Hormone-induced Recruitment of Sp1 Mediates Estrogen Activation of the Rabbit Uteroglobin Gene in Endometrial Epithelium

Abstract

Steroid hormones activate gene expression by interaction of their receptors with hormone-responsive DNA elements and tissue-specific or ubiquitous factors. To monitor the molecular changes on the promoter of the rabbit uteroglobin gene during early pseudopregnancy in vivo, we have applied the genomic footprinting methodology to endometrial tissue. Estrogen induction results in the simultaneous occupancy of an estrogen-responsive element and an adjacent GC/GT box in the promoter. DNA binding assays demonstrate that the corresponding regulatory factors are the ligand-induced estrogen receptor and the ubiquitous transcription factor Sp1. Both factors functionally synergize in primary endometrial cells, showing that the GC/GT box is an essential part of a composite estrogen-responsive unit. However, the estrogen receptor and Sp1 do not bind cooperatively to their sites in vitro, suggesting that other mechanisms might be responsible for the hormone-dependent binding of Sp1 in vivo. Since hormone treatment leads to the appearance of a distinct DNase I-hypersensitive site over the promoter chromatin, an estrogen-induced change in the local chromatin structure could facilitate binding of Sp1in vivo. Steroid hormones activate gene expression by interaction of their receptors with hormone-responsive DNA elements and tissue-specific or ubiquitous factors. To monitor the molecular changes on the promoter of the rabbit uteroglobin gene during early pseudopregnancy in vivo, we have applied the genomic footprinting methodology to endometrial tissue. Estrogen induction results in the simultaneous occupancy of an estrogen-responsive element and an adjacent GC/GT box in the promoter. DNA binding assays demonstrate that the corresponding regulatory factors are the ligand-induced estrogen receptor and the ubiquitous transcription factor Sp1. Both factors functionally synergize in primary endometrial cells, showing that the GC/GT box is an essential part of a composite estrogen-responsive unit. However, the estrogen receptor and Sp1 do not bind cooperatively to their sites in vitro, suggesting that other mechanisms might be responsible for the hormone-dependent binding of Sp1 in vivo. Since hormone treatment leads to the appearance of a distinct DNase I-hypersensitive site over the promoter chromatin, an estrogen-induced change in the local chromatin structure could facilitate binding of Sp1in vivo. Gene expression is controlled by combinatorial arrangement of sequence-specific transcription factors that interact with each other and with components of the transcription initiation complex. Modulation of gene transcription is achieved by factors whose activity is reversibly influenced by ligands or posttranslational modifications, such as phosphorylation. The transcriptional effects of ligand-inducible steroid hormone receptors represent a typical example. To attain efficiency and specificity in gene regulation, steroid hormone receptors interact with ubiquitous or tissue-specific factors as well as with co-activators, which bridge to the general transcriptional apparatus (1Beato M. Herrlich P. Schütz G. Cell. 1995; 83: 851-857Abstract Full Text PDF PubMed Scopus (1624) Google Scholar). The particular combination of factors and the nature of the interactions required for regulated expression of a gene is specified in the form of complex arrays of cis-acting elements in its enhancer and promoter regions. These elements are usually identified through gene transfer experiments and in vitro DNA binding studies. However, the binding of factors to cognate DNA elements, as well as interactions with other factors, is conditioned by the native organization of DNA in chromatin, which imposes defined topological constraints (2Felsenfeld G. Boyes J. Chung J. Clark D. Studitsky V. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9384-9388Crossref PubMed Scopus (155) Google Scholar). Therefore, demonstration of the functional relevance of DNA elements requires a genomic analysis of the chromosomally organized gene in intact cells. To approach these issues, we have studied the steroid hormone-dependent regulation of the rabbit uteroglobin gene. In female animals, the gene is transcriptionally active in epithelial cells of the endometrium during the preimplantation phase of pregnancy (3Beier H.M. Biochim. Biophys. Acat. 1968; 160: 289-291Crossref PubMed Scopus (240) Google Scholar, 4Krishnan R.S. Daniel J.C.J. Science. 1967; 158: 490-492Crossref PubMed Scopus (230) Google Scholar). Estrogen and progesterone exert a stimulatory effect on transcription (5Müller H. Beato M. Eur. J. Biochem. 1980; 112: 235-241Crossref PubMed Scopus (41) Google Scholar). Whereas the action of progesterone is probably mediated by an upstream enhancer region containing two clusters of progesterone receptor binding sites (6Jantzen C. Fritton H.P. Igo-Kemenes T. Espel E. Janich S. Cato A.C.B. Mugele K. Beato M. Nucleic Acids Res. 1987; 15: 4535-4552Crossref PubMed Scopus (92) Google Scholar), estrogen might function via a noncanonical estrogen-responsive element (ERE), 1The abbreviations used are: ERE, estrogen-responsive element; ER, estrogen receptor; DMS, dimethyl sulfate; EMSA, electrophoretic mobility shift analysis; hCG, human chorionic gonadotropin. 1The abbreviations used are: ERE, estrogen-responsive element; ER, estrogen receptor; DMS, dimethyl sulfate; EMSA, electrophoretic mobility shift analysis; hCG, human chorionic gonadotropin. as suggested by gene transfer and in vitro binding assays (7Slater E.P. Redeuilh G. Theis K. Suske G. Beato M. Mol. Endocrinol. 1990; 4: 604-610Crossref PubMed Scopus (83) Google Scholar). We have analyzed the promoter of the endogenous uteroglobin gene by genomic footprinting in endometrial epithelium from uterus in situ. Upon hormone treatment, we detect endometrium-specific occupancy of the noncanonical ERE in the promoter. Concomitantly, we observe estrogen-dependent recruitment of Sp1 to an adjacent site, which proved to be functionally essential for estrogen induction of the promoter. We provide evidence that Sp1 but not the related transcription factor Sp3 (8Hagen G. Muller S. Beato M. Suske G. Nucleic Acids Res. 1992; 20: 5519-5525Crossref PubMed Scopus (521) Google Scholar) mediates estrogen induction. Within this composite unit, the estrogen receptor (ER) and Sp1 bind noncooperatively in vitro. Synergistic binding in vivo could involve the chromatin configuration of DNA, since estrogen treatment induces a change in the chromatin structure of the promoter documented by the appearance of a prominent DNase I-hypersensitive site. For the construction of the uteroglobin promoter-driven luciferase reporter plasmid, a HindIII (−395) to XhoI (+14) uteroglobin promoter fragment (9Suske G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar) was inserted into the pXP2 plasmid (10Nordeen S.K. BioTechniques. 1988; 6: 454-457PubMed Google Scholar). Promoter linker-scanner mutants were generated from similar constructs (9Suske G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar). Further mutations were introduced by oligonucleotide-directed mutagenesis (11Barettino D. Feigenbutz M. Valcarcel R. Stunnenberg H.G. Nucleic Acids Res. 1994; 22: 541-542Crossref PubMed Scopus (106) Google Scholar). The following expression plasmids for insect cells were used: for the expression of OctI, pPacOct (kindly supplied by C. Möws (12Sturm R.A. Das G. Herr W. Genes Dev. 1988; 12: 1582-1599Crossref Scopus (474) Google Scholar)); for human ER (13Tora L. Mullick A. Metzger D. Ponglikitmongkol M. Park I. Chambon P. EMBO J. 1989; 8: 1981-1986Crossref PubMed Scopus (370) Google Scholar), pPacER (constructed and provided by G. Suske); for Sp1, pPacSp1 (14Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1072) Google Scholar); and for Sp3, pPacUbxSp3 (15Dennig J. Beato M. Suske G. EMBO J. 1996; 15: 5659-5667Crossref PubMed Scopus (203) Google Scholar). DMS footprinting was performed according to Ref. 16Pfeifer G.P. Steigerwald S. Mueller P.R. Riggs A.D. Science. 1989; 246: 810-813Crossref PubMed Scopus (309) Google Scholar. In brief, endometrial epithelium or liver cells were exposed to 0.2% DMS in Dulbecco's modified Eagle's medium for 5 min. The reaction was stopped by washing several times with phosphate-buffered saline. Epithelial cells were separated, and genomic DNA was prepared, cleaved with piperidine, and submitted to a ligation-mediated polymerase chain reaction as described (17Truss M. Bartsch J. Schelbert A. Haché R.J.G. Beato M. EMBO J. 1995; 14: 1737-1751Crossref PubMed Scopus (265) Google Scholar). The following gene-specific oligonucleotides were used: for the upper strand, ERA1 (GATCCTGGGTGCTCCT), ERA2 (TCACAGCCACTTGGGCCTCAGC), and ERA3 (GGCCTCAGCTTCTCCTGTGACAGG); for the lower strand, ER1 (ACTGCATTATTTACTTGGG), ER2 (CATTGACTTGGTGGGATAAGTAAATATTCCC), and ER3 (TTCCCTTTTCTCAATCCAGTTTCCATCCC). Nuclear extracts for EMSA were prepared according to Ref. 18Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2207) Google Scholar. The following double-stranded DNA oligonucleotides were used: GTI, named Sp, containing a uteroglobin Sp-binding site (−232 to −223) (8Hagen G. Muller S. Beato M. Suske G. Nucleic Acids Res. 1992; 20: 5519-5525Crossref PubMed Scopus (521) Google Scholar); a uteroglobin promoter (Fnu4HI–HpaII) fragment comprising an ERE and Sp-binding site (−304 to −207) or the respective linker-scanner mutants (9Suske G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar); and a consensus ERE (19Truss M. Chalepakis G. Slater E.P. Mader S. Beato M. Mol. Cell. Biol. 1991; 11: 3247-3258Crossref PubMed Scopus (57) Google Scholar). The gel-purified oligonucleotides were 32P-labeled by the Klenow filling-in reaction, and unincorporated nucleotides were removed through gel filtration. Recombinant human ER was expressed in COS-7 cells by transient transfection with the expression plasmid HEGO (13Tora L. Mullick A. Metzger D. Ponglikitmongkol M. Park I. Chambon P. EMBO J. 1989; 8: 1981-1986Crossref PubMed Scopus (370) Google Scholar). Antibodies against Sp1 (20Hagen G. Müller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar) and ER (21Greene G.L. Sobel N.B. King W.J. Jensen E.V. J. Steroid Biochem. 1984; 20: 51-56Crossref PubMed Scopus (383) Google Scholar) were preincubated with nuclear extracts for 15 min at room temperature. Poly(dI-dC) and calf thymus DNA were added as nonspecific competitor, and binding buffers were as described in Ref. 22Schauer M. Chalepakis G. Willmann T. Beato M. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1123-1127Crossref PubMed Scopus (67) Google Scholar but containing 3 mm ZnCl2. The binding reaction was incubated at room temperature for 15 min before loading on a 5% nondenaturing polyacrylamide gel. 10−7m diethylstilbestrol was included in experiments with ER. Gels were run in 0.5-fold Tris borate/EDTA buffer at 7 V/cm and room temperature for 120 min, dried, and autoradiographed. SL2 Schneider cells were maintained in Schneider's modified Drosophila medium supplemented with 10% fetal calf serum (insect cell-qualified, Life Technologies, Inc.) at 25 °C. Transient transfections were performed by the calcium phosphate method (23DiNocera P.P. Dawid I.B. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 7095-7098Crossref PubMed Scopus (265) Google Scholar). A 60-mm dish received 5 μg of reporter plasmid, different amounts of co-expression plasmids, and calf thymus DNA to a of μg of were added to the medium of treatment was applied to cells to reporter expression Nucleic Acids Res. PubMed Scopus Google Scholar). were and extracts were and activity were as described J. T. A Scholar) and to since transcription factors might have with an reporter plasmid Genes Dev. 1990; 4: PubMed Scopus Google Scholar). to female or were in controlled of temperature and and were from to was by of at were at by of in the The uterus and liver were and in phosphate-buffered saline. of the method used to and endometrial epithelium cells be the of the uterus was incubated with at and and cells were by The of cells was maintained in Dulbecco's modified Eagle's medium on The medium was supplemented with 5% calf serum and were at in 5% The of the primary was by an against rabbit Transient transfection was performed by the calcium phosphate method C. H. Mol. Cell. Biol. 1987; PubMed Scopus Google Scholar). were added to the medium as and was for was used as estrogen and Nucleic Acids Res. PubMed Scopus Google Scholar) was used as as of was used as of cells with DNase was performed as described (17Truss M. Bartsch J. Schelbert A. Haché R.J.G. Beato M. EMBO J. 1995; 14: 1737-1751Crossref PubMed Scopus (265) Google Scholar). μg of genomic DNA were cleaved with in and on A was with a uteroglobin gene fragment to according to Ref. Proc. Natl. Acad. Sci. U. S. A. 1984; PubMed Scopus Google Scholar. was performed from the a and or from and of the rabbit uteroglobin gene in epithelial cells of the endometrium is by estrogen and progesterone (5Müller H. Beato M. Eur. J. Biochem. 1980; 112: 235-241Crossref PubMed Scopus (41) Google Scholar). in vitro DNA binding experiments and transient gene we have defined a noncanonical ERE (7Slater E.P. Redeuilh G. Theis K. Suske G. Beato M. Mol. Endocrinol. 1990; 4: 604-610Crossref PubMed Scopus (83) Google Scholar) and Sp-binding sites to as GC/GT and (9Suske G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar, J. G. Beato M. Suske G. J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar) To the of these regulatory elements in hormone induction in vivo, we have studied their occupancy by the genomic footprinting G.P. Steigerwald S. Mueller P.R. Riggs A.D. Science. 1989; 246: 810-813Crossref PubMed Scopus (309) Google Scholar). Since are endometrial we have applied the DMS footprinting to the rabbit endometrial epithelium in treatment of the polymerase chain reaction analysis of the modified and DNA two hormone-dependent in the promoter region and which in the endometrial epithelium but not in liver of over the ERE was in a was in the lower with the liver and as an upstream of the ERE, the in the upper was in for the the adjacent GC/GT were in the lower and a in the upper The corresponding are in the of A. The were in the endometrial epithelium but not in the endometrial epithelium from female and These over the ERE and over the adjacent GC/GT box but treatment to induction of the promoter. prominent were over the other GC/GT not The from to The of an in vitro described for the ER (7Slater E.P. Redeuilh G. Theis K. Suske G. Beato M. Mol. Endocrinol. 1990; 4: 604-610Crossref PubMed Scopus (83) Google Scholar). We that by the are responsible for the over the ERE by the uterus from to estrogen A was ligands of the ER, such as the estrogen were The the from with described and estrogen-dependent in over the ERE was as early as min hormone treatment not and was for at suggesting a estrogen to the of in endometrial estrogen treatment of uterus the occupancy of the ERE and the adjacent GC/GT box in vitro approach was to the binding at their respective A DNA fragment was incubated with nuclear extracts of the endometrial epithelium from and to were The was by an to ER to the ER the was by an against Sp1 the was by an of a consensus ERE the was by an a binding site for factors 3 and a in the ERE the a in the GC/GT box the 7 and results were in binding experiments Sp1 expressed in and human ER expressed in cells or in COS-7 cells and not The of the genomic in vivo was by with corresponding vitro. Both the human ER and the Sp1, the as in vivo The was the with extracts of endometrial epithelium that were identified as the endogenous ER and Sp1 not The of in that the genomic from binding of ER and from Sp1. to binding in vitro and gene transfer two Sp-binding sites in the uteroglobin promoter have (9Suske G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar, J. G. Beato M. Suske G. J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar) To the functional of the Sp-binding we performed transient transfection experiments in primary epithelial cells from the We mutations that factor binding to the GC/GT (9Suske G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar, J. G. Beato M. Suske G. J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar) The uteroglobin gene promoter fragment from to estrogen to the reporter 3 in with the estrogen induction of uteroglobin transcription in intact (5Müller H. Beato M. Eur. J. Biochem. 1980; 112: 235-241Crossref PubMed Scopus (41) Google Scholar). of the ERE its function as a element 3 of the GC/GT box adjacent to the ERE estrogen induction 3 mutations of the GC/GT at and at not estrogen induction but in induction 3 and of these mutants estrogen induction 3 that transcription requires not binding of the receptor to its element but a interaction with transcription of the factors to the adjacent GC/GT the transcription was by these in the GC/GT box at to a in the two GC/GT suggesting a of these sites for and Since the of transcription factors several with similar for GC/GT (8Hagen G. Muller S. Beato M. Suske G. Nucleic Acids Res. 1992; 20: 5519-5525Crossref PubMed Scopus (521) Google Scholar, J. Beato M. Suske G. EMBO J. 1996; 15: 5659-5667Crossref PubMed Scopus (203) Google Scholar, G. Müller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar, J. G. Beato M. Suske G. J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar), we performed experiments with ER in SL2 insect cells, which are of endogenous factors (14Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1072) Google Scholar). The ER estrogen induction to a reporter gene by the uteroglobin but estrogen induction was by co-expression of Sp1, a co-expression of Sp3 such effect 3 Since Sp1 and Sp3 were expressed at similar in insect cells (20Hagen G. Müller S. Beato M. Suske G. EMBO J. 1994; 13: 3843-3851Crossref PubMed Scopus (650) Google Scholar) and Sp1 is the GC/GT box binding activity in nuclear extracts of endometrial and we that Sp1 in the estrogen-dependent of the uteroglobin gene. The of other GC/GT factors, such as or K. H. H. H. Nucleic Acids Res. PubMed Scopus Google Scholar), in the tissue-specific of the gene was not since these were not in the extracts by EMSA (8Hagen G. Muller S. Beato M. Suske G. Nucleic Acids Res. 1992; 20: 5519-5525Crossref PubMed Scopus (521) Google Scholar) The recruitment of Sp1 to its binding site by the binding of the ER could be to DNA binding of the two factors. To this we performed a with the human ER and Sp1 and a DNA fragment comprising the ERE and the adjacent GC/GT In the of of factors, a complex containing ERE and Sp1 was and as by not A similar gel was performed with DNA in the ERE or the the corresponding to the site was not and complex was and A of the different as by EMSA a function the of added ER and the appearance of the complex These a in binding of ER and Sp1 to the corresponding region in the promoter in vitro. for the simultaneous binding of ER and Sp1 in vivo be a in chromatin which could facilitate Sp1 To this we the of nuclear DNA DNase or In with DNase at the a site was at in the endometrial epithelium of The region was not transcriptional of the uteroglobin gene promoter is by an of the organization as by the at a of the promoter. DNA regulatory elements be identified in transfection experiments in but the of in the regulation of a particular gene be by in the intact or in the to approach this is to the regulatory of DNA genomic footprinting to sites that are in vivo Proc. Natl. Acad. Sci. U. S. A. 1984; PubMed Scopus Google Scholar). of usually performed with in with the well by and we the molecular analysis of steroid hormone effects in the native endometrial epithelium performed in an and applied to the rabbit uteroglobin gene. methodology to monitor the effects of related in the complex of the intact The from these have via gene transfer in a and cells from the endometrial gene transfer experiments to the of a noncanonical ERE and several GC/GT in the rabbit uteroglobin but the of these elements to gene regulation was since the experiments were in cells not the endogenous uteroglobin gene (7Slater E.P. Redeuilh G. Theis K. Suske G. Beato M. Mol. Endocrinol. 1990; 4: 604-610Crossref PubMed Scopus (83) Google Scholar, G. Lorenz W. Klug J. Gazdar A.F. Beato M. Gene Expr. 1992; 2: 339-352PubMed Google Scholar). In was not the GC/GT elements in induction of the uteroglobin gene. The results of genomic footprinting experiments in the endometrial epithelium in demonstrate a of the different GC/GT the simultaneous occupancy of the ERE and the adjacent GC/GT box following induction of uteroglobin gene expression during early A similar was were with the of the changes was probably effects early these a for the ER in the occupancy of the adjacent GC/GT experiments with nuclear extracts from endometrial cells and with that the factors responsible for the in vivo are the ER and of the of transcription factors. In to the ERE, the of the adjacent GC/GT box was essential for estrogen induction in primary endometrial cells. In transfection experiments in insect cells, which factors, ER was for estrogen-dependent induction of the uteroglobin promoter. Since Sp1 was to transcriptionally synergize with ER, Sp3 is and a of GC/GT in endometrial epithelium we that Sp1 is the the occupancy of ERE and GC/GT Sp3 to an that mediated by Sp1 (15Dennig J. Beato M. Suske G. EMBO J. 1996; 15: 5659-5667Crossref PubMed Scopus (203) Google Scholar). Therefore, the of the estrogen by changes in the of Sp3 to Sp1 be M. R. R. 1996; PubMed Scopus Google Scholar). The simultaneous occupancy of the adjacent ERE and GC/GT box could be to which binding of the two to their respective However, ER and Sp1 bind to a promoter fragment binding experiments do not a binding in vitro. factors could be in binding of ER and Sp1. such as have suggested to in Sp1 and ER and could or their R. J. S. H. R. M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: PubMed Scopus Google Scholar). interactions regulatory could be to in binding since the of in nuclear extracts might be interactions of ER and Sp1 with components of the transcription such as box binding have described T. G. Tjian R. Cell. Full Text PDF PubMed Scopus Google Scholar, G. E. Tjian R. Proc. Natl. Acad. Sci. U. S. A. 1994; PubMed Scopus Google Scholar, C. I. Chambon P. L. Cell. 1994; Full Text PDF PubMed Scopus Google Scholar), which could the functional S.K. Tjian R. Science. 1995; PubMed Scopus Google Scholar). particular in recruitment of the transcriptional complex could be in in vitro could involve the chromatin of the DNA is that ER and Sp1 do synergize for DNA binding on chromatin, do not synergize on DNA, a that described for other factors J. J. Mol. Biol. 1995; PubMed Scopus Google Scholar, Mol. Cell. Biol. 1995; 15: PubMed Google Scholar). with on uteroglobin promoter DNA be required to this hormone-dependent chromatin could the of ER to the uteroglobin ERE in chromatin could a change in the chromatin structure required for or of Sp1 to the promoter. is by the appearance of a DNase I-hypersensitive site in the active promoter A similar for the or binding of the ubiquitous transcription factor to the promoter (17Truss M. Bartsch J. Schelbert A. Haché R.J.G. Beato M. EMBO J. 1995; 14: 1737-1751Crossref PubMed Scopus (265) Google Scholar, G.L. Cell. 1987; Full Text PDF PubMed Scopus Google Scholar, K. R. M. Beato M. Nucleic Acids Res. PubMed Scopus Google Scholar). To this the organization of the uteroglobin promoter is A similar hormone-dependent binding of sequence-specific transcription factors to the of a steroid hormone-responsive element for the promoter J. G. EMBO J. 1988; PubMed Scopus Google Scholar, K. G. M. Nucleic Acids Res. 13: PubMed Scopus Google Scholar, J. Muller E. G. Nucleic Acids Res. 1991; 19: PubMed Scopus Google Scholar), the gene W. U. Schütz G. PubMed Scopus Google Scholar), and the or promoter G.L. Cell. 1987; Full Text PDF PubMed Scopus Google Scholar). hormone-dependent recruitment of ubiquitous transcription factors to and sites be a of gene regulation M. R. G. Eur. J. Biochem. 1994; PubMed Scopus Google Scholar, U. W. Schütz G. EMBO J. 1988; PubMed Scopus Google Scholar, 1996; PubMed Scopus Google Scholar, R. Müller M. H. R. 1988; PubMed Scopus Google Scholar, R. Muller M. H. R. Science. 1988; PubMed Scopus Google Scholar). We L. and G. L. for the T. and for cells with the human G. Suske and for SL2 expression plasmids, to Sp1, and and A. E. for the of We J. for the of epithelial cells from the H. M. and C. for on the treatment of the The was by from the and the