Regulation of Cholesterologenesis by the Oxysterol Receptor, LXRα

Abstract

Cholesterol is required for normal cellular and physiological function, yet dysregulation of cholesterol metabolism is associated with diseases such as atherosclerosis. Cholesterol biosynthesis is regulated by end product negative feedback inhibition where the levels of sterols and oxysterols regulate the expression of cholesterologenic enzymes. Sterol regulatory element-binding protein-2 is responsive to both sterols and oxysterols and has been shown to mediate the transcriptional response of the cholesterologenic enzymes to these lipids. Here, we show that the nuclear hormone receptor for oxysterols, the liver X receptor α (LXRα), regulates cholesterol biosynthesis by directly silencing the expression of two key cholesterologenic enzymes (lanosterol 14α-demethylase (CYP51A1), and squalene synthase (farnesyl diphosphate farnesyl transferase 1)) via novel negative LXR DNA response elements (nLXREs) located in each of these genes. Examination of the CYP51A1 gene revealed that both the SRE and nLXRE are required for normal oxysterol-dependent repression of this gene. Thus, these data suggest that LXRα plays an important role in the regulation of cholesterol biosynthesis. Cholesterol is required for normal cellular and physiological function, yet dysregulation of cholesterol metabolism is associated with diseases such as atherosclerosis. Cholesterol biosynthesis is regulated by end product negative feedback inhibition where the levels of sterols and oxysterols regulate the expression of cholesterologenic enzymes. Sterol regulatory element-binding protein-2 is responsive to both sterols and oxysterols and has been shown to mediate the transcriptional response of the cholesterologenic enzymes to these lipids. Here, we show that the nuclear hormone receptor for oxysterols, the liver X receptor α (LXRα), regulates cholesterol biosynthesis by directly silencing the expression of two key cholesterologenic enzymes (lanosterol 14α-demethylase (CYP51A1), and squalene synthase (farnesyl diphosphate farnesyl transferase 1)) via novel negative LXR DNA response elements (nLXREs) located in each of these genes. Examination of the CYP51A1 gene revealed that both the SRE and nLXRE are required for normal oxysterol-dependent repression of this gene. Thus, these data suggest that LXRα plays an important role in the regulation of cholesterol biosynthesis. Cholesterol is essential for maintenance of cellular membrane fluidity and is a precursor for the production of steroid hormones and bile acids. Although cholesterol is required for normal cellular and physiological function, dysregulation of cholesterol metabolism is associated with atherosclerosis and increased risk of heart disease (1Maxfield F.R. Tabas I. Nature. 2005; 438: 612-621Crossref PubMed Scopus (969) Google Scholar). Thus, cholesterol metabolism is under strict biological regulation, and drugs inhibiting cholesterol biosynthesis such as the statins, inhibitors of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR) 2The abbreviations used are: HMGCR3-hydroxy-3-methylglutaryl-coenzyme A reductaseSREsterol regulatory elementSREBPSRE-binding proteinFDFTfarnesyl diphosphate farnesyl transferaseEMSAelectrophoretic mobility shift assaysiRNAsmall interfering RNAChIPchromatin immunoprecipitationPARpromising active regionLXRELXR DNA response elementnLXREnegative LXREOHCoxysterol. 2The abbreviations used are: HMGCR3-hydroxy-3-methylglutaryl-coenzyme A reductaseSREsterol regulatory elementSREBPSRE-binding proteinFDFTfarnesyl diphosphate farnesyl transferaseEMSAelectrophoretic mobility shift assaysiRNAsmall interfering RNAChIPchromatin immunoprecipitationPARpromising active regionLXRELXR DNA response elementnLXREnegative LXREOHCoxysterol. (see Fig. 1a), have been successfully utilized clinically to reduce the risk of atherosclerosis. The biosynthesis of cholesterol has long been known to be regulated by end product feedback inhibition, and this regulation has been attributed to direct regulation of the expression of several cholesterol biosynthetic genes by the sterol sensing sterol regulatory element-binding protein-2 (SREBP-2) (2Goldstein J.L. DeBose-Boyd R.A. Brown M.S. Cell. 2006; 124: 35-46Abstract Full Text Full Text PDF PubMed Scopus (1230) Google Scholar). The SREBPs are responsive to both alterations in cholesterol levels as well as oxidized cholesterol metabolites known as oxysterols (3Horton J.D. Goldstein J.L. Brown M.S. J. Clin. Investig. 2002; 109: 1125-1131Crossref PubMed Scopus (3757) Google Scholar). 3-hydroxy-3-methylglutaryl-coenzyme A reductase sterol regulatory element SRE-binding protein farnesyl diphosphate farnesyl transferase electrophoretic mobility shift assay small interfering RNA chromatin immunoprecipitation promising active region LXR DNA response element negative LXRE oxysterol. 3-hydroxy-3-methylglutaryl-coenzyme A reductase sterol regulatory element SRE-binding protein farnesyl diphosphate farnesyl transferase electrophoretic mobility shift assay small interfering RNA chromatin immunoprecipitation promising active region LXR DNA response element negative LXRE oxysterol. The nuclear hormone receptors LXRα (NR1H3) and LXRβ (NR1H2) have been demonstrated to be physiological receptors for oxysterols (4Janowski B.A. Willy P.J. Devi T.R. Falck J.R. Mangelsdorf D.J. Nature. 1996; 383: 728-731Crossref PubMed Scopus (1458) Google Scholar, 5Lehmann J.M. Kliewer S.A. Moore L.B. SmithOliver T.A. Oliver B.B. Su J.L. Sundseth S.S. Winegar D.A. Blanchard D.E. Spencer T.A. Willson T.M. J. Biol. Chem. 1997; 272: 3137-3140Abstract Full Text Full Text PDF PubMed Scopus (1037) Google Scholar, 6Chen W.L. Chen G.X. Head D.L. Mangelsdorf D.J. Russell D.W. Cell Metab. 2007; 5: 73-79Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar) and regulate components of the cholesterol metabolic pathway including reverse cholesterol transport and cholesterol elimination (7Zelcer N. Tontonoz P. J. Clin. Investig. 2006; 116: 607-614Crossref PubMed Scopus (766) Google Scholar). No role for the LXRs in direct regulation of cholesterol biosynthesis has been described. A recent study by Wong et al. (8Wong J. Quinn C.M. Gelissen I.C. Brown A.J. J. Biol. Chem. 2008; 283: 700-707Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar) suggested that 24,25-epoxycholesterol was important for “fine-tuning” acute control of cellular cholesterol biosynthesis. Because this endogenous oxysterol is known to be one of the more potent natural oxysterol ligands for the LXRs, it is possible that some of its activity may be mediated by these receptors. Here, we show that two key cholesterologenic enzyme genes are LXR target genes and that LXR plays a role in the regulation of cholesterol biosynthesis. Plasmid Construction—The CYP51A1 promoter (–2217 to +155) was amplified from genomic DNA isolated from HepG2 cells and cloned into pTAL-Luc luciferase report vector (Clontech, CA) by introducing KpnI and BglII into the primers. The proximal portion (–2217 to –1749) containing LXRE and the distal portion (–1749 to +155) containing the SRE of the promoter were amplified from the CYP51A1 promoter vector and cloned into pTAL-Luc vector using the same restriction sites. Three copies of CYP51A1 LXRE, FDFT1 LXRE, and NR1H3 LXRE were cloned into pTAL-Luc through MluI and BglII. LXRα and RXRα were cloned into pDEST14 (Invitrogen) using Gateway® technology (Invitrogen) for EMSA analysis. LXRα and LXRβ were cloned into pcDNA3.1 vector for overexpression analysis. The LXRE mutant CYP51A1 promoter reporter was created using QuikChange® II site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. Cell Culture and Cotransfections—HepG2 cells were maintained and routinely propagated in minimum essential medium supplemented with 10% fetal bovine serum at 37 °C under 5% CO2. HEK293 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum at 37 °C under 5% CO2. In experiments where lipids and sterols were depleted, cells were maintained on charcoal treated serum (10% fetal bovine serum) and treated with 7.5 μm lovastatin and 100 μm mevalonic acid. 24 h prior to transfection, HepG2 or HEK293 cells were plated in 96-well plates at a density of 15 × 103 cells/well. Each transfection contained 100 ng of the pTAL-Luc reporter, 50 ng of pGL4.73 reporter, and 50 ng of receptor (as indicated) as described in the figure legend using Lipofectamine™ 2000 (Invitrogen). 16 h post-transfection, the cells were treated with LXR ligands. 24 h post-treatment, the luciferase activity was measured using the Dual-Glo™ luciferase assay system (Promega). The values indicated represent the means ± S.E. from three independently transfected wells. The experiments were repeated at least three times, and representative experiments are shown. mRNA and Protein Measurement—cDNA synthesized from mRNA was quantified by quantitative PCR analysis using SYBR green technology. The primers for quantitative PCR are: CYP51A1, CAGAACTCCTCAGACTGTGG (forward) and GTCTTTGATTGACAGTGGGA (reverse).; FDFT1, CCGTGACTATCTGGAAGAC (forward) and CATACCTGCTCCAAACCTC (reverse); LXRα, GGAGGTACAACCCTGGGAGT (forward) and AGCAATGAGCAAGGCAAACT (reverse). CYP51A1, FDFT1 HMG-CoA, and LXRα protein levels were assessed by Western blot using antibodies from Abnova (Taiwan). LXRα and control siRNA was obtained from Ambion (Austin, TX). The transfection was performed using siPORT™ NeoFX SiRNA transfection reagents in accordance with the manufacturer's instructions. Cholesterol Quantification and Biosynthesis Measurement—Cholesterol quantification was performed using a cholesterol/cholesterol ester quantification kit (BioVision). The cholesterol level was normalized to protein content. Cholesterol de novo biosynthesis was measured by TLC. HepG2 cells were treated with siRNA for 45 h, and the media were replaced with growth media supplemented with 1 μCi/ml of 14C sodium acetate (Amersham Biosciences). After 3 h of incubation at 37 °C under 5% CO2, total lipid was extracted and dissolved in chloroform:methanol (2:1). TLC was performed in heptane:isopropylether:acetic acid (160 ml/40 ml/2 ml) for 1 h. The TLC plate was scanned using Bioscan AR2000 Imaging Scanner (Bioscan, Washington, D. C.). The number of counts/min was normalized to protein content. ChIP-on-chip—ChIP-on-chip procedures were performed as previously described (9Stayrook K.R. Rogers P.M. Savkur R.S. Wang Y. Su C. Varga G. Bu X. Wei T. Nagpal S. Liu X.S. Burris T.P. Mol. Pharmacol. 2008; 73: 607-612Crossref PubMed Scopus (22) Google Scholar). Microarray—Microarray identification of genes altered by knock-down of LXR expression in mice was previously described (10Hu T.H. Foxworthy P. Siesky A. Ficorilli J.V. Gao H. Li S.Y. Christe M. Ryan T. Cao G.Q. Eacho P. Michael M.D. Michael L.F. Endocrinology. 2005; 146: 5380-5387Crossref PubMed Scopus (39) Google Scholar). Electrophoretic Mobility Shift Assays—LXRα and RXRα were expressed using TnT® quick coupled transcription/translation systems (Promega). EMSAs were performed using the [α-33P]dATP-labeled CYP51A1 and FDFT1 LXRE oligonucleotide. Competition assays were performed using various amounts of the unlabeled CYP51A1, FDFT1, ABCA1, and mutant CYP51A1 oligonucleotide as previously described (5×, 25×, and 100× molar excess) (11Burris T.P. Guo W.W. Le T. McCabe E.R.B. Biochem. Biophys. Res. Commun. 1995; 214: 576-581Crossref PubMed Scopus (94) Google Scholar). HMG-CoA Reductase Enzyme Assay—HMG-CoA reductase activity was measured by spectrophotometric assay as described by Takahashi et al. (12Takahashi S. Kuzuyama T. Seto H. J. Bacteriol. 1999; 181: 1256-1263Crossref PubMed Google Scholar). The reaction buffer consisted of 25 mm potassium phosphate (pH 7.2), 50 mm KCl, 1 mm EDTA, and 5 mm dithiothreitol. Control and siRNA-treated HepG2 cells were cultivated in 6-well plates. After treatment, the cells were harvested in 100 μl of reaction buffer/well. The assay was performed in reaction buffer with 0.3 mm NADPH, 0.3 mm R,S-HMG-CoA and 2 μl protein in a final volume of 200 μl. The kinetics program in the Benchmark Plus™ microplate spectrophotometer was used, and the reaction was monitored every 20 s for up to 10 min at 37 °C. One unit of HMG-CoA reductase activity is defined as the amount of the enzyme that caused oxidation of 1 μmol of NADPH/min at 37 °C. Identification of Novel LXRα Target Genes—To identify novel biochemical pathways regulated by LXRα, we performed LXRα chromatin immunoprecipitation followed by whole genome analysis of the enriched DNA fragments by microarray experiment (ChIP-on-chip) (9Stayrook K.R. Rogers P.M. Savkur R.S. Wang Y. Su C. Varga G. Bu X. Wei T. Nagpal S. Liu X.S. Burris T.P. Mol. Pharmacol. 2008; 73: 607-612Crossref PubMed Scopus (22) Google Scholar). Regions of the genome with significant LXRα occupancy (termed promising active regions (PARs)) were screened for putative LXREs using a previously described algorithm (13Varga G. Su C. BioDrugs. 2007; 21: 117-124Crossref PubMed Scopus (11) Google Scholar, 14Sandelin A. Wasserman W.W. Mol. Endocrinol. 2005; 19: 595-606Crossref PubMed Scopus (115) Google Scholar). PARs were then queried against the human genome data base, and 1304 unique genes were identified with a PAR within 1 kb of a gene. We then compared these data with microarray data obtained from the livers of mice treated with a LXR-directed antisense oligonucleotide that significantly reduced LXRα expression (10Hu T.H. Foxworthy P. Siesky A. Ficorilli J.V. Gao H. Li S.Y. Christe M. Ryan T. Cao G.Q. Eacho P. Michael M.D. Michael L.F. Endocrinology. 2005; 146: 5380-5387Crossref PubMed Scopus (39) Google Scholar). This allowed us to identify genes that were significantly altered by LXRα knock-down that also demonstrated LXRα occupancy and contained a defined LXRE. Fifty-seven genes were identified as having met these criteria and included the well characterized LXR target genes ABCA1 and NR1H3, indicating that the method was successful. of the putative target it was that were of genes expression was increased in response to a in LXRα that LXRα may a direct role in regulation of these genes. We this and novel that LXR has been previously characterized as a direct of gene two of the regulated genes key enzymes within the cholesterol biosynthesis The two genes identified were squalene synthase and 14α-demethylase (CYP51A1), and within the cholesterologenic pathway are in Fig. have regions of significant LXRα as by in the region or in the region of the genes the putative role of LXRα in regulation of we LXRα expression in the human by protein using siRNA (9Stayrook K.R. Rogers P.M. Savkur R.S. Wang Y. Su C. Varga G. Bu X. Wei T. Nagpal S. Liu X.S. Burris T.P. Mol. Pharmacol. 2008; 73: 607-612Crossref PubMed Scopus (22) Google Scholar). in Fig. LXRα expression to a significant in expression of both identified genes. CYP51A1 and FDFT1 expression increased by and Protein levels of CYP51A1 and FDFT1 were also LXRα knock-down and as in Fig. CYP51A1 expression increased and FDFT1 increased data suggest that the of LXRα on the expression of these genes is negative of a significant amount of LXRα in increased expression of these genes. of Enzyme by FDFT1 and CYP51A1 enzymes that are essential for FDFT1 the enzyme squalene synthase that the production of squalene from farnesyl and is the in sterol of this enzyme have been shown to be inhibitors of cholesterol D. D.J. J. Pharmacol. 1997; Google Scholar, T. H. H. T. M. S. Y. H. J. Pharmacol. PubMed Scopus Google Scholar). CYP51A1 of the from the cholesterol Mol. Cell. Endocrinol. PubMed Scopus Google Scholar) of CYP51A1 activity by in in a in total serum cholesterol and a in serum density the of this enzyme in the cholesterol biosynthesis pathway T.A. J. Res. Full Text PDF PubMed Google Scholar). of CYP51A1 activity in of in T.A. J. Res. Full Text PDF PubMed Google and has been suggested to regulate DeBose-Boyd R.A. Cell Metab. 2005; Full Text Full Text PDF PubMed Scopus Google Scholar). A more recent study indicated that and is for regulation of Y. J. J. Biol. Chem. 2008; 283: Full Text Full Text PDF PubMed Scopus Google Scholar). Because CYP51A1 both and as a Mol. Cell. Endocrinol. PubMed Scopus Google regulation of CYP51A1 activity has on the levels of both of these sterols T.A. J. Res. Full Text PDF PubMed Google and in it that inhibition of CYP51A1 activity has a on the level of to T.A. J. Res. Full Text PDF PubMed Google Scholar). Thus, we that LXRα may regulate expression via of levels by its direct to CYP51A1 we that of LXRα expression in a in expression and a in activity Thus, LXRα regulates the expression of three key enzymes in the cholesterol biosynthesis LXRα for of on these we that LXRα knock-down in increased cholesterol in HepG2 Fig. that this is the LXRα expression is by cholesterol levels We also de novo in this and a in cholesterol biosynthesis in cells data are with a where LXRα regulates the expression of CYP51A1 and FDFT1 and the of in of cholesterol biosynthesis. Identification of LXR DNA CYP51A1 and FDFT1 were identified on LXRα occupancy in analysis in to the for a putative LXRE within the occupancy these data that these may be the of LXREs in the of the PARs from CYP51A1 and FDFT1 by the LXRα study revealed putative We performed EMSAs on putative LXREs and identified two LXREs in each that to the The novel LXREs to well characterized LXREs identified in the ABCA1 and NR1H3 genes One is a is a unique No LXREs with a have been previously RXRα was required for LXRα to both novel LXREs the of these novel we cloned three copies of each of a reporter and in the and of or or natural LXR ligands in HepG2 The LXRE and CYP51A1 and FDFT1 LXREs both with The NR1H3 LXRE increased by the two LXREs by The of ligands on from a reporter a LXRE In cells transfected with the LXRE, a in was with with of the two ligands LXREs from the CYP51A1 and FDFT1 to the LXR ligands and and novel was that the nLXRE from each of the both cholesterologenic enzyme genes oxysterol-dependent repression of to the reporter and We these LXREs LXREs (nLXREs) on to negative to of these were responsive to oxysterols that are known of LXR such as and were to well characterized such as This with of to LXR that these novel may to the from the CYP51A1 and FDFT1 genes oxysterol-dependent repression to a reporter gene in HepG2 the from both the CYP51A1 and FDFT1 genes mediate repression of cloned of a promoter luciferase reporter, the LXRE of in transfected HepG2 of various LXR ligands on a luciferase reporter three copies of the NR1H3 LXRE of a promoter transfected in to HepG2 of various LXR ligands on a luciferase reporter three copies of the CYP51A1 LXRE of a promoter transfected in to HepG2 of various LXR ligands on a luciferase reporter three copies of the FDFT1 LXRE of a promoter transfected in to HepG2 of the experiments within this figure utilized lipid media as described under LXR ligands and were at 1 and the oxysterols were at 10 in were at control as by We also the activity of these three LXRE containing reporter in HEK293 HepG2 HEK293 cells also and the LXR of reporter genes be by overexpression of LXR T. T. H. N. M. T. S. T. H. Y. M. Takahashi A. H. J. S. N. Mol. Endocrinol. PubMed Scopus Google Scholar). We transfected the into HEK293 cells in the or of a vector the overexpression of LXRα or in Fig. the reporter containing the LXREs from the NR1H3 gene and overexpression of LXR in of with data from the HepG2 transfection of the cells with the containing the from the CYP51A1 or FDFT1 genes to that was overexpression of LXRα or We the of LXR ligands to the transcriptional activity of LXRα transfected into HEK293 cells with the nLXRE from the CYP51A1 or FDFT1 genes. The were to obtained in HepG2 cells in that the oxysterols that in HepG2 cells also in HEK293 cells and data are with that the mediate repression of the nLXRE and the SRE for of CYP51A1 the CYP51A1 promoter a SRE that is also responsive to oxysterols via we assessed the of repression by LXRα expression with siRNA and the in HepG2 cells in lipid and of LXRα in a significant of the of that a significant of the is mediated by this receptor on that plays an important role in CYP51A1 expression M. D. Mol. Endocrinol. 2002; PubMed Scopus Google Scholar) as well as data indicating that LXRα also is we that both the nLXRE and the SRE a role in oxysterol of the gene. we a CYP51A1 promoter reporter by CYP51A1 promoter of a luciferase reporter and as shown in Fig. this was transfected into HepG2 is to the control with in repression to Fig. We CYP51A1 in we the nLXRE or the SRE as in Fig. of the nLXRE in an in a of this element with we have in systems such as and by this CYP51A1 promoter containing the to the same level as that both the nLXRE and the SRE elements were of the SRE in expression to control and the of repression is the nLXRE is We the role of the nLXRE more by a mutant LXRE CYP51A1 promoter where the LXRE is to to We that the mutant LXRE is to to LXRα in an EMSA the promoter and the LXRE mutant promoter were transfected into HepG2 and the of to was in Fig. of the LXRE within the CYP51A1 promoter in significant of the of the oxysterol to Thus, these data that both the nLXRE and SRE a role in the oxysterol of of this gene and that the nLXRE also has a on of this gene. the role of LXRα in the regulation of cholesterol transport and this nuclear receptor also plays an important role in end product inhibition of cholesterol biosynthesis is to that the two enzymes expression is directly by LXRα are in of where the pathway has to sterol This is in to regulates the expression of enzymes the data suggest that LXRα in with to regulate the expression of CYP51A1 in response to has been shown to be an important for acute control of cellular cholesterol (8Wong J. Quinn C.M. Gelissen I.C. Brown A.J. J. Biol. Chem. 2008; 283: 700-707Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Because this endogenous oxysterol is one of the more potent natural ligands of it is possible that at least some of the activity of 24,25-epoxycholesterol described by these may be mediated via the we have described. of the genes directly regulated by LXR described to are under regulation by LXR (7Zelcer N. Tontonoz P. J. Clin. Investig. 2006; 116: 607-614Crossref PubMed Scopus (766) Google Scholar) to the NR1H3 indicating that the of regulation of CYP51A1 and FDFT1 is transcriptional repression by LXR has been previously G. M. R.A. Mol. Cell Biol. PubMed Scopus Google in this the of an LXR in of repression as we have for the CYP51A1 LXRE. A recent study that LXRα may expression via a that with within the H. Y. N. J. Mangelsdorf D.J. S. Mol. Cell Biol. 2008; PubMed Scopus Google Scholar). LXR has also been shown to the protein it is this is mediated by an LXRE Y. A. Tontonoz P. Res. 2006; PubMed Scopus Google Scholar). LXR has been demonstrated to a number of genes in the response a that has been attributed to of the pathway A. B.A. Mangelsdorf D.J. Tontonoz P. PubMed Scopus Google Scholar). Thus, the CYP51A1 and FDFT1 LXREs represent a novel of LXRE that negative to LXR and the nLXRE is responsive to of LXR ligands The for the is it has been suggested that oxysterol to LXR in of the receptor M. T. I. C. M. J. Biol. Chem. 2006; Full Text Full Text PDF PubMed Scopus Google Scholar). Although data suggest that these are mediated via direct of the ligands to LXR we on LXR to the it is possible that of these oxysterols may also be a role oxysterol-dependent of the to be are genes that a Because LXR is a putative target for the of L.F. J.M. Burris T.P. Chem. 2005; 5: PubMed Scopus (39) Google the activity of LXR ligands on nLXRE containing genes such as CYP51A1 and FDFT1 be also suggest putative of LXR as inhibitors of cholesterol biosynthesis. data a for oxysterol regulation of cholesterol biosynthesis in cholesterologenic enzyme expression in response to oxysterol LXRα to oxysterol levels to the expression of key cholesterologenic enzymes This of regulation of may for and control of cholesterol production where its levels by to cellular also