Effect of Inositol Hexakisphosphate Kinase 2 on Transforming Growth Factor β-activated Kinase 1 and NF-κB Activation

Abstract

We previously showed that inositol hexakisphosphate kinase 2 (IHPK2) functions as a growth-suppressive and apoptosis-enhancing kinase during cell stress. Overexpression of IHPK2 sensitized ovarian carcinoma cell lines to the growth-suppressive and apoptotic effects of interferon β (IFN-β), IFN-α2, and γ-irradiation. Expression of a kinase-dead mutant abrogated 50% of the apoptosis induced by IFN-β. Because the kinase-dead mutant retained significant response to cell stressors, we hypothesized that a portion of the death-promoting function of IHPK2 was independent of its kinase activity. We now demonstrate that IHPK2 binds to tumor necrosis factor (TNF) receptor-associated factor (TRAF) 2 and interferes with phosphorylation of transforming growth factor β-activated kinase 1 (TAK1), thereby inhibiting NF-κB signaling. IHPK2 contains two sites required for TRAF2 binding, Ser-347 and Ser-359. Compared with wild type IHPK2-transfected cells, cells expressing S347A and S359A mutations displayed 3.5-fold greater TAK1 activation following TNF-α. This mutant demonstrated a 6–10-fold increase in NF-κB DNA binding following TNF-α compared with wild type IHPK2-expressing cells in which NF-κB DNA binding was inhibited. Cells transfected with wild type IHPK2 or IHPK2 mutants that lacked S347A and S359A mutations displayed enhanced terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling staining following TNF-α. We believe that IHPK2-TRAF2 binding leads to attenuation of TAK1- and NF-κB-mediated signaling and is partially responsible for the apoptotic activity of IHPK2. We previously showed that inositol hexakisphosphate kinase 2 (IHPK2) functions as a growth-suppressive and apoptosis-enhancing kinase during cell stress. Overexpression of IHPK2 sensitized ovarian carcinoma cell lines to the growth-suppressive and apoptotic effects of interferon β (IFN-β), IFN-α2, and γ-irradiation. Expression of a kinase-dead mutant abrogated 50% of the apoptosis induced by IFN-β. Because the kinase-dead mutant retained significant response to cell stressors, we hypothesized that a portion of the death-promoting function of IHPK2 was independent of its kinase activity. We now demonstrate that IHPK2 binds to tumor necrosis factor (TNF) receptor-associated factor (TRAF) 2 and interferes with phosphorylation of transforming growth factor β-activated kinase 1 (TAK1), thereby inhibiting NF-κB signaling. IHPK2 contains two sites required for TRAF2 binding, Ser-347 and Ser-359. Compared with wild type IHPK2-transfected cells, cells expressing S347A and S359A mutations displayed 3.5-fold greater TAK1 activation following TNF-α. This mutant demonstrated a 6–10-fold increase in NF-κB DNA binding following TNF-α compared with wild type IHPK2-expressing cells in which NF-κB DNA binding was inhibited. Cells transfected with wild type IHPK2 or IHPK2 mutants that lacked S347A and S359A mutations displayed enhanced terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling staining following TNF-α. We believe that IHPK2-TRAF2 binding leads to attenuation of TAK1- and NF-κB-mediated signaling and is partially responsible for the apoptotic activity of IHPK2. Inositol polyphosphates play diverse biologic roles, including regulation of endocytic trafficking (1Saiardi A. Sciambi C. McCaffery J.M. Wendland B. Snyder S.H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 14206-14211Crossref PubMed Scopus (149) Google Scholar), protein phosphorylation (2Saiardi A. Bhandari R. Resnick A.C. Snowman A.M. Snyder S.H. Science. 2004; 306: 2101-2105Crossref PubMed Scopus (241) Google Scholar), chemotaxis (3Luo H.R. Huang Y.E. Chen J.C. Saiardi A. Iijima M. Ye K. Huang Y. Nagata E. Devreotes P. Snyder S.H. Cell. 2003; 114: 559-572Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar), regulation of non-homologous end joining (4Hanakahi L.A. Bartlet-Jones M. Chappell C. Pappin D. West S.C. Cell. 2000; 102: 721-729Abstract Full Text Full Text PDF PubMed Google Scholar, 5Ma Y. Lieber M.R. J. Biol. Chem. 2002; 30: 30Google Scholar, 6Byrum J. Jordan S. Safrany S.T. Rodgers W. Nucleic Acids Res. 2004; 32: 2776-2784Crossref PubMed Scopus (41) Google Scholar), and apoptosis (7Morrison B.H. Bauer J.A. Kalvakolanu D.V. Lindner D.J. J. Biol. Chem. 2001; 276: 24965-24970Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 8Nagata E. Luo H.R. Saiardi A. Bae B.I. Suzuki N. Snyder S.H. J. Biol. Chem. 2005; 280: 1634-1640Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). Inositol hexakisphosphate kinase 2 (IHPK2) 2The abbreviations used are: IHPK2, inositol hexakisphosphate kinase 2; DN, dominant negative; IFN, interferon; IκB, inhibitor of NF-κB; IKK, IκB kinase; MEF, murine embryonic fibroblast; NF-κB, nuclear factor-κB; PBS, phosphate-buffered saline; TAK1, transforming growth factor β-activated kinase 1; TNF, tumor necrosis factor; TRAF, TNF receptor-associated factor; XIAP, X-linked inhibitor of apoptosis; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling; GAPDH, glyceraldehyde-3phosphate dehydrogenase; EMSA, electrophoretic mobility shift assay; siRNA, small interfering RNA; siSCR, siRNA-scrambled; GST, glutathione S-transferase. is a kinase that catalyzes the synthesis of diphosphoinositol pentakisphosphate and bis-diphosphoinositol tetrakisphosphate. Overexpression of IHPK2 sensitizes ovarian carcinoma cell lines to the growth-suppressive and apoptotic effects of IFN-β, IFN-α2 treatment, and ionizing radiation (9Morrison B.H. Bauer J.A. Hu J. Grane R.W. Ozdemir A. Chawla-Sarkar M. Gong B. Almasan A. Kalvakolanu D.V. Lindner D.J. Oncogene. 2002; 21: 1882-1889Crossref PubMed Google Scholar). Snyder and co-workers (8Nagata E. Luo H.R. Saiardi A. Bae B.I. Suzuki N. Snyder S.H. J. Biol. Chem. 2005; 280: 1634-1640Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar) recently demonstrated that IHPK2 enhanced the cytotoxic actions of several different cell stressors. By co-immunoprecipitation, we found that IHPK2 associated with TRAF2. The tumor necrosis factor (TNF) receptor-associated factor (TRAF) family of proteins serve as adapter proteins for the TNF-R and interleukin-1 receptor superfamilies (10Arch R.H. Gedrich R.W. Thompson C.B. Genes Dev. 1998; 12: 2821-2830Crossref PubMed Google Scholar, 11Kopp E.B. Medzhitov R. Curr. Opin. Immunol. 1999; 11: 13-18Crossref PubMed Scopus (588) Google Scholar). The role of TRAF2 in mediating the TNF-α response is controversial. Early studies with TRAF2 and TRAF5 knock-out mice or dominant negative (DN) TRAF2 mice suggested that these proteins were not essential or played redundant roles in TNF-induced NF-κB activation (12Yeh W.C. Shahinian A. Speiser D. Kraunus J. Billia F. Wakeham A. de la Pompa J.L. Ferrick D. Hum B. Iscove N. Ohashi P. Rothe M. Goeddel D.V. Mak T.W. Immunity. 1997; 7: 715-725Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar, 13Nakano H. Sakon S. Koseki H. Takemori T. Tada K. Matsumoto M. Munechika E. Sakai T. Shirasawa T. Akiba H. Kobata T. Santee S.M. Ware C.F. Rennert P.D. Taniguchi M. Yagita H. Okumura K. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 9803-9808Crossref PubMed Scopus (165) Google Scholar, 14Lee S.Y. Reichlin A. Santana A. Sokol K.A. Nussenzweig M.C. Choi Y. Immunity. 1997; 7: 703-713Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar). TRAF2–/– fibroblasts are severely impaired in their ability to activate c-Jun N-terminal kinase in response to TNF-α (12Yeh W.C. Shahinian A. Speiser D. Kraunus J. Billia F. Wakeham A. de la Pompa J.L. Ferrick D. Hum B. Iscove N. Ohashi P. Rothe M. Goeddel D.V. Mak T.W. Immunity. 1997; 7: 715-725Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar). Subsequent studies suggested that TRAF2–/– fibroblasts (15Devin A. Cook A. Lin Y. Rodriguez Y. Kelliher M. Liu Z. Immunity. 2000; 12: 419-429Abstract Full Text Full Text PDF PubMed Google Scholar) or TRAF2/TRAF5 double knock-out murine fibroblasts (16Tada K. Okazaki T. Sakon S. Kobarai T. Kurosawa K. Yamaoka S. Hashimoto H. Mak T.W. Yagita H. Okumura K. Yeh W.C. Nakano H. J. Biol. Chem. 2001; 276: 36530-36534Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar) were impaired in their ability to activate NF-κB in response to TNF-α. Most recently, Aggarwal and co-workers (17Jackson-Bernitsas D.G. Ichikawa H. Takada Y. Myers J.N. Lin X.L. Darnay B.G. Chaturvedi M.M. Aggarwal B.B. Oncogene. 2007; 26: 1385-1397Crossref PubMed Scopus (172) Google Scholar) have shown that NF-κB activation in carcinomas could be disrupted by expression of DN-TRAF2 but not by DN-TRAF5, suggesting that TRAF2 plays a critical role in TNF-α-induced NF-κB activation. Within the trimeric signaling complex TRAF2 serves to recruit IκB kinase (IKK) and RIP1 to the TNF-R1 (18Devin A. Lin Y. Yamaoka S. Li Z. Karin M. Liu Z. Mol. Cell. Biol. 2001; 21: 3986-3994Crossref PubMed Scopus (129) Google Scholar, 19Song H.Y. Regnier C.H. Kirschning C.J. Goeddel D.V. Rothe M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9792-9796Crossref PubMed Scopus (507) Google Scholar). Transforming growth factor β-activated kinase (TAK1) is a critical component of this cascade, functioning downstream of RIP1 and TRAF2 to activate IKKβ (20Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). We hypothesized that the binding of IHPK2 to TRAF2 might disrupt TNF-α signaling. The aims of this study were to identify motifs in IHPK2 required for TRAF2 binding and to determine whether disruption of IHPK2-TRAF2 binding would affect TNF-α signaling. Materials—Human IFN-β (Serono, Rockland, MA)-specific activity, 2.7 × 108 units/mg, was used in these studies. Construction of IHPK2 SXXE Mutants—IHPK2 was cloned into the pCXN2myc mammalian expression vector (21Kinoshita S. Suzuki H. Ito K. Kume K. Shimizu T. Sugiyama Y. Pharm. Res. 1998; 15: 1851-1856Crossref PubMed Scopus (26) Google Scholar). Using PCR, point mutations were made in IHPK2. The serine residues in SXXE were changed to AXXE. Thus, the wild type sequences (in bold) SXXE1, VDIVDNSDCEPKS; SXXE2, LLENLTSRYEVPC; SXXE3, PEVVLDSDAEDLE; and SXXE4, EDLSEESADESAG were changed to SXXE1, VDIVDNADCEPKS; SXXE2, LLENLTARYEVPC; SXXE3, PEVVLDADAEDLE; and SXXE4, EDLSEEAADESAG. This was done using primers 5′-pGTGGACATTGTAGATAATGCAGACTGTGAACCAAAAAGT-3′ and 5′-pACTTTTTGGTTCACAGTCTGCATTATCTACAATGTCCAC-3′ for SXXE1, 5′-pTTACTGGAAAACCTGACTGCCCGCTATGAGGTGCCTTGT-3′ and 5′-pACAAGGCACCTCATAGCGGGCAGTCAGGTTTTCCAGTAA-3′ for SXXE2, 5′-pCCCGAAGTGGTCCTGGACGCAGATGCTGAGGATTTGGAG-3′ and 5′-pCTCCAAATCCTCAGCATCTGCGTCCAGGACCACTTCGGG-3′ for SXXE3, and 5′-pGAGGACCTGTCAGAGGAAGCAGCTGATGAGTCTGCTGGT-3′ and 5′-pACCAGCAGACTCATCAGCTGCTTCCTCTGACAGGTCCTC-3′ for SXXE4 (p indicates phosphorylated 5′-nucleotide). The PCR product was digested with EcoRI and XhoI and cloned into pCXN2myc. Mutations were confirmed by sequencing. TRAF2 cDNA was cloned into pCXN2myc in a similar manner. Constructs were transfected into NIH-OVCAR-3 cells by nucleofection with Cell Line Nucleofector kit T (Amaxa, Koeln, Germany). For transient transfection studies, cells were utilized after 48 h. In other co-immunoprecipitation studies, transfectants were selected with G418 for 4 weeks of selection, and clones were pooled. Expression of mutants was monitored by immunoblotting. siRNA Target Sequence—The IHPK2 target sequence consisted of a 29-mer oligonucleotide representing the 21-nucleotide sequence starting at nucleotide 181 (AAAUUCACUCCCCAGUACAAA) and contained an 8-nucleotide sequence at the 3′-end complementary to the T7 promoter primer provided in the Silencer siRNA construction kit (Ambion, Austin, TX). Complementary oligonucleotides were annealed, and double-stranded RNA was prepared by in vitro transcription. The resulting double-stranded RNA was then treated with RNase A and DNase I to generate the final siRNA product. An oligonucleotide sequence that does not silence any mammalian gene (siRNA-scrambled, siSCR) was utilized as a negative control. Nucleofection was used to transiently transfect siRNAs into cells at a concentration of 40 nm. Immunoprecipitation—Mouse monoclonal antibody (15 μg) made in our laboratory was incubated with Protein A-Sepharose beads (Amersham Biosciences) in cell lysis buffer (0.1% Nonidet P-40, 50 mm Tris, pH 8.0, 0.1 mm EDTA, 0.5 mm dithiothreitol, 75 mm NaCl, 10% glycerol, and protease inhibitors). For in vitro interaction studies, recombinant purified IHPK2 and TRAF2 (50 μg), encoded in pET32a and expressed in BL21-DE3 bacteria, were incubated in 20 mm Hepes, pH 7.9, 150 mm NaCl, 10 mm EDTA, 0.1% Nonidet P-40 (v/v), 10% glycerol, 1 mm dithiothreitol, 1 mm phenylmethanesulfonyl fluoride, 20 μg/ml leupeptin. For in vivo interaction studies, total cell protein (100 μg) was immunoprecipitated with IHPK2 monoclonal antibody. Precipitate was subjected to electrophoresis, transferred to polyvinylidene difluoride membrane, and immunoblotted with rabbit anti-mouse TRAF2 polyclonal antibody (Leinco Technologies, St. Louis, MO). Membranes were incubated with anti-mouse IgG antibody conjugated to horseradish peroxidase and developed using ECL reagents (Pierce). Converse were by with and with were immunoprecipitated with antibody or and for IHPK2. cell protein (50 μg) was 10% and transferred to polyvinylidene difluoride Membranes were incubated with antibody TAK1, or or or or or were incubated with antibody conjugated to horseradish peroxidase and developed using ECL reagents (Pierce). was using was expressed as the of a for NF-κB cells were treated with TNF-α for were with phosphate-buffered Cells were and in lysis with and protease were incubated by × for protein were using the protein The NF-κB binding sequence oligonucleotide was with using kinase DNA binding were 4 20 of in mm mm EDTA, 50% glycerol, mm dithiothreitol, mm 20 mm Tris, pH of and were were and to that were of NF-κB, were for with TNF-α and incubated with 1 of antibody was by a using (Amersham was expressed as the of cell of were with 150 of A mm Hepes, pH 7.9, 20 mm 10 mm 0.1 mm mm 10 mm 0.5 mm fluoride, and protease and 2 of rabbit and by 1 J.A. 2000; PubMed Google Scholar). A 50% of Protein (Amersham Biosciences) in A or was and by at 4 1 h. Protein was by × 1 and monoclonal antibody Biosciences) or antibody was to the and by 2 A 50% of Protein prepared in A 50 mm and 10 mm and was and by Protein were by × and with A mm and with A 50 mm and 10 mm were in of kinase buffer with 0.1 mm 50 of 2 mm dithiothreitol, and 2 of recombinant and incubated were with of buffer mm pH glycerol, 10 and by were with to protein and to to activation was by were treated with IFN-β during growth in and Cells were confirmed by was monitored using a P. R. D. A. J. D. H. S. M.R. J. Natl. PubMed Google Scholar). contained Cells were and with after 4 was cells, and was at nm. was after to determine the representing starting cell with this and that with cells at the end of the growth were as and Thus, as a of a in cell to starting cell is a negative the cells were to TNF-α for h. cells were by deoxynucleotidyltransferase-mediated nick staining using a kit Cells were to the The of cells was by cell IHPK2 proteins were with antibody for IHPK2 antibody to the receptor not TRAF2 NIH-OVCAR-3 cells were treated with or IFN-β (100 were immunoprecipitated with by with antibody IFN-β the interaction of IHPK2 with TRAF2. The with and with similar with and IHPK2 IFN-β previously showed that IFN-β induced IHPK2 in a (7Morrison B.H. Bauer J.A. Kalvakolanu D.V. Lindner D.J. J. Biol. Chem. 2001; 276: 24965-24970Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). This could be after IFN-β (100 transfection with siRNA IHPK2 IHPK2 siRNA Because siRNA an we effects of siRNA transfection activation and phosphorylation of the factor of cells with IFN-β induced phosphorylation of after which was after h. activation of was in and cells, suggesting that of IHPK2 not affect signaling. The expression of an was in and cells transfected NIH-OVCAR-3 cells were subjected to IFN-β, cells expressing siRNA displayed greater staining compared with cells expressing the of apoptosis following TNF-α to of IHPK2 to apoptosis induced by IFN-β and by TNF-α. of apoptosis with enhanced a increase in for IFN-β in cells compared with and IHPK2 IHPK2-TRAF2 of as and the apoptotic TNF-α binds of and protein which leads to activation. of not a but an by apoptosis binding to and of NIH-OVCAR-3 cell with IHPK2 monoclonal antibody showed that was IHPK2 and or with IFN-β enhanced binding of IHPK2 to TRAF2 The interaction was TRAF2 and IHPK2 were cells are transfected with IHPK2 or a and TRAF2 is immunoprecipitated compared with IHPK2 contains SXXE binding sites for TRAF2 H. 1999; PubMed Scopus Google Scholar). For we these sites and The SXXE sites were point to and in NIH-OVCAR-3 cells were with IHPK2 mutants and TRAF2. Cell were immunoprecipitated with IHPK2 monoclonal antibody. demonstrated that two of the SXXE mutations and in not TRAF2 binding activity Protein of IHPK2 and TRAF2 were in transfected cells of IHPK2 TAK1 TAK1 plays an role in the and functions downstream of TRAF2 (20Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar), we whether IHPK2 any phosphorylation of type and cells displayed a to of in response to TNF-α TNF-α to activate TAK1 in cells expressing IHPK2 or the or mutants of phosphorylation of TAK1 following TNF-α was in cells double mutants to 3.5-fold the double mutant TRAF2 binding and TAK1 of IHPK2 to NF-κB phosphorylation of J.A. 1999; PubMed Scopus Google Scholar), we whether IHPK2 any activation of type and cells displayed a of in response to TNF-α The TNF-α response of cells expressing IHPK2 or the or mutants was to of the TNF-α response was in cells double displayed to of the double mutant the ability to activation. of IHPK2 of and is responsible for phosphorylation of IκB, to IκB and nuclear of TAK1 the We activity in of cells transfected with IHPK2 was immunoprecipitated cell using and kinase activity was using recombinant as a TNF-α induced activity in wild type cells, cells, and transfectants Cells expressing IHPK2 double mutants displayed similar kinase activity as wild type cells or other the mutant not to activity in of IHPK2 NF-κB DNA whether IHPK2-TRAF2 binding and of TAK1 phosphorylation disrupted NF-κB signaling. In wild type NIH-OVCAR-3 cells, with TNF-α in NF-κB activation as demonstrated by with confirmed the of with IHPK2 the of DNA binding activity in response to TNF-α of the shift a 2 and of IHPK2 NF-κB DNA binding activity in response to TNF-α. Cells expressing two IHPK2 mutations demonstrated to activation of NF-κB compared with cells with wild type IHPK2. The other IHPK2 mutants that lacked mutations NF-κB activation of IHPK2 NF-κB to the and of target as inhibitor of apoptosis proteins The X-linked mammalian inhibitor of apoptosis protein binds to and J. C.J. J. M. A.M. J. Cell Biol. 2002; PubMed Scopus Google Scholar). Cells expressing IHPK2 mutants displayed to a increase in The IHPK2 mutants and wild type IHPK2, resulting in expression increase Thus, effects of IHPK2 with in NF-κB DNA binding activity. IHPK2 TNF-α-induced effects of IHPK2 TNF-α-induced apoptosis were by wild type and cells displayed 40 and following Cells expressing IHPK2 or or point mutations enhanced Cells expressing the double were a response that was similar to or the double mutant was in TNF-α-induced IHPK2 of of the IHPK2 mutations was in using of Overexpression of IHPK2 sensitized cells to IFN-β, as the to in and IHPK2-transfected cells, Constructs the mutations to IFN-β, as the in cells to in double cells, Cells expressing IHPK2 mutations displayed to IFN-β that of and IHPK2-transfected of IHPK2 sensitized cells to IFN-β, and the double to IFN-β. In our of the kinase-dead IHPK2 mutant cell but the of was transfection was Snyder and co-workers (8Nagata E. Luo H.R. Saiardi A. Bae B.I. Suzuki N. Snyder S.H. J. Biol. Chem. 2005; 280: 1634-1640Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar) recently demonstrated that transfection of IHPK2 the apoptotic of several cell stressors. transfection of of cell of IHPK2, but not or abrogated studies and of Snyder and co-workers that kinase activity is not the of the apoptotic activity of IHPK2. The study that IHPK2 is a protein that TAK1 phosphorylation and NF-κB activation. In the of cell as IFN-β or IHPK2-TRAF2 interaction is at This be responsible for the of apoptosis in NIH-OVCAR-3 confirmed that the SXXE mutations and in TRAF2 these residues are for IHPK2-TRAF2 Cells expressing these IHPK2 mutations were at phosphorylation of TAK1 and activation of NF-κB compared with cells expressing wild type IHPK2. the double mutants were at and to the apoptotic effects of IFN-β. The NF-κB is following of IκB U. Y. Xiao G. G. G. Chen Y. Hu Y. A. S.C. Karin M. Science. 2001; PubMed Scopus Google Scholar). This the which contains and TRAF2 functions to recruit and IKKβ to the TNF-R1 receptor (18Devin A. Lin Y. Yamaoka S. Li Z. Karin M. Liu Z. Mol. Cell. Biol. 2001; 21: 3986-3994Crossref PubMed Scopus (129) Google Scholar). studies TRAF2 knock-out suggested that TRAF2 not play a role in activation of TNF-α (12Yeh W.C. Shahinian A. Speiser D. Kraunus J. Billia F. Wakeham A. de la Pompa J.L. Ferrick D. Hum B. Iscove N. Ohashi P. Rothe M. Goeddel D.V. Mak T.W. Immunity. 1997; 7: 715-725Abstract Full Text Full Text PDF PubMed Scopus (712) Google Scholar), studies that TRAF2 was required for NF-κB activation. Nakano and co-workers (16Tada K. Okazaki T. Sakon S. Kobarai T. Kurosawa K. Yamaoka S. Hashimoto H. Mak T.W. Yagita H. Okumura K. Yeh W.C. Nakano H. J. Biol. Chem. 2001; 276: 36530-36534Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar) showed that TRAF2/TRAF5 double knock-out were severely impaired in NF-κB activation following suggesting that TRAF2 and TRAF5 function be In expression of DN-TRAF2 of an NF-κB NF-κB activation (17Jackson-Bernitsas D.G. Ichikawa H. Takada Y. Myers J.N. Lin X.L. Darnay B.G. Chaturvedi M.M. Aggarwal B.B. Oncogene. 2007; 26: 1385-1397Crossref PubMed Scopus (172) Google Scholar). in carcinomas TRAF2 and TRAF5 function is not A for this signaling that TAK1 activate NF-κB in response to TNF-α and are to TNF-α-induced that the is severely in these cells (20Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). of by to be in TAK1 knock-out (20Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). Thus, TAK1 IKKβ but does not to with recombinant proteins demonstrated that IKKβ is the of the complex E. Chen Y. Karin M. Science. 1998; PubMed Google Scholar). The glutathione and the residues of is phosphorylated by in the kinase IKKβ disrupt or are utilized to the proteins as and be required for activity of the complex G. P. Goeddel D.V. Mol. Cell. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar). proteins are not the not the of phosphorylation in of IHPK2 TAK1 phosphorylation but not affect kinase activity in vitro is TRAF2 and in NIH-OVCAR-3 cells, as of IHPK2 activation a TNF receptor TRAF2 to activate In TRAF2 knock-out and carcinoma cells that phosphorylation was severely impaired Mak T.W. Mol. Cell. Biol. 2005; PubMed Scopus Google Scholar). studies that following binding to IHPK2 functions to TAK1 and NF-κB activation.