Hormone-induced Translocation of Thyroid Hormone Receptors in Living Cells Visualized Using a Receptor Green Fluorescent Protein Chimera

Abstract

Thyroid hormone nuclear receptors (TRs) are ligand-dependent transcription factors that regulate growth, differentiation, and development. To understand the role of the hormone, 3,3′,5-triiodo-l-thyronine (T3), in the nuclear translocation and targeting of TRs to the regulatory sites in chromatin, we appended green fluorescent protein (GFP) to the human TR subtype β1 (TRβ1). The fusion of GFP to the amino terminus of TRβ1 protein did not alter T3 binding or transcriptional activities of the receptor. The subcellular localization of GFP-TRβ1 in living cells was visualized by laser-scanning confocal microscopy. In the presence of T3, the expressed GFP-TRβ1 was predominately localized in the nucleus, exhibiting a nuclear/cytoplasmic ratio of ∼5.5. No GFP-TRβ1 was detected in the nucleolus. In the absence of T3, more GFP-TRβ1 was present in the cytoplasm, exhibiting a nuclear/cytoplasmic ratio of ∼1.5. In these cells, cytoplasmic GFP-TRβ1 could be induced to enter the nucleus by T3. The T3-induced translocation was blocked when Lys184-Arg185 in domain D of TRβ1 was mutated to Ala184-Ala185. Furthermore, the inability of the mutant TR to translocate to the nucleus correlated with the loss of most of its transcriptional activity. These results suggest that TR functions may, in part, be regulated by T3-induced nuclear entry. Thyroid hormone nuclear receptors (TRs) are ligand-dependent transcription factors that regulate growth, differentiation, and development. To understand the role of the hormone, 3,3′,5-triiodo-l-thyronine (T3), in the nuclear translocation and targeting of TRs to the regulatory sites in chromatin, we appended green fluorescent protein (GFP) to the human TR subtype β1 (TRβ1). The fusion of GFP to the amino terminus of TRβ1 protein did not alter T3 binding or transcriptional activities of the receptor. The subcellular localization of GFP-TRβ1 in living cells was visualized by laser-scanning confocal microscopy. In the presence of T3, the expressed GFP-TRβ1 was predominately localized in the nucleus, exhibiting a nuclear/cytoplasmic ratio of ∼5.5. No GFP-TRβ1 was detected in the nucleolus. In the absence of T3, more GFP-TRβ1 was present in the cytoplasm, exhibiting a nuclear/cytoplasmic ratio of ∼1.5. In these cells, cytoplasmic GFP-TRβ1 could be induced to enter the nucleus by T3. The T3-induced translocation was blocked when Lys184-Arg185 in domain D of TRβ1 was mutated to Ala184-Ala185. Furthermore, the inability of the mutant TR to translocate to the nucleus correlated with the loss of most of its transcriptional activity. These results suggest that TR functions may, in part, be regulated by T3-induced nuclear entry. thyroid hormone receptor 3,3′,5-triiodo-l-thyronine human TR subtype β1 rat retinoid X receptor green fluorescence protein GFP fused to TRβ1 thyroid hormone response element palindromic TRE chloramphenicol acetyltransferase. Thyroid hormone receptors (TRs)1 are ligand-dependent transcription factors, which are members of the steroid hormone/retinoic acid receptor superfamily. Two TR genes, TRα and TRβ, located on chromosomes 17 and 3, respectively, give rise to four TR isoforms, α1, α2, β1, and β2, by alternative splicing of the primary transcripts (1Cheng S.-Y. J. Biomed. Sci. 1995; 2: 77-89Crossref PubMed Scopus (39) Google Scholar, 2Oppenheimer J.H. Schwartz H.L. Strait K.A. Eur. J. Endocrinol. 1994; 130: 15-24Crossref PubMed Scopus (59) Google Scholar). TRs mediate the biological activities of the thyroid hormone, 3,3′,5-triiodo-l-thyronine (T3), by binding to the specific DNA sequences, known as the thyroid hormone response elements (TREs), in the promoter regions of T3 target genes (1Cheng S.-Y. J. Biomed. Sci. 1995; 2: 77-89Crossref PubMed Scopus (39) Google Scholar, 2Oppenheimer J.H. Schwartz H.L. Strait K.A. Eur. J. Endocrinol. 1994; 130: 15-24Crossref PubMed Scopus (59) Google Scholar). The transcriptional regulatory activity of TRs not only depends on T3 and the types of TREs but also on a host of co-regulatory proteins including co-repressors, co-activators, and the tumor suppressor p53 (3Horwitz K.B. Jackson T.A. Bain D.L. Richer J.K. Takimoto G.S. Tung L. Mol. Endocrinol. 1996; 10: 1167-1177Crossref PubMed Scopus (830) Google Scholar, 4Yap N., Yu, C.-L. Cheng S.-y. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4273-4277Crossref PubMed Scopus (77) Google Scholar). To function as transcription factors, TRs have to interact with transcriptional machinery in the nucleus. However, the process by which TRs are targeted to the nucleus is poorly understood. Before the genes encoding TRs were isolated, high affinity, low capacity T3binding sites were detected in the nuclear fractions of tissues and cultured cells by subcellular fractionation (5Oppenheimer J.H. Schwartz H.L. Surks M.I. Endocr. Res. Commun. 1975; 2: 309-325Crossref PubMed Scopus (56) Google Scholar, 6Samuels H.H. Stanley F. Casanova J. J. Clin. Invest. 1979; 63: 1229-1240Crossref PubMed Scopus (97) Google Scholar, 7Spindler B.J. MacLeod K.M. Ring J. Baxter J.D. J. Biol. Chem. 1975; 250: 4113-4119Abstract Full Text PDF PubMed Google Scholar, 8Surks M.I. Koerner D.H. Oppenheimer J.H. J. Clin. Invest. 1975; 55: 50-60Crossref PubMed Scopus (89) Google Scholar, 9Samuels H.H. Stanley F. Shapiro L.E. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 3877-3881Crossref PubMed Scopus (97) Google Scholar). Subsequently, when anti-TR antibodies became available, TRs were found only in the nuclei of fixed cells by immunocytochemistry and immunohistochemistry (10Strait K.A. Schwartz H.L. Seybold V.S. Ling N.C. Oppenheimer J.H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3887-3891Crossref PubMed Scopus (101) Google Scholar, 11Puymirat J. Marchand R. Dussault J.H. Neurosci Lett. 1992; 135: 239-242Crossref PubMed Scopus (15) Google Scholar, 12Lin K.-H. Willingham M.C. Liang C.-M. Cheng S.-y. Endocrinology. 1991; 128: 2601-2609Crossref PubMed Scopus (42) Google Scholar). However, in these studies, dynamic cytoplasmic nuclear trafficking of TRs and the effect of T3 on nuclear trafficking were not addressed. In the present study, we appended the green fluorescence protein (GFP) to the human TR subtype β1 (TRβ1) allowing direct examination of the nuclear transport of TRs in living cells. TR exhibited both constitutive nuclear localization and hormone-dependent nuclear localization. Furthermore, we identified a nuclear localization signal in D domain that mediates the T3-dependent cytoplasm-nucleus translocation. The plasmid pCI-nGFP-C656G containing the GFP-glucocorticoid receptor fusion gene was digested with the restriction enzymes BssHI and EcoRI to release the glucocorticoid receptor cDNA (13Htun H. Barsony J. Renyi I. Gould D.L. Hager G.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4845-4850Crossref PubMed Scopus (322) Google Scholar). The plasmid containing the TRβ1 cloned from human placenta (14Lin K.H. Zhu X.-G. Shieh H.Y. Hsu H.C. Chen S.T. McPhie P. Cheng S.Y. Endocrinology. 1996; 137: 4073-4081Crossref PubMed Scopus (50) Google Scholar) was digested withNcoI and PstI or PstI and EcoRI to obtain the NcoI-PstI and PstI-EcoI DNA fragments, respectively. The two fragments were ligated onto the plasmid pCI-nGFPBssHII-EcoRI vector using aBssHI-NcoI adaptor. The resultant plasmid is denoted as pGFP-TRβ1. GFP was also fused to the amino termini of two mutants to obtain GFP-TR2A and -TR5A. GFP-TRβ2A and -5A were constructed by replacing the sequence AAGAGG (Lys184-Arg185) of pGFP-TRβ1 with GCGGCG (Ala184-Ala185) and AAGAGGCTGGCCAAGAGGAAG (Lys184-Arg185-Leu186-Ala187-Lys188-Arg189-Lys190) of pGFP-TRβ1 with GCGGCGCTGGCCGCGGCGGCG (Ala184-Ala185-Leu186-Ala187-Ala188-Ala189-Ala190), respectively. The sequences of the mutants were confirmed by restriction analyses and direct DNA sequencing. The size of the mutant proteins was also confirmed by SDS-polyacrylamide gel electrophoresis analysis. Electrophoresis gel mobility shift assay was carried out as described (15Meier C.A. Parkison C. Chen A. Ashizawa K. Muchmore P. Meier-Heusler S.C. Cheng S.-y. Weintraub B.D. J. Clin. Invest. 1993; 92: 1986-1993Crossref PubMed Scopus (71) Google Scholar, 16Zhu X.-G. McPhie P. Lin K.-h. Cheng S.-y. J. Biol. Chem. 1997; 272: 9048-9054Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Briefly, equal amounts of in vitro translated GFP-TRβ1 or GFP-TR mutants (TNT kit, Promega) were incubated with the [32P]Lys- and Pal-TRE in the binding buffer (25 mm Hepes, pH 7.5, 5 mm MgCl2, 4 mm EDTA, 10 mm dithiothreitol, 0.11 mm NaCl, and 0.4 μg ssDNA). In some experiments, RXRβ was added in the reaction mixture (15Meier C.A. Parkison C. Chen A. Ashizawa K. Muchmore P. Meier-Heusler S.C. Cheng S.-y. Weintraub B.D. J. Clin. Invest. 1993; 92: 1986-1993Crossref PubMed Scopus (71) Google Scholar, 16Zhu X.-G. McPhie P. Lin K.-h. Cheng S.-y. J. Biol. Chem. 1997; 272: 9048-9054Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). After incubation for 30 min at 25 °C, the reaction mixture was loaded onto a 5% polyacrylamide gel and electrophoresed at 4 °C for 2–3 h at a constant voltage of 250 V. The gel was dried and autoradiographed. Fifteen microliters of the in vitrotranslated GFP-TR wild type or its mutant proteins was incubated with 0.2 nm [125I]T3 in the presence or absence of unlabeled T3 in 0.25 ml of buffer B (50 mm Tris·HCl, pH 8.0, 0.2 m NaCl, 0.01% Lubrol, and 20% glycerol) for 90 min at 25 °C. Protein-bound [125I]T3 was separated from the unbound radioligand in a Sephadex G-25 column (fine) as described previously (16Zhu X.-G. McPhie P. Lin K.-h. Cheng S.-y. J. Biol. Chem. 1997; 272: 9048-9054Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The binding data were analyzed similarly as described (14Lin K.H. Zhu X.-G. Shieh H.Y. Hsu H.C. Chen S.T. McPhie P. Cheng S.Y. Endocrinology. 1996; 137: 4073-4081Crossref PubMed Scopus (50) Google Scholar). CV1 cells were transfected with TRβ1 or GFP-TRβ1 together with the TRE-containing reporter plasmids (each 0.2 μg) using the LipofectAMINE transfection method according to the manufacturer's procedure. Twelve hours later, the medium was replaced with Dulbecco's modified Eagle's medium containing 10% T3-depleted serum for an additional 12 h. Fifteen hours before cells were harvested, T3 (100 nm) was added to the appropriate dishes. The cells were lysed, and the CAT activity was analyzed as described (16Zhu X.-G. McPhie P. Lin K.-h. Cheng S.-y. J. Biol. Chem. 1997; 272: 9048-9054Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The CAT activity was normalized for the protein concentrations of the lysates. Cell lysates (60 μg) from transient transfection experiments described above were loaded onto a 12% SDS-polyacrylamide electrophoresis gel. Western blotting was carried out as described (16Zhu X.-G. McPhie P. Lin K.-h. Cheng S.-y. J. Biol. Chem. 1997; 272: 9048-9054Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The antibodies used for detecting GFP-TRβ1 were monoclonal antibody C4 (1 μg/ml) and monoclonal anti-GFP antibodies (1 μg/ml, CLONTECH). CV1 cells were plated 24 h before transfection in Dulbecco's modified Eagle's medium containing 10% fetal calf serum at a density of 4.5 × 104 cells in a Lab-Tek chambered cover glass cuvette (Nage Nunc International, Naperville, IL). Cells were transfected with the appropriate plasmids (0.2 μg) using the LipofectAMINE transfection method described above. Fifteen hours later, the medium was replaced with Dulbecco's modified Eagle's medium containing 10% T3-depleted serum, and cells were further incubated for an additional 12 h. Cells were observed as described below. Microscopy was performed using a Zeiss LSM410 laser-scanning confocal microscope. All images were captured using a 100 × 1.4 numerical aperture objective lens. Image analysis and determination of nuclear/cytoplasmic ratios were carried out using standard functions of the LSM410 software. The ratios were determined by averaging the intensities of 20 random regions within the nucleoplasm and cytoplasm of 50–60 living cells. All images were scanned at a fixed gain and black level. It is known that the COOH-terminal region is essential for the function of TRβ1 (17Wurtz J.M. Bourguet W. Renaud J.P. Vivat V. Chambon P. Moras D. Gronemeyer H. Nat. Struct. Biol. 1996; 3 (; Correction (1996) Nat. Struct. Biol. 3, 206): 87-94Crossref PubMed Scopus (669) Google Scholar), whereas the amino-terminal A/B domain is not critically involved in the hormone and transcriptional activity of TRβ1 (16Zhu X.-G. McPhie P. Lin K.-h. Cheng S.-y. J. Biol. Chem. 1997; 272: 9048-9054Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 18Lin K.-H. Parkison C. McPhie P. Cheng S.-y. Mol. Endocrinol. 1991; 5: 485-492Crossref PubMed Scopus (44) Google Scholar). We therefore fused GFP to the amino terminus of TRβ1 The GFP used was a from the containing a to at amino acid which not only a but also more to the GFP R. 1995; PubMed Scopus Google Scholar). To be that the of GFP to TRβ1 did not alter the of we the hormone and DNA binding activities of GFP-TRβ1 was by in vitro and its binding to T3 was No were detected in the from the binding of T3 to TRβ1 or GFP-TRβ1 not The were determined to be and nm for TRβ1 and respectively, that the GFP to the amino terminus of TRβ1 did not the T3 binding activity of We further the DNA binding activity of GFP-TRβ1 by using two that GFP-TRβ1 to not only as a but also as a with the RXRβ The was the binding of the TRβ1 to as with the and in and respectively. We also the binding of GFP-TRβ1 to with the binding of the TRβ1 to Pal-TRE as with binding of GFP-TRβ1 to Pal-TRE was not the However, GFP-TRβ1 to Pal-TRE as a with RXRβ as in its binding was the TRβ1 To further the of we the transcriptional activity of GFP-TRβ1 using the CAT reporter CV1 cells were with the GFP-TRβ1 or the TRβ1 plasmid with the TRE-containing CAT 3 that in using the transcriptional activity of GFP-TRβ1 was from that of TRβ1 in that the of T3-dependent transcriptional activity was not and also similarly the transcriptional activity in the absence of T3 5 and 3 and are to the transcriptional activity. results were also when Pal-TRE was 4 and of 3 B that were detected in the T3-dependent activities the TRβ1 and these results that GFP-TRβ1 was and is a to the of fixed cultured cells, TRs were to be localized in the nucleus K.-H. Willingham M.C. Liang C.-M. Cheng S.-y. Endocrinology. 1991; 128: 2601-2609Crossref PubMed Scopus (42) Google Scholar). To understand T3 the nuclear translocation of TRs in living cells, CV1 cells transfected with the GFP-TRβ1 vector were in or T3-depleted and the expressed GFP-TRβ1 was visualized by confocal microscopy. We determined the of GFP-TRβ1 by the intensities of 20 random regions in the cytoplasm and nucleus of 50–60 living cells. The of of cells with nuclear/cytoplasmic ratios is in 4 that in the absence of T3, cells nuclear/cytoplasmic ratios in the of with the of cells the ratio of However, with a ratio 4 was the cells exhibiting only cytoplasmic the nuclear/cytoplasmic ratio was to be ∼1.5. In in the presence of T3 4 most of the cells nuclear/cytoplasmic from with an ratio of ∼5.5. cells localization of GFP-TRβ1 in both the nucleus and cytoplasm in the absence of T3 are in 5 and in the presence of T3 localization in the nucleus are in 5 The in 4 were of the of We also determined the in cells transfected with a of GFP-TRβ1 a of plasmid was GFP-TRβ1 was expressed in more cells and the was However, in the nuclear/cytoplasmic ratios were detected not subcellular of GFP-TRβ1 in living cells. CV1 cells were transfected with the vector of GFP-TRβ1 as described and Fifteen hours later, cells were cultured in T3-depleted and the fluorescence was and 100 or was and the images were the cells were incubated for 30 min at Image The which was localized in the cytoplasm, could be induced to translocate the nucleus by T3 in a 5 B that the which was in the cytoplasm in 5 was the nucleus 30 min at °C. 5 in which GFP-TRβ1 was detected in both the nucleus and the cytoplasm in the absence of T3. However, as in 5 which is a of T3, did not the translocation of The of GFP-TRβ1 in the in 5 D was the as that in 5 C. a of GFP-TRβ1 is localized in the nucleus, GFP-TRβ1 also to hormone to nuclear translocation. on the of nuclear proteins including steroid the sequence the nuclear translocation determined to of two of 2–3 amino separated by two amino C. Sci. 1991; Full Text PDF PubMed Scopus Google Scholar). of the amino acid sequence of TRβ1 identified a nuclear localization signal in domain D To that the nuclear translocation for we mutated the Lys184-Arg185 to The mutated TRβ1 was fused to GFP to GFP-TR2A was the promoter as in GFP-TRβ1 In living CV1 cells, which cultured in the presence of T3, two of GFP-TR2A were of the GFP-TR2A in the nucleus and However, of the most of the GFP-TR2A localized in the cytoplasm, the inability of GFP-TR2A to translocate the presence of T3. cells are in is in to GFP-TRβ1 in that GFP-TRβ1 was located in the nucleus in the presence of T3 and 5 and D of are the for the cells in and respectively. We also mutated to to obtain These additional only the the receptors localized in the cytoplasm These results that of the nuclear localization for Furthermore, these suggest that more in the translocation of a of GFP-TRβ1 was induced by T3 to translocate from cytoplasm the nucleus, we the nuclear translocation is by the activities GFP-TRβ1 and of that and of T3-dependent activity of GFP-TR2A was as with that of GFP-TRβ1 3, and on and respectively. The T3-dependent activity of GFP-TR2A could be to its loss of T3 binding of a protein in the transfected cells, an inability to to an in nuclear translocation. we these We determined the T3 binding activity of The for the binding of GFP-TR2A to T3 was from of TRβ1 and GFP-TRβ1 not The was determined to be which was not from that of TRβ1 and GFP-TRβ1 and These data that the activity of GFP-TR2A was not of its inability to T3. We protein of GFP-TRβ1 and GFP-TR2A by Western in 3 and the of the two proteins as detected by monoclonal were The protein were further confirmed by using anti-GFP antibodies and the activity of GFP-TR2A was not of a for the receptor. The activity of GFP-TR2A was also not of its inability to to and of that GFP-TR2A to as a with RXRβ GFP-TR2A with RXRβ as GFP-TRβ1 with binding of TRβ1 to Pal-TRE (15Meier C.A. Parkison C. Chen A. Ashizawa K. Muchmore P. Meier-Heusler S.C. Cheng S.-y. Weintraub B.D. J. Clin. Invest. 1993; 92: 1986-1993Crossref PubMed Scopus (71) Google Scholar), binding of GFP-TRβ1 and GFP-TR2A to Pal-TRE was not the 3 and these results suggest that the of the activity of GFP-TR2A was most of of cytoplasm to nucleus translocation of The present that the GFP-TRβ1 localized in the cytoplasm was induced to translocate the nucleus by T3. We identified a nuclear localization signal that the T3-induced nuclear translocation. The by which signal to T3 for nuclear is not signal with the sequence of located in the which is of a in domain D F. 1995; PubMed Scopus Google Scholar). was determined from the DNA binding domain with a direct is the of in the of the TRβ1 the binding of T3 to domain of the TRβ1 are However, is to that in domain D could T3-induced as is that in the binding domain of TRβ1 when to T3 McPhie P. Parkison C. Liang Cheng S.-y. Res. Commun. 1993; PubMed Scopus Google Scholar, Baxter J.D. 1995; PubMed Scopus Google Scholar). The T3-induced of in the of the TRβ1 could the nuclear localization signal to more to the receptors that the nuclear localization signal L. J. Cell Biol. PubMed Scopus Google Scholar, 1992; Full Text PDF PubMed Scopus Google Scholar), additional of the transcriptional activity of and protein have in the translocation of steroid receptors and are to and a of factors with the glucocorticoid receptor J. Biol. Chem. Full Text PDF PubMed Google Scholar) and are from the receptor and nuclear translocation Proc. Biol. PubMed Scopus Google Scholar). the proteins and members of the thyroid receptor and acid receptor have not described J. Biol. Chem. Full Text PDF PubMed Google Scholar), and Mol. Biol. 1995; PubMed Scopus (71) Google Scholar) that is for acid receptors and function in that the role of the in signal by nuclear receptors be more with the receptors in the a direct or role in the translocation of TRs is with the using fixed cells K.-H. Willingham M.C. Liang C.-M. Cheng S.-y. Endocrinology. 1991; 128: 2601-2609Crossref PubMed Scopus (42) Google Scholar) and subcellular fractionation (5Oppenheimer J.H. Schwartz H.L. Surks M.I. Endocr. Res. Commun. 1975; 2: 309-325Crossref PubMed Scopus (56) Google Scholar, 6Samuels H.H. Stanley F. Casanova J. J. Clin. Invest. 1979; 63: 1229-1240Crossref PubMed Scopus (97) Google Scholar, 7Spindler B.J. MacLeod K.M. Ring J. Baxter J.D. J. Biol. Chem. 1975; 250: 4113-4119Abstract Full Text PDF PubMed Google Scholar, 8Surks M.I. Koerner D.H. Oppenheimer J.H. J. Clin. Invest. 1975; 55: 50-60Crossref PubMed Scopus (89) Google Scholar, 9Samuels H.H. Stanley F. Shapiro L.E. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 3877-3881Crossref PubMed Scopus (97) Google Scholar), we found that TRs are localized in the nuclei in the presence of T3. However, in the absence of T3, we found that the localization of TRs was with to nuclear/cytoplasmic ratios of the presence of GFP-TRβ1 in the cytoplasm of some cells. is in to the in which high and low capacity T3 binding sites were not detected in the fractions of tissues and cells by hormone binding (5Oppenheimer J.H. Schwartz H.L. Surks M.I. Endocr. Res. Commun. 1975; 2: 309-325Crossref PubMed Scopus (56) Google Scholar, 6Samuels H.H. Stanley F. Casanova J. J. Clin. Invest. 1979; 63: 1229-1240Crossref PubMed Scopus (97) Google Scholar, 7Spindler B.J. MacLeod K.M. Ring J. Baxter J.D. J. Biol. Chem. 1975; 250: 4113-4119Abstract Full Text PDF PubMed Google Scholar, 8Surks M.I. Koerner D.H. Oppenheimer J.H. J. Clin. Invest. 1975; 55: 50-60Crossref PubMed Scopus (89) Google Scholar, 9Samuels H.H. Stanley F. Shapiro L.E. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 3877-3881Crossref PubMed Scopus (97) Google Scholar). are to for the subcellular fractionation of tissues and cells could to the loss of low amounts of the high T3 binding sites present in the the tissues a high of T3 that high binding sites are located in the nucleus. the method not be to the low of TRs in the The of TRs to the trafficking of TRs in living cells the subcellular fractionation However, as with with GFP of trafficking of steroid hormone GFP alter the activity of TRs or its transport factors be or for the nuclear localization is in cells when is The of the is that the GFP-TRβ1 the of the receptor. is by the that the hormone DNA and activities of GFP-TRβ1 are not from of the unlabeled The of TRs with to nuclear/cytoplasmic ratios in living cells could be the of additional of as the We have observed that of cells by serum in a more of J. A. and S.-y. known to Surks M.I. Endocrinology. PubMed Scopus Google Scholar). In a cultured cells are not and are in a of In the absence of T3, cells at a which the of TRs in the cytoplasm to regulate the activity of is by the of the loss of transcriptional activity with the of mutant TRβ1 in the cytoplasm of the of the nuclear localization The subcellular is not a transcription involved in to regulate its activity by the nuclear/cytoplasmic ratios S. D. Proc. Natl. Acad. Sci. U. S. A. 1997; PubMed Scopus Google Scholar). Furthermore, that the of glucocorticoid receptors in the nuclei is not only by the hormone but also by the receptors are within nuclei hormone-dependent nuclear translocation in the and of the cells, but not in cells in the S.C. J. 1992; PubMed Scopus Google Scholar). The localization of the transfected rat by immunocytochemistry in fixed cells V. J. Biol. Chem. 1993; Full Text PDF PubMed Google Scholar). In study, to to in was identified to be of the nuclear localization However, in to was not found to the localization of the transfected rat are for The for of a of the in receptor the for antibody in a specific subcellular not be in fixed cells to the antibody the used for the localization of the rat in the were not It is that the could some of thyroid which the of of the cytoplasmic localization. The that TRβ1 could be induced by T3 to translocate to the nucleus in a of cells added in the of TR in to the types of TREs and the co-regulatory which are known to regulate transcriptional activity of the present that the hormone-dependent nuclear trafficking could an regulatory role in the functions of