Pivotal Role of Bcl-2 Family Proteins in the Regulation of Chondrocyte Apoptosis

Abstract

During endochondral ossification, chondrocytes undergo hypertrophic differentiation and die by apoptosis. The level of inorganic phosphate (Pi) elevates at the site of cartilage mineralization, and when chondrocytes were treated with Pi, they underwent rapid apoptosis. Gene silencing of the proapoptotic Bcl-2 homology 3-only molecule bnip3 significantly suppressed Pi-induced apoptosis. Conversely, overexpression of Bcl-xL suppressed, and its knockdown promoted, the apoptosis of chondrocytes. Bnip3 was associated with Bcl-xL in chondrocytes stimulated with Pi. Bcl-xL was expressed uniformly in the growth plate chondrocytes, whereas Bnip3 expression was exclusively localized in the hypertrophic chondrocytes. Finally, we generated chondrocyte-specific bcl-x knock-out mice using the Cre-loxP recombination system, and we provided evidence that the hypertrophic chondrocyte layer was shortened in those mice because of an increased apoptosis of prehypertrophic and hypertrophic chondrocytes, with the mice afflicted with dwarfism as a result. These results suggest the pivotal role of Bcl-2 family members in the regulation of chondrocyte apoptosis. During endochondral ossification, chondrocytes undergo hypertrophic differentiation and die by apoptosis. The level of inorganic phosphate (Pi) elevates at the site of cartilage mineralization, and when chondrocytes were treated with Pi, they underwent rapid apoptosis. Gene silencing of the proapoptotic Bcl-2 homology 3-only molecule bnip3 significantly suppressed Pi-induced apoptosis. Conversely, overexpression of Bcl-xL suppressed, and its knockdown promoted, the apoptosis of chondrocytes. Bnip3 was associated with Bcl-xL in chondrocytes stimulated with Pi. Bcl-xL was expressed uniformly in the growth plate chondrocytes, whereas Bnip3 expression was exclusively localized in the hypertrophic chondrocytes. Finally, we generated chondrocyte-specific bcl-x knock-out mice using the Cre-loxP recombination system, and we provided evidence that the hypertrophic chondrocyte layer was shortened in those mice because of an increased apoptosis of prehypertrophic and hypertrophic chondrocytes, with the mice afflicted with dwarfism as a result. These results suggest the pivotal role of Bcl-2 family members in the regulation of chondrocyte apoptosis. Endochondral ossification is an essential process for skeletal development, fracture healing, and pathologic conditions such as osteoarthritis and ectopic ossification (1Kronenberg H.M. Nature. 2003; 423: 332-336Crossref PubMed Scopus (2177) Google Scholar). In this process, chondrocytes first proliferate and then differentiate into mature hypertrophic chondrocytes, which mineralize the surrounding matrix that is finally replaced by bone (1Kronenberg H.M. Nature. 2003; 423: 332-336Crossref PubMed Scopus (2177) Google Scholar). There is controversy as to the cell fate of hypertrophic chondrocytes, and several studies have shown that they undergo apoptosis after terminal differentiation (2Farnum C.E. Wilsman N.J. Anat. Rec. 1987; 219: 221-232Crossref PubMed Scopus (112) Google Scholar, 3Gibson G.J. Kohler W.J. Schaffler M.B. Dev. Dyn. 1995; 203: 468-476Crossref PubMed Scopus (123) Google Scholar, 4Hatori M. Klatte K.J. Teixeira C.C. Shapiro I.M. J. Bone Miner. Res. 1995; 10: 1960-1968Crossref PubMed Scopus (176) Google Scholar). Apoptosis is a form of programmed cell death that is characterized by specific morphological and biochemical features, and is tightly regulated by extracellular stimuli and intracellular signaling pathways (5Kerr J.F. Wyllie A.H. Currie A.R. Br. J. Cancer. 1972; 26: 239-257Crossref PubMed Scopus (12927) Google Scholar). Morphologically, apoptosis is characterized by a series of structural changes in dying cells as follows: blebbing of the plasma membrane, condensation of the cytoplasm and the nucleus, and cellular fragmentation into membrane apoptotic bodies. Biochemically, apoptosis is characterized by the degradation of chromatin, initially into large fragments of 50–300 kb and subsequently into smaller fragments that are monomers and multimers of 200 bases. Not only does apoptosis regulate various aspects of the biological activity, but it also can trigger cancer, autoimmune diseases, and degenerative disorders (6Thompson C.B. Science. 1995; 267: 1456-1462Crossref PubMed Scopus (6205) Google Scholar). Several molecules such as Sox5, -6, and -9 and Runx2 have been reported to regulate proliferation and hypertrophic differentiation of chondrocytes (7Ikeda T. Kamekura S. Mabuchi A. Kou I. Seki S. Takato T. Nakamura K. Kawaguchi H. Ikegawa S. Chung U.I. Arthritis Rheum. 2004; 50: 3561-3573Crossref PubMed Scopus (288) Google Scholar, 8Inada M. Yasui T. Nomura S. Miyake S. Deguchi K. Himeno M. Sato M. Yamagiwa H. Kimura T. Yasui N. Ochi T. Endo N. Kitamura Y. Kishimoto T. Komori T. Dev. Dyn. 1999; 214: 279-290Crossref PubMed Scopus (508) Google Scholar, 9Yoshida C.A. Yamamoto H. Fujita T. Furuichi T. Ito K. Inoue K. Yamana K. Zanma A. Takada K. Ito Y. Komori T. Genes Dev. 2004; 18: 952-963Crossref PubMed Scopus (462) Google Scholar). However, the physiologic and pathologic significance of chondrocyte apoptosis and key molecules that regulate this process remain to be elucidated. Previous studies have shown the possible involvement of cytokines, such as tumor necrosis factor-α and Fas ligand, and hormones, such as glucocorticoids and parathyroid hormone-related peptide (PTHrP), 2The abbreviations used are: PTHrPparathyroid hormone-related peptideRTreverse transcriptioncKOconditional knock-outRNAiRNA interferenceBH3Bcr homology domain 3Zbenzyloxycarbonylfmkfluoromethyl ketoneLMlittermateBH3Bcl-2 homology 3. in the localized hypoxia and increased generation of reactive oxygen species in chondrocyte apoptosis. Shapiro and co-workers (10Boyde A. Shapiro I.M. Histochemistry. 1980; 69: 85-94Crossref PubMed Scopus (40) Google Scholar, 11Mansfield K. Rajpurohit R. Shapiro I.M. J. Cell. Physiol. 1999; 179: 276-286Crossref PubMed Scopus (100) Google Scholar, 12Mansfield K. Teixeira C.C. Adams C.S. Shapiro I.M. Bone (Elmsford). 2001; 28: 1-8Crossref PubMed Scopus (114) Google Scholar) and Poole and co-workers (13Mwale F. Tchetina E. Wu C.W. Poole A.R. J. Bone Miner. Res. 2002; 17: 275-283Crossref PubMed Scopus (81) Google Scholar) reported that the terminal differentiation of chondrocytes is accompanied by marked accumulation of extracellular phosphate ions, which may lead to chondrocyte apoptosis through a plasma membrane phosphate transporter mechanism. The importance of phosphate ions in chondrocyte apoptosis was also confirmed by Demay and co-workers (14Sabbagh Y. Carpenter T.O. Demay M.B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9637-9642Crossref PubMed Scopus (201) Google Scholar), who reported that hypophosphatemia leads to impaired apoptosis of hypertrophic chondrocytes and subsequent expansion of the late hypertrophic chondrocyte layer in vitamin D receptor-null mice, which was reversed by feeding with a high phosphate diet. Although these reports indicate that Pi entry into the cells induces apoptosis in growth plate chondrocytes, the precise molecular mechanism that results in the apoptosis of chondrocytes is still an enigma. parathyroid hormone-related peptide reverse transcription conditional knock-out RNA interference Bcr homology domain 3 benzyloxycarbonyl fluoromethyl ketone littermate Bcl-2 homology 3. There are two distinct signaling pathways of apoptosis in mammals. One is initiated by death receptors (death receptor pathways) (15Nagata S. Cell. 1997; 88: 355-365Abstract Full Text Full Text PDF PubMed Scopus (4561) Google Scholar), and the other is regulated by anti- and pro-apoptotic Bcl-2 family members and involves release of cytochrome c from mitochondria into the cytoplasm (mitochondrial pathways) (16Gross A. McDonnell J.M. Korsmeyer S.J. Genes Dev. 1999; 13: 1899-1911Crossref PubMed Scopus (3268) Google Scholar, 17Strasser A. O'Connor L. Dixit V.M. Annu. Rev. Biochem. 2000; 69: 217-245Crossref PubMed Scopus (1387) Google Scholar). The anti-apoptotic Bcl-2 family members include mammalian Bcl-2, Bcl-xL, and Mcl-1, and more than 20 pro-apoptotic Bcl-2 family proteins have been identified to date in mammals, which are divided into two groups as follows: multidomain members (Bax, Bak, Bok/Mtd, etc.) and BH3 domain-only members (Bid, Bad, Bim, Bik, Puma, Noxa, Bmf, Hrk, Bnip3, Nix, etc.) (18Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (902) Google Scholar). Although the BH3-only family members display tissue-specific distribution patterns, multidomain pro-apoptotic members are ubiquitously expressed, indicating that BH3-only proteins play a tissue/cell-specific and a stimulus-specific role in apoptosis and that the other members play an essential role further downstream (18Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (902) Google Scholar). We report here that the balance between the anti-apoptotic Bcl-2 family member Bcl-xL and the pro-apoptotic family member Bnip3 critically regulates the apoptosis of terminally differentiated chondrocytes both in vitro and in vivo. We first showed that the Bcl-xL/Bnip3 axis plays an essential role in Pi-induced chondrocyte apoptosis in vitro. Subsequently, we generated mutant mice conditionally deficient in the bcl-x gene using the Cre-loxP recombination system, and we found that the hypertrophic chondrocyte layer was shortened in these mice because of increased apoptosis. Plasmids and Viral Vectors—For the production of retrovirus, full-length cDNA of mouse bcl-xL, bcl-2, mcl-1, and bnip3 was amplified by PCR, subcloned into pCR-TOPO II vectors (Invitrogen), and inserted into pMx vectors (19Kitamura T. Int. J. Hematol. 1998; 67: 351-359Crossref PubMed Google Scholar). The production of the retroviral vectors was performed as reported previously (20Morita S. Kojima T. Kitamura T. Gene Ther. 2000; 7: 1063-1066Crossref PubMed Scopus (1377) Google Scholar). Briefly, Plat-E cells (2 × 106 cells) were plated in 60-mm dishes and transfected with 2 μg of pMx vector using FuGENE (Roche Applied Science) on the following day. After 24 h, the medium was replaced with fresh medium, which was collected and used as the retroviral supernatant 48 h after the transfection. The puromycin-resistant gene and blasticidin-resistant gene were inserted into a pMx vector for the selection of stable cells. For gene silencing, RNAi sequences were designed for each of the mouse Bcl-2 family genes. Targeting sequences used were as follows: GCGTTCAGTGATCTAACATCC for Bcl-xL; GGATGCCTTTGTGGAACTATA for Bcl-2; GGACTGGCTTGTCAAACAAAG for Mcl-1; GGTAGGACAGAAACTAGAT for Bim; GGGTCAGCTATTATCTCAA for Bid; GAGCCAAACCTGACCACTA for Puma; GGTGGAGAGTTCAATTAAG for Bik; GAAGAGAAGTTGAAAGTAT for Bnip3; GGAAGAAAGTAAGTCTGAT for Nix; GGAAGGAAGCAGAATTGTA for Hrk; GCTCAAAGAAAGATGGCTT for Bmf; and GCTACGTCCAGGAGCGCACCA for green fluorescent protein. RNAi expression vectors for these genes were constructed with piGENEmU6 vector (for mouse) (iGENE Therapeutics) as described (21Miyagishi M. Taira K. Methods Mol. Biol. 2004; 252: 483-491PubMed Google Scholar). For retrovirus expressing RNAi, the U6 promoter and inserts in piGENE vectors were cloned into pMx vectors. The adenovirus vector expressing FADDDN, which lacks the domain that is for and at the death receptor K. Strasser A. J. 1998; 17: PubMed Scopus Google Scholar), was as described previously (7Ikeda T. Kamekura S. Mabuchi A. Kou I. Seki S. Takato T. Nakamura K. Kawaguchi H. Ikegawa S. Chung U.I. Arthritis Rheum. 2004; 50: 3561-3573Crossref PubMed Scopus (288) Google Scholar). vectors expressing was a from of were amplified in cells and with the Viral were by the and the were used at of the gene knockdown of Bcl-2 family growth plate chondrocytes cells × were 60-mm cell After 24 h, the cells were treated with the retrovirus vectors with at the medium was replaced with fresh medium of of they overexpression of Bcl-2 family member molecules was confirmed by plate chondrocytes were from the the of mice × cells can be from were in high medium and are of chondrocytes and were differentiated into hypertrophic chondrocytes and underwent apoptosis in the of Pi. cells were from the The cells were in with and hypertrophic cells were in the of and for apoptosis in the medium was to medium, with and phosphate at of for These cells were at in a The medium was replaced other day. was by to the cells. Briefly, the cells were cells in a After with the of Pi for 24 h, of was and for an 3 was by the with a at was performed with cell from growth plate chondrocytes cells. were with and proteins were with an cell to the of the cell were with a II For were by with and After with were with to Bcl-xL, Puma, Bik, and Mcl-1, Bcl-2, Bnip3, Nix, Bmf, cytochrome and by were with to the For cells were in 20 were with and by with a RNA was with and an was using a RNA to was performed on an using to the After by the system, the of a specific gene in the RNA was and a generated with and to RNA with mouse as an were with a (Invitrogen), to the of mouse genes is described as follows: and for and for and for and for and for Bmf; and for and for and for Bik; and for Bim; and for Hrk; and for Nix; and for Puma; and for Bnip3; and for Bid; and for and for and for for the bcl-x gene with two sequences at the promoter and the were generated as reported previously L. A. L. Mol. 2000; PubMed Scopus Google Scholar). The mice are on a and The of the bcl-x gene was by the site using the and a of 200 and a gene of These mice have been used to the role of Bcl-xL in a of cell those in the and as as in cells and cells L. A. L. Mol. 2000; PubMed Scopus Google Scholar, H. L. J. J. 2004; PubMed Scopus Google Scholar, R. T. K. L. Biol. 2002; PubMed Scopus Google Scholar, J.M. J. 2005; PubMed Scopus Google Scholar, E. U. L. 2000; PubMed Google Scholar, J.M. K. L. Dev. 2001; PubMed Scopus Google Scholar). chondrocyte-specific bcl-x knock-out mice, mice were with II mice, which the gene the of the gene promoter J.M. 2000; 26: PubMed Scopus Google Scholar). and mice were generated by mice with were specific conditions and treated with from the and of the of were in in in and into of and as as were performed to the For were at with Bcl-xL Bnip3 and The of the was by with by with to the For fluorescent a with was bone of and was with a were performed using for the and cell of was to be The results are as Pi Apoptosis of through first the of Pi on the of chondrocytes in vitro. mouse chondrocytes were stimulated with Pi, a and in cell death was of the chondrocytes 24 h after with 20 Pi. which Pi entry into the Pi-induced cell as reported previously indicating that the intracellular Pi stimulated chondrocyte cell In of the cell death indicating that Pi-induced cell death is a process, apoptosis. we the molecular that lead to hypertrophic mineralization, and apoptosis of chondrocytes, using a cell cells of hypertrophic chondrocytes and mineralize the surrounding matrix and subsequent Pi T. J. J. J. Bone Miner. Res. 2003; 18: PubMed Scopus Google Scholar, T. K. F. Y. J. Biol. PubMed Scopus Google Scholar). During the expression of a chondrocyte II increased than and high on In the expression of a hypertrophic chondrocyte was on and increased and was expressed on was After Pi the cells underwent and apoptosis 24 h the of cytochrome c in the of the apoptosis of we performed cell c was in the which is for Pi and was into the cytoplasm in to Pi The differentiation and apoptosis of chondrocytes are regulated overexpression of Pi-induced apoptosis. of which death tumor necrosis cell death but Pi-induced apoptosis in cells These results suggest that the but the death receptor is in the Pi-induced apoptosis of cells. Bcl-xL pathways are regulated by Bcl-2 family member we the expression and of Bcl-2 family molecules the differentiation and apoptosis of chondrocytes. We first the of of of anti-apoptotic Bcl-2 family Bcl-2, Bcl-xL, and Mcl-1, on the cell of cells. these Bcl-xL suppressed Pi-induced chondrocyte apoptosis when by retroviral vectors Conversely, the knockdown of gene through RNAi the cell with the knockdown of the gene that expression was suppressed by Bcl-xL overexpression and increased by its knockdown in differentiated cells treated with Pi and The role of Bcl-xL was further confirmed by the using chondrocytes from overexpression of bcl-x gene in chondrocytes from mice and in the and they apoptotic These results suggest that Bcl-xL the of chondrocytes. However, the expression of Bcl-xL to in the of differentiation Pi-induced apoptosis in cells In that Bcl-xL is uniformly expressed in growth plate chondrocytes be that the expression of member Bcl-2 increased in to Pi an role of the molecule in chondrocyte apoptosis However, the increased level of Bcl-2 was to Pi-induced apoptosis of Bnip3, a Bcl-2 the Pi-induced Apoptosis of that the expression level of Bcl-xL was by Pi and that Bcl-xL is uniformly expressed in the chondrocyte to the role of pro-apoptotic that may the anti-apoptotic of pro-apoptotic Bcl-2 family molecules Hrk, Bnip3, Bad, and increased in expression level the of hypertrophic differentiation and two of and in to Pi shown in gene silencing of the proapoptotic BH3-only molecule bnip3 significantly suppressed Pi-induced apoptosis. that the of Bnip3 increased in to Pi by of growth that Bnip3 expression was exclusively localized in the prehypertrophic and hypertrophic of chondrocytes Although overexpression of Bnip3 increased Pi-induced chondrocyte its overexpression to chondrocyte apoptosis in the of Pi Bnip3 with Bcl-xL and the of Bcl-xL on then the molecular between Bcl-xL and Bnip3 in chondrocytes. studies have shown that Bnip3 with Bcl-2 and Bcl-xL and cell death pathways R. J. A.H. J. Biol. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar). shown in Bnip3 was with Bcl-xL in chondrocytes. The to apoptosis by knockdown was by silencing of bnip3 Conversely, overexpression of Bnip3 Pi-induced cell which was by the of Bcl-xL but by that of Bcl-2 Bnip3 is and with Bcl-xL in chondrocytes in to Pi the anti-apoptotic of Bcl-xL, and apoptosis in these cells. a in the of further the essential role of the Bcl-xL/Bnip3 axis in chondrocytes, we generated chondrocyte-specific conditional knock-out mice of the bcl-x gene by mice with mice, in which is expressed in chondrocytes the of the The mice were at a Bcl-xL expression was in chondrocytes of the mice, whereas its expression in other cells was with that in that the gene bcl-x mice with shortened and with The of the mice was than that of mice at of The of the and which are through endochondral ossification, were also significantly in mice and of the growth of the showed that the hypertrophic chondrocyte layer was shortened in mice, because of an increased apoptosis of prehypertrophic and hypertrophic chondrocytes, as by of in was Bnip3 was expressed in the prehypertrophic and hypertrophic of chondrocytes, and its expression level was between the mice and these Bcl-xL is essential for the of prehypertrophic and hypertrophic chondrocytes by the pro-apoptotic of Although the molecular mechanism and role of chondrocyte apoptosis have been the possible involvement of Pi in this process been was reported that both intracellular and extracellular and phosphate in the hypertrophic terminally differentiated chondrocytes mineralize the surrounding matrix and subsequently die K. Rajpurohit R. Shapiro I.M. J. Cell. Physiol. 1999; 179: 276-286Crossref PubMed Scopus (100) Google Scholar, T. J. J. J. Bone Miner. Res. 2003; 18: PubMed Scopus Google Scholar, Y. F. H. J. Cell. Biochem. 1995; PubMed Scopus Google Scholar). In vitro studies have also that Pi induces the and cell death of chondrocytes K. Rajpurohit R. Shapiro I.M. J. Cell. Physiol. 1999; 179: 276-286Crossref PubMed Scopus (100) Google Scholar, 12Mansfield K. Teixeira C.C. Adams C.S. Shapiro I.M. Bone (Elmsford). 2001; 28: 1-8Crossref PubMed Scopus (114) Google Scholar). T. J. J. J. Bone Miner. Res. 2003; 18: PubMed Scopus Google Scholar) the involvement of Pi and in chondrocyte using and showed that Pi is a key of chondrocyte mineralization, and apoptosis. In disorders in Pi in endochondral ossification, and hypophosphatemia by phosphate by the is associated with of the which as R. J. Google Scholar, H. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar). (14Sabbagh Y. Carpenter T.O. Demay M.B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9637-9642Crossref PubMed Scopus (201) Google Scholar) reported that but is for the chondrocyte apoptosis and the subsequent changes in vitamin D receptor-null mice and of these indicate a role of Pi in the cell fate of hypertrophic chondrocytes. that hypertrophic chondrocytes are to Pi-induced which is regulated by the balance between pro-apoptotic and anti-apoptotic Bcl-2 family the anti-apoptotic members of the Bcl-2 overexpression of an anti-apoptotic member Bcl-xL suppressed its by RNAi stimulated Pi-induced chondrocyte apoptosis Although overexpression of Bcl-2 also suppressed chondrocyte its by RNAi was as as Bcl-xL knockdown was in chondrocyte apoptosis. In mice skeletal because of the of chondrocytes M. L. S. Inoue K. E. R. J. Biol. 1997; PubMed Scopus Google Scholar), in chondrocyte apoptosis was in these mice of Pi-induced chondrocyte apoptosis. These results suggest that Bcl-xL is in the of chondrocytes, it is also that other anti-apoptotic Bcl-2 family members have with the skeletal of bcl-x gene knock-out mice have been because of we generated chondrocyte-specific bcl-x gene knock-out mice using the Cre-loxP recombination The mice dwarfism and of the growth plate a of the hypertrophic layer because of the apoptosis of hypertrophic chondrocytes, the pivotal role of Bcl-xL in hypertrophic chondrocyte N. K. H. H. PubMed Scopus Google Scholar) previously reported that the apoptosis of chondrocytes was increased in the hypertrophic of M. Y. Biol. PubMed Scopus (40) Google Scholar) reported that the which downstream of parathyroid receptor chondrocyte by in a However, because the morphological of growth of bcl-x mice were from those of mice, in which the of chondrocytes was because of apoptosis and endochondral ossification was we that the apoptosis of hypertrophic chondrocytes in bcl-x mice is because of a in the N. F. Dev. Biol. 2001; PubMed Scopus Google Scholar) that anti-apoptotic 3 regulates the of chondrocytes, and its in mice results in an accumulation of at the between cartilage and endochondral these they that the apoptosis of hypertrophic chondrocytes does the bone In bcl-x mice a which was to be by the increased apoptosis of hypertrophic chondrocytes. The for the between results and and further be to the between Bcl-xL and 3. the expression of Bcl-xL and other anti-apoptotic members to in the of the hypertrophic differentiation and the apoptosis of chondrocytes, we that the expression of pro-apoptotic is in the hypertrophic chondrocytes and the anti-apoptotic of the pro-apoptotic Bcl-2 family we identified Bnip3 as a pro-apoptotic gene in chondrocytes. Bnip3 to the BH3-only members and both and apoptosis by Bcl-2 Bcl-xL R. J. A.H. J. Biol. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar, Biochem. J. PubMed Scopus Google Scholar). Bnip3 is ubiquitously expressed, and its expression in a of H. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar, J. Res. 2004; PubMed Scopus Google Scholar). it was reported that the between Bnip3 and Bcl-xL, and the of to does on the of a BH3 domain in Bnip3 is also in cell death by downstream of the A. M. PubMed Scopus Google Scholar). We found that the expression of Bnip3 increased in with hypertrophic differentiation and Pi-induced apoptosis in which to the expression of Bnip3 in the growth as by Bnip3 its expression in to Pi and to Bcl-xL in chondrocytes. In knockdown of Bnip3 Pi-induced apoptosis of chondrocytes, and we that Bnip3 the cell fate of hypertrophic chondrocytes by the anti-apoptotic of Bcl-xL, the involvement of other BH3-only proteins be of Bnip3 increased Pi-induced chondrocyte apoptosis but to apoptosis in the of Pi indicating that other molecules by Pi is also for chondrocyte apoptosis. Previous reports have shown an in in hypertrophic chondrocytes E. N. Y. Acad. Sci. PubMed Scopus Google Scholar), which may Bnip3 Pi the terminal differentiation of chondrocytes, as by increased expression of it is possible that Pi induces chondrocyte apoptosis by terminal differentiation of the cells. However, overexpression of Bnip3 the apoptosis of chondrocytes hypertrophic indicating that the differentiation and the apoptosis of chondrocytes are we were the A. M. J. H. J. J. PubMed Scopus Google Scholar) reported the of Bnip3 knock-out mice with in of the growth is to is in chondrocyte in the mice, and Bnip3 as a BH3-only in chondrocytes to be Bnip3 been reported to be in in cells A. M. PubMed Scopus Google Scholar). is a than mechanism. However, studies have that it is also to programmed cell which is by Bcl-xL A. PubMed Scopus Google Scholar). terminally differentiated chondrocytes are reported to Shapiro I.M. PubMed Scopus (40) Google Scholar). growth plate chondrocytes are to E. N. Y. Acad. Sci. PubMed Scopus Google Scholar), may to such Although the precise mechanism of cell death the apoptotic cell death and the cell death be with each other in growth plate chondrocytes and regulated by Bcl-xL and In the apoptosis of hypertrophic chondrocytes is at regulated by the balance between anti-apoptotic Bcl-xL and pro-apoptotic Bnip3, in which Pi to play a studies be to the molecular chondrocyte which have to be We R. of of who provided the to with