Mediator Influences Schizosaccharomyces pombe RNA Polymerase II-dependent Transcription in Vitro

Abstract

The fission yeast Schizosaccharomyces pombe has proved an important model system for cross-species comparative studies of many fundamental processes in the eukaryotic cell, such as cell cycle control and DNA replication. The RNA polymerase II transcription machinery is, however, still relatively poorly understood in S. pombe, partially due to the absence of a reconstituted in vitro transcription system. We have now purified S. pombe RNA polymerase II and its general initiation factors TFIIB, TFIIF, TFIIE, and TFIIH to near homogeneity. These factors enable RNA polymerase II to initiate transcription from the S. pombe alcohol dehydrogenase promoter (adh1p) when combined with Saccharomyces cerevisiae TATA-binding protein. We use our reconstituted system to examine effects of Mediator on basal transcription in vitro. S. pombe Mediator exists in two distinct forms, a free form, which contains the spSrb8, spTrap240, spSrb10, and spSrb11 subunits, and a smaller form, which lacks these four subunits and associates with RNA polymerase II to form a holoenzyme. We find that spSrb8/spTrap240/spSrb10/spSrb11 containing Mediator repress basal transcription, whereas Mediator lacking these subunits has a stimulatory effect on transcription. Our findings thus demonstrate that the spSrb8/spTrap240/spSrb10/spSrb11 subcomplex governs the ability of Mediator to stimulate or repress basal transcription in vitro. The fission yeast Schizosaccharomyces pombe has proved an important model system for cross-species comparative studies of many fundamental processes in the eukaryotic cell, such as cell cycle control and DNA replication. The RNA polymerase II transcription machinery is, however, still relatively poorly understood in S. pombe, partially due to the absence of a reconstituted in vitro transcription system. We have now purified S. pombe RNA polymerase II and its general initiation factors TFIIB, TFIIF, TFIIE, and TFIIH to near homogeneity. These factors enable RNA polymerase II to initiate transcription from the S. pombe alcohol dehydrogenase promoter (adh1p) when combined with Saccharomyces cerevisiae TATA-binding protein. We use our reconstituted system to examine effects of Mediator on basal transcription in vitro. S. pombe Mediator exists in two distinct forms, a free form, which contains the spSrb8, spTrap240, spSrb10, and spSrb11 subunits, and a smaller form, which lacks these four subunits and associates with RNA polymerase II to form a holoenzyme. We find that spSrb8/spTrap240/spSrb10/spSrb11 containing Mediator repress basal transcription, whereas Mediator lacking these subunits has a stimulatory effect on transcription. Our findings thus demonstrate that the spSrb8/spTrap240/spSrb10/spSrb11 subcomplex governs the ability of Mediator to stimulate or repress basal transcription in vitro. The minimal set of general transcription factors required for basal transcription in vitro include, RNA polymerase II (pol II), 1The abbreviations used are: pol IIRNA polymerase IITBPTATA-binding proteinCTDC-terminal domainDTTdithiothreitolNi2+-NTAnickel-nitrilotriacetic acidMALDI-TOFmatrix-assisted laser desorption ionization time-of-flightTAPtandem affinity purificationTFtranscription factor.1The abbreviations used are: pol IIRNA polymerase IITBPTATA-binding proteinCTDC-terminal domainDTTdithiothreitolNi2+-NTAnickel-nitrilotriacetic acidMALDI-TOFmatrix-assisted laser desorption ionization time-of-flightTAPtandem affinity purificationTFtranscription factor. the TATA-binding protein (TBP), and transcription factors (TFs) IIB, IIE, IIF, and IIH. These factors are both necessary and sufficient for proper initiation of transcription in transcription systems reconstituted from Saccharomyces cerevisiae and mammalian cells (1Woychik N.A. Hampsey M. Cell. 2002; 108: 453-463Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). RNA polymerase II TATA-binding protein C-terminal domain dithiothreitol nickel-nitrilotriacetic acid matrix-assisted laser desorption ionization time-of-flight tandem affinity purification transcription factor. RNA polymerase II TATA-binding protein C-terminal domain dithiothreitol nickel-nitrilotriacetic acid matrix-assisted laser desorption ionization time-of-flight tandem affinity purification transcription factor. The structure and function of Schizosaccharomyces pombe pol II has been investigated in great detail. The enzyme is composed of 12 subunits, Rpb1 to Rpb12, similar to what has been described for the budding yeast S. cerevisiae and mammalian cells (2Sakurai H. Mitsuzawa H. Kimura M. Ishihama A. Mol. Cell. Biol. 1999; 19: 7511-7518Crossref PubMed Scopus (48) Google Scholar, 3Shpakovski G.V. Gadal O. Labarre-Mariotte S. Lebedenko E.N. Miklos I. Sakurai H. Proshkin S.A. Van Mullem V. Ishihama A. Thuriaux P. J. Mol. Biol. 2000; 295: 1119-1127Crossref PubMed Scopus (26) Google Scholar). Biochemical analysis of the enzyme has revealed the presence of several distinct subcomplexes and has proved important in the analysis of the recently published x-ray crystallography structure of S. cerevisiae pol II (4Kimura M. Ishiguro A. Ishihama A. J. Biol. Chem. 1997; 272: 25851-25855Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 5Cramer P. Bushnell D.A. Kornberg R.D. Science. 2001; 292: 1863-1876Crossref PubMed Scopus (961) Google Scholar). Previous characterization of S. pombe TFIIH has only concerned a specific subcomplex of this transcription factor, containing the Mcs6, Mcs2, and Pmh1 gene products (6Hermand D. Westerling T. Pihlak A. Thuret J.Y. Vallenius T. Tiainen M. Vandenhaute J. Cottarel G. Mann C. Makela T.P. EMBO J. 2001; 20: 82-90Crossref PubMed Scopus (27) Google Scholar). These proteins correspond to the cyclin-dependent kinase 7 (Cdk7), cyclin H, and Mat1, in mammalian TFIIH. Cdk7 phosphorylates the C-terminal domain (CTD) of the largest subunit of pol II upon initiation of transcription (7Feaver W.J. Svejstrup J.Q. Henry N.L. Kornberg R.D. Cell. 1994; 79: 1103-1109Abstract Full Text PDF PubMed Scopus (359) Google Scholar, 8Shiekhattar R. Mermelstein F. Fisher R.P. Drapkin R. Dynlacht B. Wessling H.C. Morgan D.O. Reinberg D. Nature. 1995; 374: 283-287Crossref PubMed Scopus (362) Google Scholar, 9Serizawa H. Makela T.P. Conaway J.W. Conaway R.C. Weinberg R.A. Young R.A. Nature. 1995; 374: 280-282Crossref PubMed Scopus (308) Google Scholar). Interestingly, Cdk7 is also the mammalian cdk-activating kinase (Cak): the kinase needed for the activating phosphorylation of other cyclin-dependent kinases (10Fisher R.P. Morgan D.O. Cell. 1994; 78: 713-724Abstract Full Text PDF PubMed Scopus (555) Google Scholar). A similar situation also appears to exist in S. pombe, where the trimeric Mcs6-Mcs2-Pmh1 complex also possesses CAK activity (6Hermand D. Westerling T. Pihlak A. Thuret J.Y. Vallenius T. Tiainen M. Vandenhaute J. Cottarel G. Mann C. Makela T.P. EMBO J. 2001; 20: 82-90Crossref PubMed Scopus (27) Google Scholar). We have reported previously on the purification and characterization of the S. pombe Mediator (11Spahr H. Beve J. Larsson T. Bergstrom J. Karlsson K.A. Gustafsson C.M. J. Biol. Chem. 2000; 275: 1351-1356Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 12Spahr H. Samuelsen C.O. Baraznenok V. Ernest I. Huylebroeck D. Remacle J.E. Samuelsson T. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11985-11990Crossref PubMed Scopus (33) Google Scholar, 13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar). The Mediator complex is essential for basal and regulated expression of nearly all pol II-dependent genes in S. cerevisiae (14Thompson C.M. Young R.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4587-4590Crossref PubMed Scopus (208) Google Scholar), and depletion of human Mediator from nuclear extracts abolishes transcription by pol II (15Mittler G. Kremmer E. Timmers H.T. Meisterernst M. EMBO Rep. 2001; 2: 808-813Crossref PubMed Scopus (103) Google Scholar). The S. pombe Mediator complex exists in at least two specific forms (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar): one smaller core Mediator in complex with pol II and one larger form of Mediator, devoid of pol II, but containing the spSrb8, spTrap240, spSrb10, and spSrb11 proteins. Homologues to these four proteins are found in certain S. cerevisiae and human Mediator preparations and they are collectively referred to as the Srb8-11 module (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar, 16Hengartner C.J. Myer V.E. Liao S.M. Wilson C.J. Koh S.S. Young R.A. Mol. Cell. 1998; 2: 43-53Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar). The SRB11 and SRB10 genes encode cyclin C and the cyclin C-dependent kinase, respectively (17Liao S.M. Zhang J. Jeffery D.A. Koleske A.J. Thompson C.M. Chao D.M. Viljoen M. van Vuuren H.J. Young R.A. Nature. 1995; 374: 193-196Crossref PubMed Scopus (365) Google Scholar), and genetic analysis indicates that the Srb8-11 module is involved in the negative regulation of a small subset of genes during exponential growth (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar, 18Holstege F.C. Jennings E.G. Wyrick J.J. Lee T.I. Hengartner C.J. Green M.R. Golub T.R. Lander E.S. Young R.A. Cell. 1998; 95: 717-728Abstract Full Text Full Text PDF PubMed Scopus (1594) Google Scholar). Why Mediator exists in two different forms and what differential roles these complexes have in transcriptional regulation are still unclear. Genetic Manipulations—The S. pombe strains used in this work are: L972 (h-), Mp12 (h-ade6-M210) and Mp13 (h+ade6-M216), TP33 (h- Δsptrap240::G418R); TP46 (h-ade6-M216 spmed7+::TAP); and TP68 (h+ade6-M216 sptrap240+::TAP). The TAP-Pmh1 strain (h+pmh1::pmh1-TAP kanR ade6-210 ura4-D18 leu1-32 his3-D1) was constructed as described previously (19Tasto J.J. Carnahan R.H. McDonald W.H. Gould K.L. Yeast. 2001; 18: 657-662Crossref PubMed Scopus (128) Google Scholar) with the following oligonucleotides: 5′-GTCATTTGCGATGCTTATATGAGGCTTTTAGTGGCATTGATTACGATTTAGAAAGTCTCAAAAAACTTGAAGTAGCAAGTTCCATGGAAAAGAGAAGATGG-3′ and 5′-GGTAATATACAAAGGCTATGATTTACTAATACAAAGAATAAAGTATACTTACCACAAACGTATATAAATATATTAGTATGGAATTCGAGCTCGTTTAAAC-3′. The TAP-spTfb2 strain HES1 (h-ade6-M216 sptfb2+::TAP) was constructed as described previously (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar) with the following primer sets: 5′-CGCGCGGTCGACGGAAAGCAAAGTGAAAATGA-3′ plus 5′-CGCGCGCCCGGGTTTGACAGCTCGTCTTTTCAA-3′ and 5′-CGCGCGGAATTCTATATAACATAAGCTCAACATTAG-3′ plus 5′-CGCGCGGATATCTGCACTTATAATTTGTATATCAC-3′. We amplified a DNA fragment encoding S. pombe TFIIB from cDNA kindly provided by Jacques E. Remacle (University of Leuven, Belgium) and cloned it in-frame with a C-terminal His6-tag in the vector pET21b (Stratagene). We also amplified DNA fragments encoding for the subunits of spTFIIF (spTfg1, spTfg2, spTfg3) and spTFIIE (spToa1, spToa2). During PCR a His6-tag was introduced at the C terminus of spTfg2, spToa1, and spToa2. The PCR products were cloned into the vector pBacPAK9 (Clontech). We prepared Autographa californica nuclear polyhedrosis viruses recombinant for the individual proteins as described in the BacPAK manual (Clontech). Protein Purification and Identification—RNA pol II holoenzyme was purified from a TAP-spMed7 strain in which spTrap240+ had been deleted. spSrb8-11/Mediator and the pol II holoenzymeΔspTrap240 were purified as described previously (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar). We purified core TFIIH from a strain containing a C-terminal TAP-tag on sptfb2+, following previously published protocols (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar), but with the following modifications. We grew 20 liters of S. pombe to mid-log phase in YES medium (20Alfa C. Fajntes P. Hyams J. McLeod M. Warbrick E. Experiments in Fission Yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1993Google Scholar) supplemented with 0.2 g/liter adenine. Cells were collected by centrifugation (JA-10, 6,000 rpm, 5 min, +4 °C), washed once with ice-cold water, and suspended in 0.5 ml of 3 × lysis buffer (0.3 m Tris acetate (pH 7.8), 0.15 m potassium acetate, 30% (v/v) glycerol, 3 mm EDTA, 1.5 mm dithiothreitol, and 3× protease inhibitors) per g of cell pellet. Cells were lysed by bead beating (BeadBeater, Stratech Scientific Ltd.) using 25 cycles, 30 s of beating, and 90 s of rest. We cleared the supernatant by centrifugation (JA-10, 9,000 rpm, 25 min, +4 °C), added 1/9 volume of 5 m KAc and stirred for 15 min. We next added 0.2% (v/v) polyethyleneimine and stirred for an additional 30 min. After ultracentrifugation (Ti45, 42,000 rpm, 90 min, +4 °C), the supernatant was dialyzed against IPP150 overnight, added to 1 ml of IgG-Sepharose beads (Amersham Biosciences), and incubated by rotation for 2 h at +4 °C. The beads were collected by sedimentation, loaded into a column, and washed with 30 ml of IPP150 followed by 10 ml of buffer mm Tris (pH mm 0.5 mm EDTA, and 1 mm We TFIIH by of of protease in 1.5 ml buffer and for 2 h at °C. We added 3 ml of buffer and 3 of 1 m of and loaded the on a (Amersham The was for 2 h at +4 and washed with 30 ml of IPP150 TFIIH was by rotation at +4 for 1 h in IPP150 buffer with mm was purified as core TFIIH but with buffer containing mm We also used an to for additional which only with the the from to the purification and the buffer used to the IgG-Sepharose and to 5 RNA pol II cells were and collected as described for purification of core TFIIH. Cells were in 3× pol lysis buffer mm (pH mm 3 mm EDTA, 10 mm 30% glycerol, 3× protease We lysed the cells by bead beating cycles, 30 s of beating, and 90 s of and cleared the supernatant by centrifugation (JA-10, 9,000 rpm, 25 min, +4 We added volume of m to the supernatant and stirred for 15 min. We next added 0.2% (v/v) polyethyleneimine and stirred for an additional 30 min. After ultracentrifugation (Ti45, rpm, 15 min, +4 °C), an volume of m was added to the supernatant at a of 10 and the was stirred for an additional 30 min. After ultracentrifugation (Ti45, rpm, 15 min, +4 the was in buffer mm (pH 0.5 mm EDTA, 1 mm protein the the indicates the in a on the The supernatant was by centrifugation rpm, 30 min, +4 and loaded an (Amersham to at 2 which had been with The was washed with 25 of buffer and to a volume of buffer was added mm (pH mm glycerol, 0.5 mm EDTA, 1 mm protein inhibitors) and to for 15 min. buffer was and were collected pol II to as by and was in cells and purified to the The was dialyzed against buffer mm (pH (v/v) glycerol, 1 mm EDTA, 1 mm dithiothreitol, and protease the the indicates the potassium acetate in The dialyzed was to a (Amersham Biosciences), which had been in buffer The was washed with 5 ml of buffer and proteins were with a of buffer to A of protein 0.5 m purification of cells with recombinant spTfg2, and at a of of 5 for Cells were collected h by centrifugation (JA-10, 10 min, °C), washed with ice-cold and as Cells were in 10 ml of buffer mm (pH 10 mm and protease the the indicates the in and incubated on for 20 followed by lysis using a 15 After rotation in 10 ml of buffer for at +4 cells were rpm, min, The supernatant was loaded on 1 ml and purified the The of was dialyzed against buffer mm Tris acetate (pH 0.2 mm EDTA, glycerol, 1 mm dithiothreitol, and protease the the indicates the potassium acetate in The dialyzed was loaded on a (Amersham which had been in buffer The was washed with 5 ml of buffer and by a of buffer to at mm purification of cells with recombinant and at a of of 5 for We purified following the as for but with the following modifications. The of from was dialyzed against buffer mm Tris acetate (pH glycerol, 1 mm dithiothreitol, and protease the the indicates the potassium acetate in The dialyzed was loaded on a (Amersham Biosciences), which had been in buffer The was washed with 5 ml of buffer and by a of buffer to at m Purification of S. cerevisiae was as described previously S. S. Nature. PubMed Scopus Google Scholar). The of proteins in this by analysis of proteins was as described previously H. Samuelsen C.O. Baraznenok V. Ernest I. Huylebroeck D. Remacle J.E. Samuelsson T. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11985-11990Crossref PubMed Scopus (33) Google Scholar). were as described previously H. Kornberg R.D. J. Biol. Chem. Full Text PDF PubMed Google Scholar) with the following modifications. the transcription mm mm potassium acetate, mm mm 5 0.5 mm dithiothreitol, 5 mm acetate, mm mm EDTA, and 15 of Protein by was at for 30 min. We used a with the S. pombe alcohol dehydrogenase promoter of a H. Kornberg R.D. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). pombe pol II was incubated with and as in the to The were in 15 of 20 mm (pH mm potassium acetate, mm acetate, 2 mm 10 and 3 of for 30 at followed by in an and We to examine the of the complex on basal transcription in vitro. this needed to a Mediator lacking the We used a tandem affinity purification on and purified Mediator from a yeast strain a of The Mediator was purified in complex with pol II, a holoenzyme The absence of from the was with and a kinase A and used the spSrb8-11/Mediator which had previously (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar). the subunit is necessary for the of the kinase with the Mediator We next to examine the of the complex on basal transcription in vitro. in vitro system had been for S. pombe, set to the necessary transcription from different contains two subunits, and S. cerevisiae a has been to with but was during of purification N.L. W.J. D. Kornberg R.D. 1994; PubMed Scopus Google Scholar). Homologues to these proteins are also found in S. pombe, and upon in cells they a TFIIF, which purified to A and We that of and during that needed to a complex to TFIIF, when only and was in cells We next purified S. pombe RNA pol II using an and a We the subunits of pol II using and our were in with the subunit analysis reported previously (2Sakurai H. Mitsuzawa H. Kimura M. Ishihama A. Mol. Cell. Biol. 1999; 19: 7511-7518Crossref PubMed Scopus (48) Google Scholar). S. cerevisiae and eukaryotic TFIIH contains subunits J.Q. P. Sci. Full Text PDF PubMed Scopus Google Scholar). S. pombe introduced a TAP-tag on the C terminus of Purification on and a trimeric complex The individual subunits were with as Mcs2, Mcs6, and Pmh1 A similar subcomplex of TFIIH has also been in S. cerevisiae and (7Feaver W.J. Svejstrup J.Q. Henry N.L. Kornberg R.D. Cell. 1994; 79: 1103-1109Abstract Full Text PDF PubMed Scopus (359) Google Scholar). in our purified complex were the subunits of core TFIIH. an to the form of TFIIH used an in which the during the purification and these preparations of the S. pombe to the S. cerevisiae P. 20: PubMed Scopus Google Scholar). other of TFIIH however, found in the TAP-Pmh1 that TFIIH a complex in S. pombe what has been described in S. cerevisiae and human cells J.Q. P. Sci. Full Text PDF PubMed Scopus Google Scholar). the S. pombe a TAP-tag to the C-terminal of purification a which was with as and The of the TFIIH subunits are in I. We the ability of to the C-terminal domain of pol II in the presence and absence of core TFIIH was in both the was in the presence of core in cerevisiae of in a We the gene as a S. pombe TFIIB The gene was in-frame with a C-terminal in E. and purified to near contains two subunits in S. which are by the and We two to these genes in S. pombe, which upon in cells TFIIE, which purified to and We next set to transcription in vitro. We used with the promoter or the S. pombe promoter (adh1p) followed by a of all the factors promoter specific transcription from the S. pombe promoter of in vitro transcription also from the promoter the activity of individual transcription a transcription where one at the was We found that transcription was TFIIB, pol II, or were the absence of a of transcription the due to small of the purified pol Our were on which had a stimulatory effect on basal transcription. with our TFIIH is needed for transcription of certain on in mammalian in vitro transcription systems R. Cell. 1994; Full Text PDF PubMed Scopus Google Scholar, Cell. Full Text PDF PubMed Scopus Google Scholar, I. B. S. S. J. 2001; PubMed Scopus Google Scholar). our S. pombe in vitro transcription system appears to on the human system R. Cell. 1994; Full Text PDF PubMed Scopus Google Scholar, Cell. Full Text PDF PubMed Scopus Google Scholar), transcription in the absence of this factor. We next the effects of holoenzymeΔspTrap240 and spSrb8-11/Mediator on basal transcription We found that Mediator devoid of had a stimulatory effect on basal transcription. Mediator containing had a negative the basal of transcription to The of basal transcription for holoenzymeΔspTrap240 is an effect of pol II, the of free pol II to the as found in the holoenzymeΔspTrap240 at had a stimulatory effect on the transcription that the effect with spSrb8-11/Mediator is due to factor. of at the purification find that the of in our in vitro transcription system with the of Mediator and activity found in the individual S. pombe and S. cerevisiae have been used in the characterization of the eukaryotic cell We have a at a comparative of regulated pol II transcription in these two yeast on the of a purified in vitro system for S. pombe pol II transcription. The purified S. pombe contains subunits, in to TFIIF, which only contains two S. cerevisiae this additional appears only with TFIIF, it with the protein complex during N.L. W.J. D. Kornberg R.D. 1994; PubMed Scopus Google Scholar). Interestingly, the protein has also been as a of the yeast complex Henry N.L. Kornberg R.D. Mol. Cell. Biol. PubMed Scopus Google Scholar) as as N.L. W.J. D. Kornberg R.D. 1994; PubMed Scopus Google Scholar). The of the cerevisiae however, demonstrate that is essential for many of the with these complexes N.L. W.J. D. Kornberg R.D. 1994; PubMed Scopus Google Scholar). Our that is required for of S. pombe in recombinant form that the protein a as an of We recently reported that Mediator in S. cerevisiae and S. pombe exists in at least two specific forms (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar). The smaller of these forms is the core Mediator, which with pol II and form a holoenzyme. larger form, which contains four additional Mediator subunits, spSrb8, spTrap240, spSrb10, is devoid of pol These proteins collectively form the Srb8-11 which was recently in free form T. R. H. P. Kornberg R. J. Biol. Chem. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar). We demonstrate that Mediator from a strain also lacks as an for the other of the Our of these two forms of Mediator also to effects on basal transcription in vitro. We find that core Mediator has a stimulatory effect on basal transcription, whereas the Mediator has an to our that the of to repress Mediator function to transcriptional (13Samuelsen C. Baraznenok V. Spahr H. Kieselbach T. Holmberg S. Gustafsson C.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6422-6427Crossref PubMed Scopus (98) Google Scholar). for the is in of transcription upon into growth factors and the of essential control eukaryotic cell of these is cells into a as phase or by a of transcription and protein 2002; PubMed Scopus Google Scholar). Interestingly, subunits of the Srb8-11 have been essential for phase in S. cerevisiae J. 2001; Google Scholar). is thus that the of the module is to transcription upon into phase and that the in vitro this specific