Publication | Closed Access
Genetic Polymorphism of Vitamin K Epoxide Reductase (VKORC1) 1173C>T in a Chinese and a Caucasian Population
28
Citations
11
References
2006
Year
GeneticsGenetic EpidemiologyHuman PolymorphismMolecular GeneticsPharmacotherapyVitamin KClinical GeneticsThrombosisOral AnticoagulantsHematologyGenetic PolymorphismPharmacogenomicsClinical ChemistryPublic HealthPlatelet AntagonistAtherosclerosisGenetic FactorCaucasian PopulationMetabolomicsPharmacologyEpidemiologyGenetic DeterminantBlood PlateletReductase PolymorphismMedicineAnticoagulant
Oral anticoagulants, such as warfarin and acenocoumarol, are widely prescribed for the prevention and treatment of thromboembolic diseases. However, these treatments are difficult to manage because of an important inter-individual variability in the response, leading to high risks of adverse effects such as bleeding. Ethnicity appears to be a significant factor in determining oral anticoagulants maintenance dose requirement: Asian patients usually require lower doses than Caucasian patients to elicit the same degree of anticoagulation (Weibert & Palinkas 1991; Yu et al. 1996), which cannot be linked to differences in dietary habits nor to polymorphisms of the cytochrome P450 2C9 (CYP2C9) (Takahashi et al. 2003; Zhao et al. 2004). Vitamin K epoxide reductase is the enzyme responsible for the recycling of vitamin K 2,3-epoxide to vitamin K hydroquinone, a cofactor that is essential for the synthesis of several blood coagulation factors. Recent studies have suggested that genetic polymorphisms within the vitamin K epoxide reductase gene could play a role in the response to oral anticoagulants (Rost et al. 2004; Bodin et al. 2005; D'Andrea et al. 2005). Thus, patients carrying the 1173T allele require a lower warfarin maintenance dose than carriers of the 1173C allele (D'Andrea et al. 2005). The genetic polymorphism -1639G>A, which is in complete linkage disequilibrium with the 1173C>T polymorphism, was also shown to influence the interindividual variability in the pharmacological response to acenocoumarol (Bodin et al. 2005). CYP2C9 and VKORC1 genes are inherited in an independent way because they are on two different chromosomes (10q and 16, respectively). We hypothesized that the vitamin K epoxide reductase 1173C>T single nucleotide polymorphism could be responsible, at least in part, for the higher sensitivity of Asian people to oral anticoagulants and thus compared the frequencies of the different alleles in Chinese and Caucasian populations. The mean International Normalized Ratios obtained in 4 Asian and 21 Caucasian healthy volunteers 24 h after a single oral dose of 4 mg of acenocoumarol were first compared using the Mann-Whitney test. The volunteers were selected from a previous study (Morin et al. 2004) because they were all homozygous for the wild-type CYP2C9*1 allele and had the same weight (55±4 kg). Then we studied the allelic distribution of the vitamin K epoxide reductase 1173C>T polymorphism in 390 unrelated persons of Han Chinese origin (mainly from Shangai) for whom DNA samples were available from a previous study (Yang et al. 2003). The study population was the same as the one used in our previous analysis of allele frequencies of CYP2C9. One hundred and seven adult healthy volunteers, 99 healthy children and a group of 148 were children with Helicobacter pylori-related disease were enrolled in this study. We performed VKORC1 genotyping on 390 of these participants because DNA genotyping were available only in 144 children patients (four DNA samples could not be amplified to genotype vitamin K epoxide reductase). In the previous published study (Yang et al. 2003), only the frequency of CYP2C9*1, *2 and *3 alleles had been determined in this Asian population (0.963, 0.001 and 0.036 respectively). The vitamin K epoxide reductase single nucleotide polymorphism distribution was compared, using the chi-square test, to the one described elsewhere in 222 Caucasian healthy volunteers (Bodin et al. 2005). The participation of all individuals in this study was in agreement with Chinese and French ethical laws (Yang et al. 2003; Bodin et al. 2005). The genomic DNA sequence of vitamin K epoxide reductase referred to as accession number AY587020 (NCBI) was used as reference sequence. Genotyping for vitamin K epoxide reductase 1173C>T single nucleotide polymorphism (rs9934438) was performed using the TaqMan® Allelic Discrimination assay on a 7000HT® Applied Biosystems real-time thermal cycler. It employed a forward primer (5′CGTCCGGGCCTGGTCT3′), a reverse primer (5′TGGAACCAGGTTAGGACTGTCAA3′) and two MGB probes, one recognizing the wild type genotype (5′VIC-AGATCATCGACCCTTG-MGB3′) and the other recognizing the mutated one (5′FAM-ATCATCGACTCTTGGACTA-MGB3′). They were designed using ABI Prism® Primer Express® software (Applied Biosystems, USA). We first compared the International Normalized Ratios obtained in healthy Asian and Caucasian volunteers, consecutively to the administration of a single oral dose of 4 mg acenocoumarol (fig. 1). The Asian INRs were significantly higher than the Caucasian ones: 1.6±0.2 versus 1.3±0.1 (P<0.05). We thus confirmed the previously described higher Asian sensitivity to oral anticoagulants (Weibert & Palinkas 1991; Zhao et al. 2004). In addition, we observed that 3 out of the 4 Asian persons were homozygous carriers of the vitamin K epoxide reductase 1173T allele compared to only 4 among the 21 Caucasians. International normalized ratio values obtained in healthy volunteers 24 h after a single oral dose of acenocoumarol (4 mg). All the volunteers had the CYP2C9 *1/1 genotype and the same weight ranging from 50 to 60 kg (*P<0.05). Subdivision of boxes and top and bottom lines on boxes represent median values and upper and lower quartile respectively. All samples were genotyped for the vitamin K epoxide reductase polymorphism, with some also genotyped for an additional polymorphism (-1639G>A). Analysis of genotypes for the 2 polymorphisms (data not shown) confirmed that G-1639 and C1173 were in strong linkage disequilibrium, and, in view of this result, all subsequent genotyping was for the vitamin K epoxide reductase 1173C>T only. In larger Caucasian and Chinese populations, the Chinese allelic frequencies were statistically different from the Caucasian ones (P<0.0001) (table 1). About 85% of the Chinese persons were homozygous for the mutated (T) allele, 14% were heterozygous and less than 1% of the subjects were homozygous for the wild-type C allele, versus 17%, 49% and 34% respectively in the Caucasian population (Bodin et al. 2005) (P<0.0001). Caucasian allelic frequencies were in agreement with the European frequencies given by the SeattleSNPs database (http:pga.gs.washington.edudata vkorc1welcome.html). Hardy Weinberg equilibrium (HWE) for vitamin K epoxide reductase 1173C>T single nucleotide polymorphism was confirmed, the observed genotype frequency showed no deviation from HWE (P=0.67). The absence of significant deviation from HWE is a good indicator for single nucleotide polymorphism genotyping quality (Hosking et al. 2004). We first confirmed the fact that for a similar weight, and CYP2C9 *1/*1 genotype, healthy Asian volunteers had a higher INR than Caucasian volunteers after a single oral dose of acenocoumarol. We observed that 3 out of the 4 Asians were homozygous for the vitamin K epoxide reductase 1173T allele compared to 4 among the 21 Caucasians. Since the vitamin K epoxide reductase 1173T allele has been previously associated to a higher sensitivity to oral anticoagulants response (D'Andrea et al. 2005), we hypothesized that it might explain the higher sensitivity to OA observed in Asian patients. As shown in table 1, the Chinese and Caucasian allelic distributions were completely different, with respectively 92% of the vitamin K epoxide reductase 1173T allele, responsible for a higher sensitivity to oral anticoagulants, versus 43%. The participants exhibited genotype frequencies of vitamin K epoxide reductase 1173C>T single nucleotide polymorphism in accordance with those recently described in Han Chinese population (Yuan et al. 2005). Indeed a comparable inversed distribution was recently described between Taiwan Chinese and Caucasians concerning the -1639G>A polymorphism and warfarin sensitivity (Yuan et al. 2005). We confirmed this observation in a number of the participants (N=107 healthy volunteers), with a complete linkage disequilibrium between the two vitamin K epoxide reductase single nucleotide polymorphisms. Our result confirmed the strong linkage disequilibrium in Chinese population and consecutively the higher frequency of the vitamin K epoxide reductase -1639A allele observed in a Han Chinese group (Yuan et al. 2005). They revealed in a haplotypic analysis that –1639G>A polymorphism is in complete association with the 1173C>T single nucleotide polymorphism in a Chinese population. Patients with the -1639 promoter polymorphism AA genotype had lower warfarin dose requirement, whereas the AG/GG genotype had higher dose requirements. A recent study (Rieder et al. 2005) confirms the role of the VKORC1 haplotype in warfarin sensitivity between different ethnic groups (African-American, European-American and Asian-American). Our results confirm the evidence that changes in the vitamin K epoxide reductase gene could alter oral anticoagulant dosage requirements both interindividually in Chinese and interethnically between Chinese and Caucasians. However that may be, -1639G>A or 1173C>T single nucleotide polymorphism analysed separately are as informative as the whole haplotype (Bodin et al. 2005; D'Andrea et al. 2005). Further clinical studies are necessary to confirm the importance of vitamin K epoxide reductase and CYP2C9 genotyping previous to oral anticoagulant treatment in patients of Asian origin but we believe that such a pharmacogenetic testing could contribute to the individualization of drug treatment and thus enhance drug safety and efficacy.
| Year | Citations | |
|---|---|---|
Page 1
Page 1