffusion of cations. Generalization of the resulting model for the function of CzcA as a two-channel pump might help to explain the functions of other RND proteins in bacteria and eukaryotes. resistance-nodulation-cell division polymerase chain reaction transmembrane helix carbonyl cyanide p-trifluoromethoxyphenyl hydrozone Multiple drug resistant bacteria poses a threat to man's fight against infectious diseases. Some multiple drug resistance systems may detoxify their substrates by transport across the complete cell wall of Gram-negative bacteria, across cytoplasmic membrane, periplasm, and outer membrane. These assumed transenvelope transporters are composed of a pump protein that energizes the transport, in addition to a membrane fusion and an outer membrane-associated protein (1Nikaido H. J. Bacteriol. 1996; 178: 5853-5859Crossref PubMed Scopus (873) Google Scholar, 2Paulsen I.T. Brown M.H. Skurray R.D. Microbiol. Rev. 1996; 60: 575-608Crossref PubMed Google Scholar). The pump protein may be an ATP-binding cassette transporter (3Fath M.J. Kolter R. Microbiol. Rev. 1993; 57: 995-1017Crossref PubMed Google Scholar, 4Saier M.H.J. Microbiol. Rev. 1994; 58: 71-93Crossref PubMed Google Scholar), a transporter of the major facilitator superfamily (5Paulsen I.T. Park J.H. Choi P.S. Saier M.H.J. FEMS Microbiol. Lett. 1997; 156: 1-8Crossref PubMed Scopus (227) Google Scholar), or a resistance-nodulation-cell division (RND)1 protein (4Saier M.H.J. Microbiol. Rev. 1994; 58: 71-93Crossref PubMed Google Scholar, 6Saier M.H. Tam R. Reizer A. Reizer J. Mol. Microbiol. 1994; 11: 841-847Crossref PubMed Scopus (275) Google Scholar, 7Tseng T.-T. Gratwick K.S. Kollman J. Park D. Nies D.H. Goffeau A. Saier M.H.J. J. Mol. Microbiol. Biotechnol. 1999; 1 (, 258–268): 22Google Scholar). The archetype of the RND permease superfamily family is CzcA from the Gram-negative bacterium Ralstonia sp. CH34 (formerly Alcaligenes eutrophus strain CH34) (8Nies D. Mergeay M. Friedrich B. Schlegel H.G. J. Bacteriol. 1987; 169: 4865-4868Crossref PubMed Google Scholar, 9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar, 10Nies D.H. J. Bacteriol. 1995; 177: 2707-2712Crossref PubMed Google Scholar, 11Rensing C. Pribyl T. Nies D.H. J. Bacteriol. 1997; 179: 6871-6879Crossref PubMed Google Scholar, 12Brim H. Heyndrickx M. De Vos P. Wilmotte A. Springael D. Schlegel H.G. Mergeay M. Syst. Appl. Microbiol. 1999; 22: 258-268Crossref PubMed Scopus (71) Google Scholar). This bacterium contains at least seven heavy metal resistance determinants, located either on the bacterial chromosome or on one of the two indigenous plasmids pMOL28 (163 kilobase pairs) and pMOL30 (238 kb) (8Nies D. Mergeay M. Friedrich B. Schlegel H.G. J. Bacteriol. 1987; 169: 4865-4868Crossref PubMed Google Scholar, 13Taghavi S. Mergeay M. Van der Lelie D. Plasmid. 1997; 37: 22-34Crossref PubMed Scopus (40) Google Scholar, 14Mergeay M. Nies D. Schlegel H.G. Gerits J. Charles P. van Gijsegem F. J. Bacteriol. 1985; 162: 328-334Crossref PubMed Google Scholar, 15Dressler C. Kües U. Nies D.H. Friedrich B. Appl. Environ. Microbiol. 1991; 57: 3079-3085Crossref PubMed Google Scholar, 16Nies A. Nies D.H. Silver S. J. Biol. Chem. 1990; 265: 5648-5653Abstract Full Text PDF PubMed Google Scholar). One of them, the czc-determinant of plasmid pMOL30, mediates inducible resistance to millimolar concentrations of Co2+, Zn2+, and Cd2+ in strain CH34 (8Nies D. Mergeay M. Friedrich B. Schlegel H.G. J. Bacteriol. 1987; 169: 4865-4868Crossref PubMed Google Scholar, 17Nies D.H. Silver S. J. Bacteriol. 1989; 171: 896-900Crossref PubMed Google Scholar). The products of the genes czcA, czcB, and czcC form a membrane-bound protein complex catalyzing an energy-dependent efflux of these three metal cations (9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar,11Rensing C. Pribyl T. Nies D.H. J. Bacteriol. 1997; 179: 6871-6879Crossref PubMed Google Scholar), probably across the complete envelope. The mechanism of action of CzcCB2A is that of a proton/cation antiporter, and the Km values of the efflux system for the substrate heavy metal cations are also in the millimolar range (10Nies D.H. J. Bacteriol. 1995; 177: 2707-2712Crossref PubMed Google Scholar). Although indirect evidence led to the assumption that CzcA is the central cation/proton antiporter of the CzcCB2A complex (10Nies D.H. J. Bacteriol. 1995; 177: 2707-2712Crossref PubMed Google Scholar), this has not been shown directly. This paper demonstrates that CzcA is a cation/proton antiporter, and develops the model of CzcA as a two-channel pump based on topology studies and the function of CzcA mutant proteins. This model sheds some light on other RND proteins involved in multiple drug resistance of bacteria or with previously unknown functions in mammals. 2T.-T. Tseng, K. S. Gratwick, D. H. Nies, A. Goffeau, and M. H. J. Saier, submitted for publication. Ralstonia sp. strain AE104 (14Mergeay M. Nies D. Schlegel H.G. Gerits J. Charles P. van Gijsegem F. J. Bacteriol. 1985; 162: 328-334Crossref PubMed Google Scholar) is a metal-sensitive, plasmid-free derivative of strain CH34.Escherichia coli K38(pGP1–2) (19Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1074-1078Crossref PubMed Scopus (2459) Google Scholar) was used for expression of czcCBAD derivatives under control of the phage T7 promoter as described (20Nies A. Nies D.H. Silver S. J. Bacteriol. 1989; 171: 5065-5070Crossref PubMed Google Scholar). Tris-buffered mineral salts medium (14Mergeay M. Nies D. Schlegel H.G. Gerits J. Charles P. van Gijsegem F. J. Bacteriol. 1985; 162: 328-334Crossref PubMed Google Scholar) containing 2 g/liter sodium gluconate was used for testing metal resistance and growth of Ralstonia. E. coli was cultivated in Luria broth (21Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd. Ed. Cold Spring Harbor Laboratory., Cold Spring Harbor, NY1989Google Scholar). Analytical grade salts of CdCl2·H2O, ZnCl2, and CoCl2·6 H2O were used to prepare 1m stock solutions, which were sterilized by filtration. Solid Tris-buffered medium contained 2 g/liter agar. Minimal inhibitory concentrations were determined as described (14Mergeay M. Nies D. Schlegel H.G. Gerits J. Charles P. van Gijsegem F. J. Bacteriol. 1985; 162: 328-334Crossref PubMed Google Scholar) using Tris-buffered mineral salts medium. Protein concentrations were determined using the Bradford method (22Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar), unless otherwise stated. Standard molecular genetic techniques were used (8Nies D. Mergeay M. Friedrich B. Schlegel H.G. J. Bacteriol. 1987; 169: 4865-4868Crossref PubMed Google Scholar, 21Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd. Ed. Cold Spring Harbor Laboratory., Cold Spring Harbor, NY1989Google Scholar). Transformation of E. coli strains was conducted as described previously (8Nies D. Mergeay M. Friedrich B. Schlegel H.G. J. Bacteriol. 1987; 169: 4865-4868Crossref PubMed Google Scholar). For expression of czcCBAD derivatives under control of the lac promoter in Ralstonia strain AE104, the plasmid pT7–5-derivatives containing the various czc constructs were cut with Eco RI and Xba I and cloned into the broad host range plasmid pVDZ′2 (23Deretic V. Chandrasekharappa S. Gill J.F. Chatterjee D.K. Chakrabarty A. Gene. 1987; 57: 61-72Crossref PubMed Scopus (58) Google Scholar). The pVDZ′2-derivatives were transformed into E. coli S17–1 (24Simon R. Priefer U. Pühler A. Bio/Technology. 1983; 1: 784-791Crossref Scopus (5658) Google Scholar) and transferred into Ralstonia AE104 by conjugation as described (8Nies D. Mergeay M. Friedrich B. Schlegel H.G. J. Bacteriol. 1987; 169: 4865-4868Crossref PubMed Google Scholar). For reporter gene fusions, fusion vector pECD500 (11Rensing C. Pribyl T. Nies D.H. J. Bacteriol. 1997; 179: 6871-6879Crossref PubMed Google Scholar) and E. coli CC118 were used (25Manoil C. J. Bacteriol. 1990; 172: 1035-1042Crossref PubMed Google Scholar). All fusions were done immediately downstream of an arginine or lysine residue of CzcA. Activity of alkaline phosphatase (25Manoil C. J. Bacteriol. 1990; 172: 1035-1042Crossref PubMed Google Scholar) was determined in triplicate as published previously. Mutations in the czcA gene were constructed using PCR by an overlap extension method (26Mikaelian I. Sergeant A. Nucleic Acids Res. 1992; 20: 376Crossref PubMed Scopus (211) Google Scholar) as published previously (11Rensing C. Pribyl T. Nies D.H. J. Bacteriol. 1997; 179: 6871-6879Crossref PubMed Google Scholar). The 5′ part of the internal 1,034-base pair Nhe I-Mun I internal fragment of czcA (position 3,489 to 4,523) (9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar) was amplified from plasmid pECD110 (9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar) using a primer corresponding to the sequence at the Nhe I site (TAGAGGATCCCGAACGGCTAGCGTCGTA, Nhe I primer) and a primer corresponding to the mutated region. These were (mutations underlined) TCGAAAACAGTGTGAGGCGA for C417S, TGGCGCGTGCGCAGGAACA for H423R, AGGAACGCCATGGCCGGC for H427R, AGGAACACCGTGGCCGGC for H428R, TCCGAGCGGTTCCGTGAGGT for H439R, GTGGTGATTGTCGACAACTGTGTG for E415D, GTGGTGATTGTCCAAAACTGTGTG for E415Q, GGCGCGCTCAACTTCGGCATC for D402N, and ATCATCATCAATGGCGCGGTG for D408N. The 3′-part of the 1,034 contained the region from the mutation to the Mun I site. These fragments were amplified from pECD110 (9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar) with primers inverse to the primers listed above and a Mun I region primer (AAAGGATCCCACGAACAATTGACACC, Mun I-primer). After purification (Wizard PCR preps, Promega, Madison, WI), each pair of PCR fragments was used as a template in another PCR reaction with the Nhe I and Mun I primers, which both contained additional Bam HI sites at their ends to facilitate cloning. The resulting DNA fragment was purified, digested with Bam HI, and cloned into pUC19 (27Yanisch-Perron C. Vieira J. Messing J. Gene. 1985; 33: 103-119Crossref PubMed Scopus (11472) Google Scholar). All final PCR products were sequenced to verify the exchange and to check for PCR-mediated unwanted changes. To facilitate the exchange of the wild type Nhe I-Mun I fragment against the mutated fragments, the respective fragment from plasmid pECD110 was first deleted and a kanamycin resistance gene was inserted instead leading to plasmid pECD451. This was done as published (11Rensing C. Pribyl T. Nies D.H. J. Bacteriol. 1997; 179: 6871-6879Crossref PubMed Google Scholar). Next, the mutated Nhe I-Mun I fragments were inserted into pECD451 instead of the kanamycin resistance gene. The resulting plasmids were verified by restriction endonuclease digestion using several enzymes, and correct expression of the mutant proteins was demonstrated by T7 expression (19Tabor S. Richardson C.C. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1074-1078Crossref PubMed Scopus (2459) Google Scholar). The czcA gene was PCR-amplified as an Eco RI-Bam HI fragment from plasmid pECD110 (9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar) and cloned into the vector pASK3 (Institut für Bioanalytik, Göttingen, Germany) in E. coli BL21 (Stratagene Europe, Amsterdam, Netherlands). The resulting plasmid pECD559 was verified by DNA sequencing. For each expression, the bacterial strain was freshly transformed. E. coli BL21(pECD559) was cultivated for 16 h at 30 °C and diluted into 1 liter of fresh Luria broth (21Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd. Ed. Cold Spring Harbor Laboratory., Cold Spring Harbor, NY1989Google Scholar). The cultures were cultivated with shaking at 30 °C until the optical density at 600 nm reached 1.0. CzcA production was induced with 100 μg of anhydrotetracyclin/liter of medium. The cells were cultivated for an additional 3 h with shaking at 30 °C and harvested by centrifugation. The pellet was washed and suspended in 10 ml of buffer W (100 mm Tris-HCl buffer (pH 1 mm with the in the of mm and and cell was by for at The membrane of the resulting was harvested by and suspended in buffer W at 10 of J. Biol. Chem. Full Text PDF PubMed Google Scholar, A. D. Anal. Biochem. 1976; PubMed Scopus Google Scholar). CzcA was from of the E. coli host using 1 of of membrane protein and for 30 at and membrane was CzcA was purified on a 1 with buffer W containing mm and of After the was washed with 12 buffer W containing mm and of CzcA was using buffer W containing mm of and mm from the of the purification were on a PubMed Scopus Google Scholar). was suspended in buffer 2 mm to a of 10 was by against mm 2 mm and the resulting were in and at For the were and a M.J. PubMed Scopus Google Scholar). was and of was determined by in at nm B. F. as in and Scholar, H. S. R. K. 37: PubMed Scopus Google Scholar). were with purified CzcA in a and at under for was by at a final of Anal. Biochem. PubMed Scopus Google Scholar). After 30 of were by on and was with fresh for an additional 30 at and at The was two against mm 2 mm at and by at for For the were suspended in ml of and on for 30 by a at for The pellet was suspended in mm Tris-HCl a of the resulting of This to a of an outer of and an of a of D. of Molecular and Molecular Scholar), each contained 1 of CzcA of CzcA proteins been in each The were in and at published (10Nies D.H. J. Bacteriol. 1995; 177: 2707-2712Crossref PubMed Google PubMed Scopus Google Scholar), 1 of were diluted into 2 ml of buffer mm Tris-HCl (pH mm containing 2 was using an of nm and an of nm in at using the method were as described D.H. Silver S. J. Bacteriol. 1989; 171: 896-900Crossref PubMed Google Scholar, PubMed Scopus Google Scholar) with some The were diluted into buffer mm (pH to a final of 30 After 1 in cation was by the addition of the cations or and the reaction was at 30 were membrane and with ml of buffer containing 10 mm and 10 mm The that on the membrane was determined with a CzcA were using the of but CzcA. To a with these the of by control was by the CzcA of the in the which was CzcA and an internal of 1 into the to an internal of 10 CzcA was purified to homogeneity The first of CzcA were determined as as from DNA sequence (9Nies D.H. Nies A. Chu L. Silver S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7351-7355Crossref PubMed Scopus (211) Google Scholar). CzcA was reconstituted into proteoliposomes, which were in 100 mm 1 mm Zn2+, CzcA of of CzcA the first control the 2 another 100 of were of by control not with The transport of by CzcA be by 100 the 2 or using instead of for not this transport was probably driven by the across the membrane. of CzcA led to metal transport, but of control not 2 CzcA was a facilitated diffusion of and a transport of into the of A of 3 of of in 100 mm was diluted into 100 mm Tris-HCl A and or with were diluted into and After 1 or was μg of CzcA were and used to the of into the of CzcA of not CzcA but were in a contained the of and were to a the as CzcA To a of of with these the of by control was by the CzcA of the in the which was the of CzcA in the system was with in the of 100 After 1 mm of was after 1 The control were CzcA. of by diluted or were diluted or that these are in of to the the various of and and control in the system of 3 1 or mm of The values for the control were from the CzcA values to a To a the were with diffusion of of the and a A for at least was shown with not CzcA 2 control of into be with 100 or but with 10 not The of in these might be the of the of used in the of was 3 mm was used as the substrate instead of 1 was with mm 2 The of transport by CzcA a substrate 3 A of was from the at 10 and mm and this was used for a 3 a 2 and a of mm 10 probably to the of on the of the not metal cation transport by of metal cation was determined for three For and the substrate was For the was determined using the at and 10 for was the at concentrations of either metal the this a using the was the resulting For mm the proteoliposomes, and transport be with concentrations 1 this range of the was and the listed Km and in a The of metal cation was determined for three For and the substrate was For the was determined using the at and 10 for was the at concentrations of either metal the this a using the was the resulting For mm the proteoliposomes, and transport be with concentrations 1 this range of the was and the listed Km and transport by CzcA was To transport, of instead of to be and the to be to 10 mm The substrate of transport by CzcA was 3 to a was at concentrations the at a was 3 2 and a of mm transport by CzcA was be at concentrations 1 mm or this range of substrate a was and a of and a Km of mm not 12 in the sequence of which might α-helices and two large and The of fusions evidence for a cytoplasmic of both of a periplasmic of both large the of I and large and fusion be and and the of the fusion and (position evidence for a periplasmic of this region and of of fusions, of triplicate are residue of topology of of triplicate are in a The conserved and of CzcA were mutated to D402N, E415Q, and The of CzcA as 3 and 1 residue these were mutated to C417S, H423R, H427R, and of the in the metal site in metal on medium in not the and are not essential for transport of of the three CzcA substrate cations Co2+, Zn2+, or mutation to or of the in the of the transmembrane led to a complete of metal resistance to each of the three heavy and not the resistance be in not resistance of mutant strains a czcA with Ralstonia sp. AE104 strains plasmid pVDZ′2 derivatives with mutant cloned under control of the lac which is in this inhibitory after 3 at 30 the Ralstonia sp. strain was strain was with Ralstonia sp. AE104 strains plasmid pVDZ′2 derivatives with mutant cloned under control of the lac which is in this after 3 at 30 the Ralstonia sp. strain was strain was in a Although the mutant CzcA protein was not the protein resistance on in in the of mm Co2+, mm Zn2+, or 1 an AE104 derivative with the mutation in czcA the respective wild type strain not the in the of the of residue of the CzcA protein the of heavy metal transport in the respective mutant The mutant proteins with in the aspartate and were purified the CzcA wild type protein and reconstituted into were with the wild type protein, three proteins the facilitated diffusion of but the mutant proteins were to the antiport. To the in the reaction was into the of the or were at the with the wild type not and the mutant proteins were for 2 with 1 and an additional 10 mm of was in this the of by the control of and Cd2+ by wild type and both mutant proteins was not not the mutant proteins were to transport metal cations into but were to a proton/cation antiport. The determined of CzcA as into the model of a H. Saier M.H. 1992; PubMed Scopus Google Scholar). two in may The conserved in one of these was essential for CzcA function in and for proton/cation antiport in but not for facilitated diffusion of cations. the form a system J. J. Biol. 1997; PubMed Scopus Google Scholar) with the for transport, the may be a cation the model to the function of is that of a two-channel a of to a cytoplasmic site of CzcA may transport across the into the This in the large periplasmic of CzcA. to using first diffusion of CzcA be to explain the of these the cation an that the cation the cation to the the cation be for from the is not conserved in the protein A. K. J.F. Silver S. 1999; PubMed Scopus Google Scholar) involved in efflux of but and are which may be by a of transport by this system in with a of 2 1 for CzcA (10Nies D.H. J. Bacteriol. 1995; 177: 2707-2712Crossref PubMed Google Scholar). RND proteins with a may be involved in transport of a and this has been demonstrated for from E. coli, which and D. H. Nies, the RND proteins T.-T. Gratwick K.S. Kollman J. Park D. Nies D.H. Goffeau A. Saier M.H.J. J. Mol. Microbiol. Biotechnol. 1999; 1 (, 258–268): 22Google Scholar) another conserved in the respective region after in to is not but another at the the substrates not to transport H. M. V. J. Bacteriol. PubMed Google Scholar). the conserved that RND proteins are driven by the an is to of or with L. K. J. Bacteriol. PubMed Google Scholar, E. P. A. J. Bacteriol. PubMed Google Scholar, J. J. Bacteriol. PubMed Google Scholar). may a periplasmic site a and a a substrate is to this may be driven into the the site as a of Some other bacterial proteins are to RND proteins or of this is involved in protein and to the of the from the This reaction is also F. J. 1997; PubMed Scopus Google Scholar, F. J. 1997; PubMed Scopus Google Scholar). is to the of RND proteins T.-T. Gratwick K.S. Kollman J. Park D. Nies D.H. Goffeau A. Saier M.H.J. J. Mol. Microbiol. Biotechnol. 1999; 1 (, 258–268): 22Google Scholar), the the reaction mechanism some proteins in may also be RND may The to be a transporter J. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, Biol. PubMed Scopus Google Scholar, D. C. J. J. M.H. M. A. Brown A. L. 1997; PubMed Scopus Google Scholar), and be of the gene family are involved in a chain of the J. M. Biol. Chem. 1997; Google Scholar, PubMed Scopus Google Scholar, E. 1996; PubMed Scopus Google Scholar, V. A. Biol. 1996; PubMed Scopus Google these proteins be transporters The to a function as a is essential for the of the protein, and of the might be to the the with the purified and reconstituted CzcA protein might be of help to the function of other proteins involved in multiple drug resistance and protein in bacteria, and of proteins involved in and in mammals. for the sequence of and for the light