Association of the p75 Neurotrophin Receptor with TRAF6

Abstract

In addition to the Trk tyrosine kinase receptors, neurotrophins also bind to a second receptor, p75, a member of the tumor necrosis factor receptor superfamily. Several signaling pathways have been implicated for p75 in the absence of Trk receptors, including induction of NF-κB and c-Jun kinase activities and increased production of ceramide. However, to date, the mechanisms by which the p75 receptor initiates intracellular signal transduction have not been defined. Here we report a specific interaction between p75 and TRAF6 (tumor necrosis factorreceptor-associated factor-6) after transient transfection in HEK293T cells. The interaction was ligand-dependent and maximal at 100 ng/ml of nerve growth factor (NGF). Other neurotrophins also promoted the association of TRAF6 with p75 but to a lesser extent. The binding of TRAF6 was localized to the juxtamembrane region of p75 by co-immunoprecipitation and Western blotting. To assess the functional significance of this interaction, we have tested responses in cultured Schwann cells that express p75 and TRAF6. An NGF-mediated increase in the nuclear localization of the p65 subunit of NF-κB could be blocked by the introduction of a dominant negative form of TRAF6 in Schwann cells. These results indicate that TRAF6 can potentially function as a signal transducer for NGF actions through the p75 receptor. In addition to the Trk tyrosine kinase receptors, neurotrophins also bind to a second receptor, p75, a member of the tumor necrosis factor receptor superfamily. Several signaling pathways have been implicated for p75 in the absence of Trk receptors, including induction of NF-κB and c-Jun kinase activities and increased production of ceramide. However, to date, the mechanisms by which the p75 receptor initiates intracellular signal transduction have not been defined. Here we report a specific interaction between p75 and TRAF6 (tumor necrosis factorreceptor-associated factor-6) after transient transfection in HEK293T cells. The interaction was ligand-dependent and maximal at 100 ng/ml of nerve growth factor (NGF). Other neurotrophins also promoted the association of TRAF6 with p75 but to a lesser extent. The binding of TRAF6 was localized to the juxtamembrane region of p75 by co-immunoprecipitation and Western blotting. To assess the functional significance of this interaction, we have tested responses in cultured Schwann cells that express p75 and TRAF6. An NGF-mediated increase in the nuclear localization of the p65 subunit of NF-κB could be blocked by the introduction of a dominant negative form of TRAF6 in Schwann cells. These results indicate that TRAF6 can potentially function as a signal transducer for NGF actions through the p75 receptor. The neurotrophins use a two-receptor system to promote cell differentiation and survival, as well as modulate axonal and dendritric branching and synaptic transmission (1Thoenen H. Science. 1995; 270: 593-598Crossref PubMed Scopus (1694) Google Scholar, 2Lewin G.R. Barde Y.-A. Annu. Rev. Neurosci. 1996; 19: 289-317Crossref PubMed Scopus (1766) Google Scholar). NGF, 1The abbreviations used are: NGF, nerve growth factor; TNF, tumor necrosis factor; TRAF, tumor necrosis factor receptor-associated factor; BDNF, brain-derived neurotrophin factor; NT, neurotrophin; IL, interleukin; HA, hemagglutinin; JNK, c-Jun N-terminal kinase; PCR, polymerase chain reaction; DN, dominant negative. 1The abbreviations used are: NGF, nerve growth factor; TNF, tumor necrosis factor; TRAF, tumor necrosis factor receptor-associated factor; BDNF, brain-derived neurotrophin factor; NT, neurotrophin; IL, interleukin; HA, hemagglutinin; JNK, c-Jun N-terminal kinase; PCR, polymerase chain reaction; DN, dominant negative.BDNF and NT-4/5, and NT-3 bind to TrkA, TrkB, and TrkC, respectively, and also bind to the p75 receptor (3Chao M.V. J. Neurobiol. 1994; 25: 1373-1385Crossref PubMed Scopus (396) Google Scholar, 4Bothwell M. Annu. Rev. Neurosci. 1995; 18: 223-253Crossref PubMed Scopus (757) Google Scholar, 5Dechant G. Barde Y.-A. Curr. Opin. Neurobiol. 1997; 7: 413-418Crossref PubMed Scopus (203) Google Scholar), a member of the TNF receptor superfamily (6Smith C.A. Farrah T. Goodwin R.G. Cell. 1994; 76: 959-962Abstract Full Text PDF PubMed Scopus (1829) Google Scholar). The TNF family includes the two TNF receptors, Fas-CD95, DR-3, DR-4, CAR-1, and the lymphoid cell-specific receptors CD30, CD40, and CD27 (7Brojatsch J. Naughton J. Rolls M.M. Zingler K. Young J.A.T. Cell. 1996; 87: 845-855Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar, 8Chinnaiyan A.M. O'Rourke K. Yu G.-L. Lyons R.H. Garg M. Duan D.R. Xing L. Gentz R. Ni J. Dixit V.M. Science. 1996; 274: 990-992Crossref PubMed Scopus (529) Google Scholar, 9Montgomery R.I. Warner M.S. Lum B.J. Spear P.G. Cell. 1996; 87: 427-436Abstract Full Text Full Text PDF PubMed Scopus (989) Google Scholar, 10Pan G. O'Rourke K. Chinnaiyan A.M. Gentz R. Ebner R. Ni J. Dixit V.M. Science. 1997; 276: 111-113Crossref PubMed Scopus (1538) Google Scholar). The common motif that defines these transmembrane proteins is a 40-amino acid cysteine sequence that occurs two to six times in the extracellular domain. In addition, several members contain a region of weak homology in the intracellular portion, designated the death domain (11Hofmann K. Tschopp J. FEBS Lett. 1995; 371: 321-323Crossref PubMed Scopus (102) Google Scholar, 12Feinstein E. Kimchi A. Wallach D. Boldin M. Varfolomeev E. Trends Biochem. Sci. 1995; 20: 342-344Abstract Full Text PDF PubMed Scopus (266) Google Scholar). Recent NMR analysis has confirmed the existence of a death domain in the p75 receptor (13Liepinsh E. Ilag L.L. Otting G. Ibanez C.F. EMBO J. 1997; 16: 4999-5005Crossref PubMed Scopus (251) Google Scholar). In the presence of TrkA receptors, p75 participates in the formation of high affinity binding sites and enhanced neurotrophin responsiveness leading to increased cell survival (14Chao M.V. Hempstead B.L. Trends Neurosci. 1995; 19: 321-326Abstract Full Text PDF Scopus (764) Google Scholar). In the absence of TrkA receptors, p75 can generate, in specific cell populations and conditions, a death signal (15Rabizadeh S. Oh J. Zhong L.T. Yang J. Bitler C.M. Butcher L.L. Bredesen D.E. Science. 1993; 261: 345-348Crossref PubMed Scopus (744) Google Scholar, 16Frade J.M. Rodriguez-Tebar A. Barde Y.-A. Nature. 1996; 383: 166-168Crossref PubMed Scopus (661) Google Scholar, 17Casaccia-Bonnefil P. Carter B.D. Dobrowsky R.T. Chao M.V. Nature. 1996; 383: 716-719Crossref PubMed Scopus (712) Google Scholar, 18Bamji S. Majdan M. Pozniak C.D. Belliveau D.J. Aloyz R.J.K. Causing C.G. Miller F.D. J. Cell Biol. 1998; 140: 911-923Crossref PubMed Scopus (439) Google Scholar). This dichotomy in responses has raised questions regarding the cell specificity and the nature of the signaling mechanisms for the p75 receptor. A variety of signaling pathways has been detected for p75. A transient elevation in intracellular ceramide levels due to increased sphingomyelin hydrolysis has been observed in several cell types, including T9, NIH3T3, and PC12 cells (19Dobrowsky R.T. Jenkins G.M. Hannun Y.A. J. Biol. Chem. 1995; 270: 22135-22142Crossref PubMed Scopus (224) Google Scholar). It is not yet clear what biological functions are mediated by an increase in ceramide. In addition, activation of c-Jun N-terminal kinase (JNK) has been observed in cells undergoing cell death (17Casaccia-Bonnefil P. Carter B.D. Dobrowsky R.T. Chao M.V. Nature. 1996; 383: 716-719Crossref PubMed Scopus (712) Google Scholar, 18Bamji S. Majdan M. Pozniak C.D. Belliveau D.J. Aloyz R.J.K. Causing C.G. Miller F.D. J. Cell Biol. 1998; 140: 911-923Crossref PubMed Scopus (439) Google Scholar, 20Yoon S.O. Carter B.D. Casaccia-Bonnefil P. Chao M.V. J. Neurosci. 1998; 18: 3273-3281Crossref PubMed Google Scholar). The activity of the stress-activated JNK protein kinase can be up-regulated by neurotrophins under apoptotic conditions through p75. Another signaling response is the activation of the nuclear transcription factor NF-κB. It has been shown that NF-κB activity can be induced by NGF in primary Schwann cells expressing p75 but not TrkA receptors (21Carter B.D. Kaltschmidt C. Kaltschmidt B. Offenhauser N. Bohm-Matthaei R. Baeuerle P.A. Barde Y.-A. Science. 1996; 272: 542-545Crossref PubMed Scopus (610) Google Scholar). This stimulation was not observed by BDNF or NT-3 treatment of Schwann cells, which express TrkB and TrkC. Increasing evidence has demonstrated that many TNF receptor family members interact with TNF receptor-associated factors (TRAFs) to modulate JNK and NF-κB activity as well as apoptosis (22Rothe M. Sarma V. Dixit V.M. Goeddel D.V. Science. 1995; 269: 1424-1427Crossref PubMed Scopus (968) Google Scholar, 23Song H.Y. Regnier C.H. Kirschning C.J. Goeddel D.V. Rothe M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9792-9796Crossref PubMed Scopus (504) Google Scholar). So far six TRAF proteins have been identified that mediate signaling through receptors for TNF, CD30L, CD40L, and IL-1 (24Arch R.H. Gedrich R.W. Thompson C.B. Genes Dev. 1998; 12: 2821-2830Crossref PubMed Scopus (507) Google Scholar). TRAF-6 is expressed in neural tissues (25Ishida T. Mizushima S. Azuma S. Kobayashi N. Tojo T. Suzuki K. Aizawa S. Watanabe T. Mosialos G. Kieff E. Yamamoto T. Inoue J. J. Biol. Chem. 1996; 271: 28745-28748Abstract Full Text Full Text PDF PubMed Scopus (430) Google Scholar, 26Liou H.C. Sha W.C. Scott M.L. Baltimore D. Mol. Cell. Biol. 1994; 14: 5349-5359Crossref PubMed Google Scholar), leading us to test whether this TRAF protein was capable of associating with the p75 neurotrophin receptor. Here we report a specific interaction of the p75 neurotrophin receptor with TRAF6. This association leads to an translocation of the p65 subunit of NF-κB in Schwann cells. The 3′ deletions were generated by using polymerase chain reaction (PCR). A common 5′-PCR primer (5′-GGATATGGTGACCACTGTGATG-3′) was used in conjunction with unique 3′-PCR primers for each particular deletion (Δ35, 5′-ATAAGGGCCCTCAGCGTCGCAGGGCGGCTAAAAG-3′; Δ62, 5′-ATAAGGGCCCTCACTCGCCTGCCAGATGTCGC-3′; Δ86, 5′-ATAAGGGCCCTCACAGGGGCAGGCTACTGTAGAG-3′; Δ113, 5′-ATAAGGGCCCTCAGCTGTCCACAGAGATGCCAC-3′; and Δ128, 5′-ATAAGGGCCCTCACGGTGGGGGCGTCTGGTTCAC-3′), and the pCDNA3-rat p75 cDNA was used as a template. All PCR products were cut withNarI and ApaI and ligated into NarI- and ApaI-digested pCDNA3-p75 carrying the rat p75 cDNA sequence. The 5′ HA epitope was generated by PCR using 5′ (5′-GGGGTACCACCATGTCTGCACTTCTGATCCTAGCTCTTGTTGGAGCTGCAGTTGCTTATCCATATGATGTTCCAGATTATCTAAGGAGACATGTTCCACAG-3′) and 3′ (5′-CTTGGGATCCATCACCAGG-3′) primers with the pCDNA3-p75 cDNA as the template. The PCR product was digested with KpnI and BamHI and ligated directly intoKpnI- and BamHI-digested pCDNA3-p75 deletion cDNAs. All constructs were verified by DNA sequencing (Rockefeller University, New York, NY). The DN TRAF6 was generated using PCR to amplify the TRAF domain. Using 5′ (5′-CGGAATTCCATCTCAGAGGTCCGGAATTTC-3′) and 3′ (5′-GAAGATCTCTATACCCCTGCATCAGTACTTCG-3′) primers and the pRK5-hTRAF6 cDNA construct as the template (kindly provided by Zhaodan Cao, Tularik), the PCR product was digested with EcoRI andBglII and ligated into a EcoRI- andBglII-digested pCMV2-FLAG cDNA. All cells were cultured at 37 °C in 5% CO2. 293T cells were cultured in Dulbecco's modified Eagle's medium plus 10% fetal calf serum supplemented with penicillin-streptomycin (Life Technologies, Inc.). Approximately 1.5 × 106 cells in 10-cm tissue culture dishes were transfected with 10 μg of plasmid DNA using the calcium phosphate method. Transfected cells were collected 36 h after removal of calcium phosphate precipitate and aliquoted into microcentrifuge tubes at 2.0 × 106 cells/ml. Recombinant neurotrophins (provided by Genentech) were added for various times, as indicated in the text. The cells were then spun down and lysed in 1 ml of Nonidet P-40 lysis buffer (1% Nonidet P-40, 20 mm Tris, pH 8.0, 200 mm NaCl, 1 mm EDTA, 2 μg/ml aprotinin, 1 μg/ml leupeptin, and 25 μg/ml phenylmethylsulfonyl fluoride). Lysates (800 μg/ml) were then incubated with α-FLAG (2 μg/ml; Eastman Kodak Co.) and Sepharose-protein A (Sigma) or with α-FLAG M2 Affinity Gel (4 μg/ml; Kodak). The matrix was then washed, and immune complexes were subjected to Western analysis. Samples in SDS-polyacrylamide gel electrophoresis sample buffer were resolved on a 10% SDS-polyacrylamide gel under reducing conditions. Proteins were transferred to polyvinylidene difluoride membrane, blocked with 5% milk, and incubated with a primary rabbit polyclonal antibody for p75, 9992, at 1:5000 or a rabbit polyclonal α-HA antibody (Immunotech) at 1:1000 dilution at room temperature. A polyclonal antibody to TRAF6 was provided by Zhaodan Cao (Tularik) and used at a dilution of 1:500. The membrane was washed with Tris-buffered saline and Tween and incubated with an α-mouse IgG-horseradish peroxidase (Sigma) and then processed by ECL (Amersham Pharmacia Biotech) and exposed to x-ray film. The gels were scanned and quantitated by ImageQuant v1.1 (Molecular Dynamics). Sciatic nerves were dissected from P2 rats, cut in small pieces, and incubated in Hanks' balanced solution containing 0.25% trypsin (Sigma) and 0.25% collagenase (Sigma) for 30 min. The cells are triturated, plated on poly-d-lysine coated coverslips, and cultured in Dulbecco's modified Eagle's medium containing 1% fetal calf serum and glial growth factor (63 ng/ml; Cambridge Neuroscience). Schwann cells are transfected with 0.3 μg of cDNA using the Effectene Transfection Reagent kit (Qiagen). After transfection, the cells were serum-starved for 2 h, and then 100 ng/ml of NGF was added for an additional 2 h. The cells are fixed in 4% paraformaldehyde, blocked in 5% goat serum, and incubated with α-p65 (1:100, Santa Cruz) and α-FLAG (1 μg/ml) overnight at 4 °C. The cells are then incubated with biotinylated anti-rabbit IgG (1:500, Vector) for 1 h, followed by incubation with rhodamine avidin D cell sorting (1:200, Vector), goat anti-mouse fluorescein isothiocyanate (1:200, Jackson Laboratories), and 4,6-diamidino-2 phenylinodole (1:500) for 1 h. The coverslips were mounted using Vecta Shield. Cells were viewed at with a 40× objective and quantitated. The TRAF6 protein interacts with the B cell antigen CD40 through a homology domain at the C-terminal region, the TRAF domain (25Ishida T. Mizushima S. Azuma S. Kobayashi N. Tojo T. Suzuki K. Aizawa S. Watanabe T. Mosialos G. Kieff E. Yamamoto T. Inoue J. J. Biol. Chem. 1996; 271: 28745-28748Abstract Full Text Full Text PDF PubMed Scopus (430) Google Scholar). TRAF6 also contains an N-terminal RING finger sequence, five zinc fingers, and a coiled-coil domain that are required for TRAF6 signaling. To determine whether TRAF6 interacts with p75, 293T cells were cotransfected with p75 cDNA and TRAF6, tagged with the FLAG epitope (FLAG-TRAF6). Immunoprecipitation of lysates with antibodies against FLAG, followed by immunoblotting with p75 antibodies indicated that p75 associated with TRAF6 (Fig.1 A). In the absence of TRAF6 expression, immunoprecipitation of p75 was not observed. The association of TRAF6 with p75 was ligand-dependent. Indeed, addition of increasing doses of NGF enhanced the interaction (Fig.1 B). The recruitment of TRAF6 to the receptor in cells treated with NGF was rapid. Within 1 min after NGF treatment, an increase level of association was detected (Fig. 1 C). TRAF6 migrated as a protein with a molecular mass of 60 kDa. In these experiments an equal amount of TRAF6 protein was detected in each immunoprecipitation reaction. These results indicate that TRAF6 associates with p75 in a ligand-dependent manner in 293T cells. The p75 receptor binds equally well to NGF, BDNF, NT-3, and NT-4/5. We therefore tested whether neurotrophins could promote the association of TRAF6 and p75. of NGF or to transfected 293T cells for min in increase of p75 associated with TRAF6 (Fig. 1 However, treatment with 100 ng/ml of BDNF and NT-3 a of association between p75 and TRAF6 and of TRAF6 (Fig. 1 and p75 were in each This was with a each neurotrophin binds to the p75 receptor with a affinity A. G. Barde Y.-A. Full Text PDF PubMed Scopus Google Scholar, A. G. R. Barde Y.A. EMBO J. PubMed Scopus Google Scholar), several p75 specific functions are by NGF and not by BDNF or NT-3 (17Casaccia-Bonnefil P. Carter B.D. Dobrowsky R.T. Chao M.V. Nature. 1996; 383: 716-719Crossref PubMed Scopus (712) Google Scholar, B.D. Kaltschmidt C. Kaltschmidt B. Offenhauser N. Bohm-Matthaei R. Baeuerle P.A. Barde Y.-A. Science. 1996; 272: 542-545Crossref PubMed Scopus (610) Google Scholar). The results indicate that each neurotrophin between p75 and TRAF6. To the interaction between p75 and TRAF6, a of deletion was in the domain of p75 A). The intracellular domain of p75 is in and contains a juxtamembrane region and a death domain sequence in the (13Liepinsh E. Ilag L.L. Otting G. Ibanez C.F. EMBO J. 1997; 16: 4999-5005Crossref PubMed Scopus (251) Google Scholar). To of these each p75 deletion was with HA at the The p75 receptor deletions were cotransfected with in 293T cells. Lysates were with antibody and with an antibody to the p75 receptor TRAF6 was to interact with p75 deletion Δ62, and but not a deletion the (Fig. 2 B). of lysates that expressed the p75 receptor or TRAF6 not immunoprecipitation of protein (Fig. 2 B). of TRAF6 and p75 receptors was confirmed by Western (Fig. 2 This analysis indicated that the interaction between p75 and TRAF6 in the juxtamembrane region of p75, between and is the significance of an association between p75 and indicated that NGF promote and cell protein in Schwann cells B. M. EMBO J. PubMed Scopus Google Scholar, G. Proc. Natl. Acad. Sci. U. S. A. 1994; PubMed Scopus Google Scholar). A signaling to for these activities be NF-κB shown to be NGF binding to p75 (21Carter B.D. Kaltschmidt C. Kaltschmidt B. Offenhauser N. Bohm-Matthaei R. Baeuerle P.A. Barde Y.-A. Science. 1996; 272: 542-545Crossref PubMed Scopus (610) Google Scholar). To test whether TRAF6 is expressed in Schwann cells, we lysates from cultured Schwann cells by immunoblotting with against TRAF6. The TRAF6 protein of 60 was detected in Schwann cells and 293T cells. an additional transfection of 293T cells with the protein to of the protein (Fig. of a TRAF6 cDNA construct with an NF-κB construct in Schwann cells to a increase in activity not These results that TRAF6 be a of NGF-mediated NF-κB signaling in Schwann cells. To assess whether TRAF6 is in NGF we a DN form of TRAF6 that contains the C-terminal of TRAF6 This form of TRAF6 was used to that TRAF6 was required for IL-1 and CD40 mediated NF-κB activation (25Ishida T. Mizushima S. Azuma S. Kobayashi N. Tojo T. Suzuki K. Aizawa S. Watanabe T. Mosialos G. Kieff E. Yamamoto T. Inoue J. J. Biol. Chem. 1996; 271: 28745-28748Abstract Full Text Full Text PDF PubMed Scopus (430) Google Scholar, J. M. T. Goeddel D.V. Nature. 1996; 383: PubMed Scopus Google Scholar). of the p65 subunit of NF-κB to the was used as an dissected Schwann cells were transfected with the and subjected to with antibodies against p65 and the FLAG In the absence of NGF treatment, Schwann cells for p65 in the (Fig. 4 A). of NGF in of p65 to the the Schwann cells expressing not a of nuclear for p65 in the presence of NGF (Fig. 4 B). The of was by FLAG antibody To the of in Schwann cells, the of cells p65 nuclear was In the absence of NGF, a of the cells for p65 The addition of NGF in of the Schwann cell for p65 nuclear C). Cells expressing not a increase in p65 nuclear These results that NGF can promote NF-κB nuclear translocation in Schwann cells. It be that the translocation of as well as in NF-κB was not observed in Schwann cells for 1 not that Schwann cells responsiveness in of NF-κB translocation in cells. TRAF6 is a of NF-κB activation through the p75 receptor. p75 has not been as a signal receptor, evidence that can signal in M. Science. 1996; 272: PubMed Scopus Google Scholar, B.D. G.R. 1997; 18: Full Text Full Text PDF PubMed Scopus Google Scholar). The of the p75 a in survival A. R. 1994; PubMed Google Scholar, K. S. R. Science. 1994; PubMed Scopus Google and an apoptotic function as well G.M. T. Science. 1996; 274: PubMed Scopus Google Scholar, J. Butcher L.L. Bredesen D.E. W.C. J. Neurosci. 1997; PubMed Google Scholar). Another regarding p75 that has been raised is that neurotrophins BDNF, and bind to p75 with each neurotrophin on cell function and through p75 M. Annu. Rev. Neurosci. 1995; 18: 223-253Crossref PubMed Scopus (757) Google Scholar, 16Frade J.M. Rodriguez-Tebar A. Barde Y.-A. Nature. 1996; 383: 166-168Crossref PubMed Scopus (661) Google Scholar, 17Casaccia-Bonnefil P. Carter B.D. Dobrowsky R.T. Chao M.V. Nature. 1996; 383: 716-719Crossref PubMed Scopus (712) Google Scholar, B.D. Kaltschmidt C. Kaltschmidt B. Offenhauser N. Bohm-Matthaei R. Baeuerle P.A. Barde Y.-A. Science. 1996; 272: 542-545Crossref PubMed Scopus (610) Google Scholar). to for the of neurotrophins is the of Trk in the of binding and the of of each neurotrophin to p75 A. G. Barde Y.-A. Full Text PDF PubMed Scopus Google Scholar, A. G. R. Barde Y.A. EMBO J. PubMed Scopus Google recruitment of by p75 be with each The that NGF and a TRAF6 association with p75 BDNF and NT-3 is with this The deletion analysis localized the binding of TRAF6 to a region of the p75 region, which includes the This juxtamembrane sequence has been between and p75 G. Full Text PDF PubMed Scopus Google Scholar). TRAF6 can also be to the IL-1 receptor through binding to receptor-associated J. M. T. Goeddel D.V. Nature. 1996; 383: PubMed Scopus Google Scholar, Science. 1996; 271: PubMed Scopus Google Scholar). the binding domain of for TRAF6 has not been a of to the of p75 and CD40 not a common binding sequence. the interaction of TRAF6 with signaling to binding In addition, signaling through TRAF6 can through the kinase a protein kinase kinase kinase member Boldin Wallach D. Nature. 1997; PubMed Scopus Google Scholar), or through the apoptosis H. M. K. H. Rothe M. K. H. Mol. Cell. 1998; Full Text Full Text PDF PubMed Scopus Google Scholar). are required to whether these are also required for neurotrophin signaling. We and for and Zhaodan Cao and H. C. for