M-LP, Mpv17-like Protein, Has a Peroxisomal Membrane Targeting Signal Comprising a Transmembrane Domain and a Positively Charged Loop and Up-regulates Expression of the Manganese Superoxide Dismutase Gene

Abstract

M-LP (Mpv17-like protein) has been identified as a new protein that has high sequence homology with Mpv17 protein, a peroxisomal membrane protein involved in the development of early onset glomerulosclerosis. In this study, we verified the peroxisomal localization of M-LP by performing dual-color confocal analysis of COS-7 cells cotransfected with green fluorescent protein-tagged M-LP and DsRED2-PTS1, a red fluorescent peroxisomal marker. To characterize the peroxisomal membrane targeting signal, we examined the intracellular localizations of several green fluorescent protein-tagged deletion mutants and demonstrated that, of the three transmembrane segments predicted, the first near the NH2 terminus and NH2-terminal half of the following loop region, which is abundant in positively charged amino acids, were necessary and sufficient for peroxisomal targeting. To elucidate the function of M-LP, we examined the activities of several enzymes involved in reactive oxygen species metabolism in COS-7 cells and found that transfection with M-LP increased the superoxide dismutase activity significantly. Quantitative real-time PCR analysis revealed that the manganese SOD (SOD2) mRNA level of COS-7 cells transfected with M-LP was elevated. These results indicate that M-LP participates in reactive oxygen species metabolism. M-LP (Mpv17-like protein) has been identified as a new protein that has high sequence homology with Mpv17 protein, a peroxisomal membrane protein involved in the development of early onset glomerulosclerosis. In this study, we verified the peroxisomal localization of M-LP by performing dual-color confocal analysis of COS-7 cells cotransfected with green fluorescent protein-tagged M-LP and DsRED2-PTS1, a red fluorescent peroxisomal marker. To characterize the peroxisomal membrane targeting signal, we examined the intracellular localizations of several green fluorescent protein-tagged deletion mutants and demonstrated that, of the three transmembrane segments predicted, the first near the NH2 terminus and NH2-terminal half of the following loop region, which is abundant in positively charged amino acids, were necessary and sufficient for peroxisomal targeting. To elucidate the function of M-LP, we examined the activities of several enzymes involved in reactive oxygen species metabolism in COS-7 cells and found that transfection with M-LP increased the superoxide dismutase activity significantly. Quantitative real-time PCR analysis revealed that the manganese SOD (SOD2) mRNA level of COS-7 cells transfected with M-LP was elevated. These results indicate that M-LP participates in reactive oxygen species metabolism. The Mpv17-like protein (M-LP) 1The abbreviations used are: M-LP, Mpv17-like protein; GFP, green fluorescent protein; ROS, reactive oxygen species; SOD, superoxide dismutase; PTS, peroxisome targeting signal; mPTS, peroxisome targeting signal of membrane protein; Gpx, glutathione peroxidase; CAT, catalase; TMS, transmembrane segment gene was identified on the basis of an expressed sequence tag obtained by differential display screening of age dependently expressed genes in mouse kidneys (1Iida R. Yasuda T. Aoyama M. Tsubota E. Matsuki T. Kishi K. Mech. Ageing Dev. 2000; 113: 135-144Google Scholar, 2Iida R. Yasuda T. Tsubota E. Matsuki T. Kishi K. Biochem. Biophys. Res. Commun. 2001; 283: 292-296Google Scholar). The M-LP gene is expressed mainly in the kidney and spleen and the amount expressed increases steadily during development, reaches its highest level in adulthood, and decreases gradually with aging. It encodes 194 amino acids of a polypeptide with a sequence and membrane topology markedly similar to those of two peroxisomal membrane proteins, Mpv17 protein (3Weiher H. Noda T. Gray D.A. Sharpe A.H. Jaenisch R. Cell. 1990; 62: 425-434Google Scholar) (30.4% identity, 66.7% similarity) and PMP22 (4Bryant D.D. Wilson G.N. Biochem. Mol. Med. 1995; 55: 22-30Google Scholar) (25.0% identity, 72.1% similarity). These results suggest that M-LP might be embedded in the peroxisomal membrane in a similar manner to these two proteins. Peroxisomes are ubiquitous eukaryotic subcellular organelles that play essential roles in a variety of metabolic pathways, including H2O2 metabolism and the oxidative degradation of fatty acids (5Van den Bosch H. Schutgens R.B. Wanders R.J. Tager J.M. Annu. Rev. Biochem. 1992; 61: 157-197Google Scholar). Recently, a number of studies have been carried out to investigate the mechanisms of peroxisomal biogenesis and protein import (6Erdmann R. Veenhuis M. Kunau W.-H. Trends Cell Biol. 1997; 7: 400-407Google Scholar, 7Passreiter M. Anton M. Lay D. Frank R. Harter C. Wieland F.T. Gorgas K. Just W.W. J. Cell Biol. 1998; 141: 373-383Google Scholar, 8Subramani S. Physiol. Rev. 1998; 78: 171-188Google Scholar). Targeting of peroxisomal matrix proteins is mediated by cytosolic receptors Pex5p and Pex7p that recognize the peroxisomal targeting signals PTS1, which consists of the sequence SKL (and conservative variants) at the carboxyl terminus (9Gould S.G. Keller G.A. Subramani S. J. Cell Biol. 1987; 105: 2923-2931Google Scholar, 10Elgersma Y. Kwast L. Klein A. Voorn-Brouwer T. van den Berg M. Metzig B. America T. Tabak H.F. Distel B. J. Cell Biol. 1996; 135: 97-109Google Scholar), and PTS2, which consists of the consensus sequence (R/K)(L/V/I)X 5(H/Q)(L/A) near the amino terminus (11Swinkels B.W. Gould S.J. Bodnar A.G. Rachubinski R.A. Subramani S. EMBO J. 1991; 10: 3255-3262Google Scholar, 12Rehling P. Marzioch M. Niesen F. Wittke E. Veenhuis M. Kunau W.H. EMBO J. 1996; 15: 2901-2913Google Scholar), respectively. Whereas the targeting of peroxisomal matrix protein import has been well characterized, neither conclusive consensus sequence nor the receptor(s) involved in peroxisomal membrane protein targeting have been determined. Thus, it is important to characterize the membrane peroxisome targeting signals (mPTSs) in as many peroxisomal membrane proteins as possible to understand the biogenesis of peroxisomal membranes. The Mpv17-negative mouse strain was generated by inserting a defective retrovirus into the germ line of mice and is characterized by progressive glomerulosclerosis and neurosensory deafness at a young age (3Weiher H. Noda T. Gray D.A. Sharpe A.H. Jaenisch R. Cell. 1990; 62: 425-434Google Scholar, 13Meyer zum Gottesberge A.M. Reuter A. Weiher H. Eur. Arch. Otorhinolaryngol. 1996; 253: 470-474Google Scholar). The phenotype results from loss of function of the Mpv17 gene encoding a 20-kDa peroxisomal membrane protein. The molecular function of the Mpv17 protein has yet to be elucidated, but it was recently hypothesized that it plays an important role in peroxisomal reactive oxygen species (ROS) metabolism and that glomerular damage is because of overproduction of ROS. In Mpv17 gene-inactivated mice, a significant increase in ROS and lipid peroxidation adduct production was observed and oxygen radical scavengers prevented glomerular damage (14Binder C.J. Weiher H. Exner M. Kerjaschki D. Am. J. Pathol. 1999; 154: 1067-1075Google Scholar). Moreover, a recent study showed that the γ-glutamyl transpeptidase enzyme activity and mRNA expression level were higher, whereas plasma glutathione peroxidase (Gpx3) and superoxide dismutase (SOD) activities were lower, in Mpv17 null cells than normal cells (15Wagner G. Stettmaier K. Bors W. Sies H. Wagner E.M. Reuter A. Weiher H. Biol. Chem. 2001; 382: 1019-1025Google Scholar). These results strongly suggest that the Mpv17 protein is involved in enzymatic antioxidant defense systems. The aims of this study were first, to confirm the peroxisomal localization of M-LP and characterize the mPTS of this new protein and second, to investigate the activities and expression of antioxidant enzymes to determine whether there is a connection between M-LP and ROS metabolism. All the primers used for expression vector construction in this study are listed in Table I. Green fluorescent protein (GFP)-PTS1 was amplified by the PCR using the primer set exGFPS and GFPPTS1A and pEGFP (Clontech, Palo Alto, CA) as the template. DsRED2-PTS1 was amplified using the primer set DsREDS and DsREDPTS1A and pDsRED2 (Clontech) as the template. The PCR products were cloned into the EcoRI/BamHI sites of a mammalian expression vector, pcDNA3.1 (Invitrogen, Carlsbad, CA).Table ISynthetic oligonucleotide primers used for construction of expression vectorsNameSequences (5′–3′)exGFPSCGggattcACCATGGTGAGCAAGGGCGAGGAGGFPPTS1ACGgaattcTTATAACTTGGACAGCTCGTCCATDsREDSCGggattcACCATGGCCTCCTCCGAGAACGTCDsREDPTS1ACGgaattcTTA TAACTTGGACAGGAACAGGTGGTGGCGexMLPS2CGggatccGGTATGGCGAGCTGGTGGCGexMLPA2CGgaattcCTTCTCTGGGGACTTATCACTCGexMG1A2CACCATGGTGGCCTTCTCTGGGGACTTATCexMG2SCCCCAGAGAAGGCCACCATGGTGAGCAexGFPACGgaattcTTACTTGTACAGCTCGTCCATGCexGM1ACGCCATACCTGCCCCCTTGTACAGCTCGTCexGM2SGTACAAGGGGGCAGGTATGGCGAGexMLPACGgaattcTCACTTCTCTGGGGACTTATCAC16MGSCGggatccACCATGCCGTGGCCCACTAACGTG35MGSCGggatccAACATGCAGCAGCGACTGCGGG92MGSCGggatccAACATGGTCGGAGGGCCGATAGCC91MSCCCCaagcttGGTATGGCGAGCTGGTGGCG34MAGGggtaccCAGGGCATCACCCGCCGAGA55MAGGggtaccGGCCAGAGTGGCCACGCGA91MAGGggtaccAGTCTGATCGCATAGCACCTTG15DMSCCCCaagcttGGTATGCCGTGGCCCACTAACGTGCTGThe start (ATG) and stop (TAA, TGA) codens are underlined,EcoRI, BamHI, HindIII, andKpnI sites are shown in lower case, and nucleotides altered (GFP-PTS1) or appended (DsRED2-PTS1) to create PTS1 (serine-lysine-leucine) are shown in bold. Open table in a new tab The start (ATG) and stop (TAA, TGA) codens are underlined,EcoRI, BamHI, HindIII, andKpnI sites are shown in lower case, and nucleotides altered (GFP-PTS1) or appended (DsRED2-PTS1) to create PTS1 (serine-lysine-leucine) are shown in bold. A DNA fragment encoding full-length M-LP was created by PCR amplification using the primer set exMLPS2 and exMLPA2 and first-strand cDNA synthesized using the total RNAs from the kidneys of 9-month-old mice as the template. The PCR product was cloned into the EcoRI/BamHI sites of pcDNA3.1 (the resulting vector was designated pcDNA3.1/MLP). GFP tagging of the COOH or NH2 terminus of M-LP was done using a PCR gene fusion technique (16Horton R.M. Hunt H.D. Ho S.N. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 61-68Google Scholar) as follows. To produce MLP-GFP (COOH-terminal GFP-tagged M-LP), two separate PCRs to amplify the M-LP and GFP genes were performed: the M-LP gene was amplified using the primer set exMLPS2 and exMG1A2 and first-strand cDNA synthesized using the total RNAs from the kidneys of 9-month-old mice as the template and the GFP gene was amplified using the primer set exMG2S and exGFPA and pEGFP as the template. Then, the two PCR products were mixed with the primer set exMLPS2 and exGFPA and extended by the PCR to form the chimeric gene. Likewise, to produce GFP-MLP (NH2-terminal GFP-tagged M-LP), separate PCRs for GFP and M-LP gene amplification were performed with the two primer sets exGFPS and exGM1A and exGM2S and exMLPA, respectively. Then, the two PCR products were mixed with the primer set exGFPS and exMLPA, extended by the PCR and each PCR-amplified chimeric gene was cloned into theEcoRI/BamHI site of pcDNA3.1 (the resulting vectors were designated pcDNA3.1/MLP-GFP and pcDNA3.1/GFP-MLP, respectively). NH2-terminal truncated Δ15MLP-GFP (NH2-terminal amino acids 1–15 are deleted from M-LP), Δ34MLP-GFP (NH2-terminal amino acids 1–34 are deleted), and Δ91MLP-GFP (NH2-terminal amino acids 1–91 are deleted) were generated by the PCR using the primer pair sets 16MGS and exGFPA, 35MGS and exGFPA, or 92MGS and exGFPA, respectively, and pcDNA3.1/MLP-GFP as the template. The PCR products were cloned into the EcoRI/BamHI site of pcDNA3.1. COOH-terminal truncation variants 34MLP-GFP (comprising NH2-terminal amino acids 1–34), 55MLP-GFP (comprising NH2-terminal amino acids 1–55), 91MLP-GFP (comprising NH2-terminal amino acids 1–91), and an NH2- and COOH-terminal truncation variant 16/55MLP-GFP (comprising amino acids 16–55) were generated as follows. The GFP gene was PCR-amplified using the primer set exGFPS and exGFPA and pEGFP as the template and the PCR product was cloned into the EcoRI/BamHI sites of pcDNA3.1 (the resulting vector was designated pcDNA3.1/GFP). DNA fragments encoding amino acids 1–34, 1–55, 1–91, and 16–55 of M-LP were PCR amplified using the primer sets 91MS and 34MA, 91MS and 55MA, 91MS and 91MA, or 15DMS and 55MA, respectively, and pcDNA3.1/GFP-MLP as the template. The PCR products were cloned into the KpnI/HindIII sites of pcDNA3.1/GFP, which contained the coding sequence of GFP behind the KpnI/HindIII site. COS-7 cells were maintained in Dulbecco's modified Eagle's medium containing 1 mml-glutamine, 50 units/ml penicillin, 50 μg/ml streptomycin, and 10% (v/v) fetal calf serum (Invitrogen) and transiently transfected using LipofectAMINE Plus reagent (Invitrogen), according to the manufacturer's instructions. Cells were plated in 3.5-cm poly-d-lysine-coated glass-bottomed dishes (MatTek, Ashland, MA) and 24 h after transfection, fluorescent images were analyzed by a laser scanning confocal microscope LSM-GB200 (Olympus, Tokyo, Japan). An argon laser at 488 nm was used for excitation and the fluorescent signals emitted by GFP and DsRED2 were detected using a 535-nm band-pass filter and a 570-nm long pass filter, respectively. The cDNA encoding NH2-terminal amino acids 1–103 or COOH-terminal amino acids 105–194 of M-LP were cloned in-frame with glutathioneS-transferase into the pGEX-6P-1 vector (AmershamBiosciences, Tokyo, Japan), introduced into Escherichia coliINVαF′ (Invitrogen), and induced using standard procedures. The glutathione S-transferase fusion proteins were solubilized from inclusion bodies using 8 m urea and affinity purified using glutathione-Sepharose-4B (Amersham Biosciences). For antibody production, the glutathione S-transferase fusion proteins were emulsified with adjuvant (TiterMax Gold; CytRx, Atlanta, GA), injected intramuscularly into Japanese white rabbits three times and the immunoglobulin G fractions were purified using a protein A column (Hitrap Protein A; Amersham Biosciences). The activities of enzymes involved in ROS metabolism in COS-7 cells transfected with pcDNA3.1/MLP and pcDNA3.1 as a control were determined. Three days after transfection, culture media and cell lysates were recovered and their enzymatic activities were determined. The cell lysates used for the measurement of SOD and Gpx activities were prepared by mixing them with 250 mm Tris-HCl (pH 7.5) containing 500 μm phenylmethylsulfonyl fluoride and 1 μg/ml aprotinin and subjecting them to three freeze-thaw cycles, after which the SOD and Gpx activities were assayed using a SOD assay kit-WST (Dojin Molecular Technologies, Kumamoto, Japan) and a glutathione peroxidase assay kit (Cayman, Ann Arbor, MI), respectively. To investigate the effects of the anti-M-LP antibody on the SOD activities, cell lysates were incubated with antibody serially diluted with 25 mmTris-HCl (pH 7.4) containing 8% (w/v) sodium chloride and 0.2% (w/v) potassium chloride at 37 °C for 1 h and the remaining activities were measured. Cell lysates were prepared for the measurement of catalase (CAT) activity as follows. The cells were washed with phosphate-buffered saline (pH 7.4), suspended in phosphate-buffered saline containing 5 mm EDTA, 0.01% (w/v) digitonin, and 0.25% (w/v) sodium cholate and sonicated 30 s for times the was The sonicated was at for 30 at °C to cell and the catalase activity of the was using a kit Protein were using a assay kit The shown are between were using and those were from mouse kidneys was prepared as in (1Iida R. Yasuda T. Aoyama M. Tsubota E. Matsuki T. Kishi K. Mech. Ageing Dev. 2000; 113: 135-144Google Scholar) and total was from COS-7 cells using Japan), according to the manufacturer's instructions. The mRNA were by real-time PCR analysis with a Molecular using the Green PCR kit CA) as R. Yasuda T. Tsubota E. H. M. Matsuki T. Kishi K. Scholar). The primer and product for each gene are in Table The amount of mRNA was to the All PCR were performed in and the was for real-time PCR Open table in a new tab A peroxisomal localization of M-LP was in of the significant homology with the amino (30.4% identity, 66.7% similarity) and of the peroxisomal membrane protein analysis of GFP-tagged M-LP and a peroxisomal protein was the of DsRED2-PTS1 as a peroxisomal was signals were observed in cells DsRED2-PTS1 and with the signals because of which has been used as a peroxisomal in studies Keller G.A. S.J. B. J.M. Gould S.J. EMBO J. 1996; 15: Scholar, T. Subramani S. J. Cell Biol. 1997; Scholar), whereas cytosolic was observed in control cells These results that as well as is an for peroxisomal protein. cells were with DsRED2-PTS1 and MLP-GFP or GFP-MLP and their intracellular were examined 1 green because of MLP-GFP was observed in cells and was on the red because of DsRED2-PTS1, that M-LP was to GFP-MLP was detected in and the These results be as that the mPTS the NH2-terminal and the between the mPTS and its receptor(s) was by tagging GFP the NH2 terminus of To the mPTS of M-LP we several NH2- and COOH-terminal deletion as shown in and examined their intracellular localizations 1 the topology of M-LP from its three and have been R. Yasuda T. Tsubota E. Matsuki T. Kishi K. Biochem. Biophys. Res. Commun. 2001; 283: 292-296Google Scholar). the the NH2-terminal of the first amino acids, was to as revealed by its with the signals from cells which the NH2-terminal and to several signals were In the of which the NH2-terminal and the loop between and cytosolic was in the of mutants truncated at the COOH-terminal region, 91MLP-GFP 1–91, which the NH2-terminal and the loop between and and 55MLP-GFP 1–55, which the NH2-terminal and half of the loop between and were in whereas 34MLP-GFP 1–34, which the NH2-terminal and was in These results that and the NH2-terminal half of the loop between and are for the peroxisomal localization of To confirm this which and the NH2-terminal half of the loop between and was and its intracellular localization was shown in 1 the signals were in that and the NH2-terminal half of the loop between and are sufficient to function as an a of peroxisomal matrix protein import has been of peroxisomal membrane proteins are and into peroxisomal is The involved in targeting or of peroxisomal membrane proteins are as T. Veenhuis M. Subramani S. J. Biol. Chem. 1996; Scholar) and S. A. 1998; Scholar) R.J. A.M. van Veenhuis M. J. Biol. Chem. 2000; Scholar) positively charged amino acids at the NH2-terminal were shown to be involved in targeting or in the COOH-terminal was for targeting Y. Kwast L. van den Berg M. Distel B. Subramani S. Tabak H.F. EMBO J. 1997; in an that to the was necessary for targeting and T. Y. T. T. T. J. Biol. Chem. 1996; in S. an a matrix and an were sufficient for targeting J.M. J. Biol. Chem. 2001; in the loop between and and three transmembrane segments were for targeting and M. Y. J. Biol. Chem. 2001; and in the NH2-terminal and than were for targeting and B. R. A. W. Just W.W. 2000; Scholar). the amino of M-LP and PMP22 are similar (25.0% identity, 72.1% those in the NH2-terminal are and the mPTS identified in PMP22 was found in and M. Y. J. Biol. Chem. 2001; Scholar) out that conclusive consensus sequence been but the to of these proteins was the of positively charged amino acids in the of a this of M-LP has two of positively charged amino acids in the loop between and (the first at amino and the at and results that the of the NH2-terminal half of the loop containing the first and were sufficient for M-LP to function as an it be that M-LP the these The high sequence and membrane of M-LP and Mpv17 have to that M-LP, as well as as an ROS we the activities of enzymes involved in ROS metabolism in COS-7 cells transfected with pcDNA3.1/MLP and pcDNA3.1 as a shown in Table there was significant between the Gpx or activities of these the SOD activity of the cell lysates prepared from COS-7 cells transfected with M-LP was than that of the control The following two mechanisms be for the of SOD of SOD at the protein level and an increase in the amount of SOD enzyme in of that with an anti-M-LP antibody the SOD activity it that the SOD activity is by an with M-LP at the protein activities in COS-7 cells transfected with pcDNA3.1 and Open table in a new tab Three SOD a SOD a manganese SOD and an SOD have been detected in mammalian cells B. R. A. W. Just W.W. 2000; Scholar). The mRNA of these three Gpx and in COS-7 cells transfected with M-LP were examined using real-time Whereas the expression of genes and were an increase in mRNA with the control cell level was that the increase in SOD activity in the M-LP cells was mainly to of the gene. Recently, (15Wagner G. Stettmaier K. Bors W. Sies H. Wagner E.M. Reuter A. Weiher H. Biol. Chem. 2001; 382: 1019-1025Google Scholar) performed the of the activities and mRNA of antioxidant enzymes in Mpv17 null and found that the of the Mpv17 protein expression of three SOD and and increased γ-glutamyl transpeptidase M-LP to have the function as the Mpv17 protein from the of that its to a in ROS In study, we used and showed that M-LP gene expression R. Yasuda T. Tsubota E. Matsuki T. Kishi K. Biochem. Biophys. Res. Commun. 2001; 283: 292-296Google Scholar). that M-LP expression of the gene in the expression of the gene during development and aging. the of M-LP and in the kidneys of to mice were using real-time shown in the amount of M-LP expressed increased steadily during development, its highest in and gradually with aging. well with results R. Yasuda T. Tsubota E. Matsuki T. Kishi K. Biochem. Biophys. Res. Commun. 2001; 283: 292-296Google Scholar). the expression of the gene was similar to that of M-LP that M-LP participates in the of gene in activity or its gene expression have been in several mammalian the expression on species For activity was observed to be lower in cell from fetal than those from were observed R. J. J. Cell. Physiol. 1995; Scholar). activities than whereas there was significant in the activities of the C. A. E. Res. 1996; Scholar). In study, we showed that the M-LP gene is expressed mainly in the kidney and The expression in be to the of a M-LP in the of ROS are generated during oxidative metabolism and damage by with proteins, and SOD is to be of the important of the first line of defense ROS production by of its to reactive superoxide to and molecular demonstrated that, of the three the gene was by the expression of The of has been shown in studies on mice Y. S. C. C.J. 1995; Scholar, R.M. H. H. J. L. S. S. A. 1996; mice than after because of of function because of the level of ROS S. 1998; Scholar). of the in the of several including protein, and an G. H. J.M. Gene (Amst.). 1995; Scholar). the antioxidant is induced by as Scholar), A. Y. E. K. J. Scholar), and M. M. Y. S. G. J. Biol. Chem. 1995; Scholar) that are to produce ROS or intracellular ROS The for the of these has yet to be elucidated, it has been that and expression by the Y. Am. J. Physiol. 1995; Scholar, K. T. J. Cell. Biochem. 2000; 77: Scholar). Thus, is to the between M-LP and these and the of M-LP in ROS metabolism. F. for S. and K. for