A Novel Protein Tightly Bound to Bacterial Magnetic Particles in Magnetospirillum magneticum Strain AMB-1

Abstract

Magnetic bacteria synthesize magnetite crystals with species-dependent morphologies. The molecular mechanisms that control nano-sized magnetite crystal formation and the generation of diverse morphologies are not well understood. From the analysis of magnetite crystal-associated proteins, several low molecular mass proteins tightly bound to bacterial magnetite were obtained from Magnetospirillum magneticumstrain AMB-1. These proteins showed common features in their amino acid sequences, which contain hydrophobic N-terminal and hydrophilic C-terminal regions. The C-terminal regions in Mms5, Mms6, Mms7, and Mms13 contain dense carboxyl and hydroxyl groups that bind iron ions. Nano-sized magnetic particles similar to those in magnetic bacteria were prepared by chemical synthesis of magnetite in the presence of the acidic protein Mms6. These proteins may be directly involved in biological magnetite crystal formation in magnetic bacteria. Magnetic bacteria synthesize magnetite crystals with species-dependent morphologies. The molecular mechanisms that control nano-sized magnetite crystal formation and the generation of diverse morphologies are not well understood. From the analysis of magnetite crystal-associated proteins, several low molecular mass proteins tightly bound to bacterial magnetite were obtained from Magnetospirillum magneticumstrain AMB-1. These proteins showed common features in their amino acid sequences, which contain hydrophobic N-terminal and hydrophilic C-terminal regions. The C-terminal regions in Mms5, Mms6, Mms7, and Mms13 contain dense carboxyl and hydroxyl groups that bind iron ions. Nano-sized magnetic particles similar to those in magnetic bacteria were prepared by chemical synthesis of magnetite in the presence of the acidic protein Mms6. These proteins may be directly involved in biological magnetite crystal formation in magnetic bacteria. bacterial magnetic particles 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine Magnetic bacteria synthesize nano-sized magnetic particles of an iron oxide, magnetite (Fe3O4); an iron sulfide, greigite (Fe3S4); or a combination of greigite and iron pyrite (Fe2S) (1Frankel R.B. Blakemore R.P. Wolfe R.S. Science. 1979; 203: 1355-1356Google Scholar, 2Sakaguchi T. Burgess J.G. Matsunaga T. Nature. 1993; 365: 47-49Google Scholar, 3Mann S. Sparks N.H.C. Frankel R.B. Bazylinski D.A. Jannasch H.W. Nature. 1990; 343: 258-261Google Scholar). These particles are individually covered with a stable lipid bilayer membrane that mainly consists of lipid and protein (4Gorby Y.A. Beveridge T.J. Blakemore R.P. J. Bacteriol. 1988; 170: 834-841Google Scholar). The mineral size, type, and morphology of bacterial magnetic particles (BMPs)1 are highly controlled within bacterial species or strains (5Spring S. Schleifer K.H. Syst. Appl. Microbiol. 1995; 18: 147-153Google Scholar). The species-specific control of BMP formation has focused attention on the possible roles of the surrounding membrane structures. The molecular mechanism of BMP synthesis is a multistep process, including vesicle formation, iron transport, and magnetite crystallization (5Spring S. Schleifer K.H. Syst. Appl. Microbiol. 1995; 18: 147-153Google Scholar, 6Schüler D. J. Mol. Microbiol. Biotechnol. 1999; 1: 79-86Google Scholar). Recent molecular studies have postulated the steps of BMP synthesis (7Okamura Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar, 8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google Scholar, 9Nakamura C. Burgess J.G. Sode K. Matsunaga T. J. Biol. Chem. 1995; 270: 28392-28396Google Scholar). Several proteins located on or in the BMP membrane have been isolated and analyzed in Magnetospirillum magneticum strain AMB-1. The first event of BMP synthesis is the formation of vesicles. Invagination of the cytoplasmic membrane is primed by a BMP membrane-specific GTPase (Mms16) to form the intracellular vesicle (7Okamura Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar). MpsA, a homolog of an acetyltransferase containing a CoA-binding motif, is also considered to be involved in this process (8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google Scholar). The second process in BMP synthesis is iron transport into the BMP vesicles. It appears that ferric iron is reduced on the cell surface, taken into the cytoplasm, transported into the BMP vesicle, and finally oxidized to produce magnetite. The magAgene was isolated through transposon mutagenesis in strain AMB-1 (9Nakamura C. Burgess J.G. Sode K. Matsunaga T. J. Biol. Chem. 1995; 270: 28392-28396Google Scholar). This gene encodes an integral membrane protein that is involved in the transport of iron into the BMP vesicles. The last process is crystallization of magnetite within the vesicle, but the process remains unclear. Other proteins associated with the BMP membrane have been partially characterized in magnetic bacteria to date. Gorby et al. (4Gorby Y.A. Beveridge T.J. Blakemore R.P. J. Bacteriol. 1988; 170: 834-841Google Scholar) observed two specific proteins in the BMP membrane fromMagnetospirillum magnetotacticum MS-1. Okuda et al. (10Okuda Y. Denda K. Fukumori Y. Gene (Amst.). 1996; 171: 99-102Google Scholar) identified three additional specific proteins and determined the nucleotide/amino acid sequence of a 22-kDa protein. From motif analysis, this is considered to function as a receptor interacting with associated cytoplasmic proteins (11Okuda Y. Fukumori Y. FEBS Lett. 2001; 491: 169-173Google Scholar). Recently, Grünberg et al. (12Grünberg K. Wawer C. Tebo B.M. Schüler D. Appl. Environ. Microbiol. 2001; 67: 4573-4582Google Scholar) cloned and sequenced four genes that were assigned to two different genomic regions coding for BMP membrane-specific proteins in Magnetospirillum gryphiswaldense MSR-1. To understand the molecular mechanism of magnetite crystallization inM. magneticum AMB-1, several proteins tightly bound to the bacterial magnetite crystals were isolated and characterized. A new class of mineral-associated proteins that may have important roles in the initiation of nucleation and magnetite crystal growth is described. Escherichia colistrains DH5α and BL21 were used for gene cloning and protein expression, respectively. E. coli cells were cultured in Luria broth at 37 °C after adding appropriate antibiotics. M. magneticum AMB-1 (ATCC700264) was grown anaerobically in an 8-liter fermentor as described previously (13Yang C.D. Takeyama H. Tanaka T. Matsunaga T. Enzyme Microb. Technol. 2001; 29: 13-19Google Scholar). BMPs were extracted from 8 liters of fed-batch culture and washed 20 times with HEPES (pH 7.0). The other cell fractions were also prepared as described previously (8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google Scholar). The purified BMPs were treated three times with 800 μl of 7 m urea, 2 m thiourea, 4% (w/v) CHAPS, and 40 mm Tris base solution with weak sonication to remove membrane-associated proteins and washed with HEPES several times. To isolate the tightly bound proteins, BMPs were treated three times with 800 μl of 1% (w/v) SDS in a 100 °C water bath for 30 min. During this process, the sample was treated briefly in an ultrasonic bath. After several washings, BMPs were treated with 20 ml of 2 m hydrofluoric acid plus 8 m ammonium hydrofluoride solution (pH 5.0). The dissolved material was dialyzed several times against 4 liters of fresh HEPES. The sample was precipitated by the same volume of 20% (w/v) trichloroacetic acid and resuspended in 400 μl of 0.1% SDS solution. The amount of protein on BMPs was evaluated using a modified Lowry method (14Markwell M.A. Haas S.M. Bieber L.L. Tolbert M.E. Anal. Biochem. 1978; 87: 206-210Google Scholar). One-hundred microliters of 1 n NaOH and 0.02% (w/v) SDS solution was added to 1 mg of BMPs and incubated in a 100 °C water bath for 10 min. After the BMPs were removed by centrifugation, the supernatant was used to measure the protein amount using bovine serum albumin as a standard. Protein concentrations in solution were measured using a protein assay kit (Bio-Rad) and adjusted before electrophoresis. Each fraction was mixed in the same volume of 2× sample buffer (0.125 m Tris-HCl (pH 6.8), 10% mercaptoethanol, 4% SDS, 10% sucrose, and 0.004% bromphenol blue) and denatured by boiling. A 3% stacking gel and a 15% resolving gel were used according to the method of Laemmli (15Laemmli U.K. Nature. 1970; 227: 680-685Google Scholar). Tricine/SDS-PAGE was performed according to the method of Schägger and von Jagow (16Schägger H. von Jagow G. Anal. Biochem. 1987; 166: 368-379Google Scholar). Gels were stained with Coomassie Brilliant Blue R-250 or SYPRO Ruby (Molecular Probes, Inc., Eugene, OR). The molecular mass was calculated from a standard linear regression curve using a low molecular mass calibration kit (Amersham Biosciences, Uppsala, Sweden) and polypeptide SDS-PAGE molecular mass standards (Bio-Rad). Western analysis was performed by electroblotting polyacrylamide gels onto polyvinylidene difluoride membranes (ImmobilonTM-P, Millipore Corp., Bedford, MA). The membranes were immunostained with mouse anti-His monoclonal antibody (cat no. 34670, QIAGEN GmbH) at a 1:5000 dilution and developed with alkaline phosphatase-coupled goat anti-mouse IgG secondary antibody (cat no. 59296, ICN Biomedicals Inc., Aurora, OH). Two-dimensional PAGE was carried out by the method of O'Farrel (17O'Farrel P.H. J. Biol. Chem. 1975; 250: 4007-4021Google Scholar). The first dimension was carried out with immobilized dry strip gels (pH 3–10; 130 mm) using the electrophoresis apparatus immobilized pH gradients Phor II (Amersham Biosciences). The strips were rehydrated with buffer containing of 7 m urea, 2 m thiourea, 4% (w/v) CHAPS, 40 mm Tris base, 19.4 mm dithiothreitol, 0.5% (v/v) carrier ampholytes (Amersham Biosciences), and traces of bromphenol blue at 20 °C for 12 h. The strips were run with the following program: step 1, 500 V for 2 h; step 2, 1000 V for 2 h; step 3, 8000 V (gradient) for 4 h; and step 4, 8000 V (hold) for 2 h. The second dimension was carried out with Tricine/SDS gels as described above. The two-dimensional gels were stained with Coomassie Brilliant Blue R-250. CarbamylyteTM calibration markers (Amersham Biosciences) were used to estimate the pI of the proteins. After gel electrophoresis, gels were electroblotted onto ImmobilonTM-PSQ (Millipore Corp.). The membrane was stained with Coomassie Brilliant Blue R-250, and identified protein spots were excised. Amino acid sequencing of the proteins/peptides was performed by automated Edman degradation using a Shimadzu PPSQ-1 amino acid sequencing system. Oligonucleotide primers were designed using the N-terminal amino acid sequence. The codon usage pattern of previously reported proteins in strain AMB-1 was used (7Okamura Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar, 8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google Scholar, 9Nakamura C. Burgess J.G. Sode K. Matsunaga T. J. Biol. Chem. 1995; 270: 28392-28396Google Scholar). Gene walking was performed to obtain the entire gene encoding the Mms5 and Mms6 proteins. Primer S1 (CAGGCCCTTGCCGGTCCAGATGGT) and primer S2 (ATCATCCTGGGCGTTGTTGGCGCC) were used to amplify the mms6 region. Primer S3 (GTGCTGCTGGGCGTGGTCGGCGTG) and primer S4 (CACGCCGACCACGCCCAGCAGCAC) were designed for the mms5 region. To sequence themms7–13 region, primer mms7–13F (GCCTAACCAAATCCAGATGAG) and primer mms7–13R (CCGTAAGGAAAGACAGACACG) were designed from the genome sequence data of M. magneticumAMB-1. 2T. Matsunaga, Y. Okamura, A. T. Wahyudi, Y. Fukuda, and H. Takeyama, manuscript in preparation. The other primers for sequencing the region containing mam7,mam13, and mms6 were designed from the same data base. The preliminary sequence data of M. magnetotacticumMS-1 obtained from the DOE Joint Genome Institute 3Available at www.jgi.doe.gowv/tempweb/JGI_microbial/html/index.html. was used for comparison. The amplified PCR fragment was cloned into the pGEM-T-easy vector (pGEM-T-easy vector system, Promega, Madison, WI) and sequenced using ABI PRISM 377 (PerkinElmer Life Sciences). The computer software package LASERGENE (DNASTAR, Inc. Madison, WI) was used for DNA and protein sequence analyses. The sequence was further analyzed by performing homology searches using the programs FASTA and against the DNA The containing the sequence coding the Mms6 was by cloning PCR into the vector The primer and was used for of the mms6 gene from AMB-1 genomic coli BL21 cells were cultured in ml of Luria broth at 37 °C The protein was purified using a acid The protein was in the same volume of buffer mm 1 mm m 1 mm reduced 10% (v/v) and mm oxidized (pH The purified protein was by in of buffer m 10% and (pH containing 4 and 2 m for was performed in 1 The protein was further dialyzed for several times against 1 of fresh Tris-HCl (pH steps were performed at 4 The of the protein was with and removed by using a membrane (Millipore Corp.). The for the of Mms6 was performed according to and Y. J. Anal. Biochem. 1993; 47-49Google Scholar). was used in the same After of proteins, the membrane was with buffer m Tris-HCl and (pH for 30 min. The membrane was in ml of the same buffer containing (PerkinElmer Life Sciences). The iron in the solution was adjusted to by adding iron was removed by the membrane with buffer three times for 30 min. The membrane was and to and bovine serum albumin were used as and respectively. iron was performed using of proteins. The membrane was in 2 ml of buffer with the or presence of including 1 mm 10 mm 10 mm 10 10 mm 10 mm and 10 was for h. Mms6 was used for magnetite formation by M. Chem. Res. Scholar). Mms6 was added to 100 μl of solution containing mm and mm ferric The solution was using n NaOH solution with A was used to the and The sample was to at and with gel The magnetic particles were at was performed using an After and mg of BMPs was obtained from an 8-liter The presence of membranes the BMPs was by from the protein assay showed that the membrane proteins 3% of the mass of BMPs with a solution containing urea, 2 m thiourea, and 4% with weak of the proteins were previously to Y. Takeyama H. Matsunaga T. Appl. Biochem. Biotechnol. 2000; (8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google and (7Okamura Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar) were observed in this fraction The of the proteins associated with BMPs not be extracted using the same solution. To strip tightly associated proteins, BMPs were three times in 1% SDS solution. of the proteins were and of BMPs were observed 1 The protein of the 1% SDS fraction showed that mainly of low molecular mass proteins 2 amino acid the same protein sample was to two-dimensional gel electrophoresis. spots were identified in the gel 2 The magnetite was dissolved in hydrofluoric acid plus 8 m ammonium hydrofluoride solution (pH to proteins in the bacterial magnetite after protein with 1% SDS solution. The magnetite was dissolved and were observed by 1 protein were observed by SDS-PAGE 2 that proteins on or the of the but not within the The proteins tightly bound to BMPs were further characterized to understand their roles in magnetite of proteins tightly bound to BMPs by protein of cell 1, BMP protein fraction extracted by a solution containing 7 m urea, 2 m thiourea, and 4% 2, cell membrane 3, cytoplasmic 4, BMP protein fraction extracted with 1% SDS material of BMPs treated with 2 m hydrofluoric acid plus ammonium hydrofluoride solution (pH 5.0). of proteins for and μl of sample were The gel was stained with SYPRO two-dimensional gel electrophoresis of the BMP protein fraction extracted with 1% SDS solution. of protein was The gel was stained with Coomassie Brilliant Blue R-250. The identified proteins are to the of A molecular mass The amino acid of the proteins obtained by Edman degradation are in From the obtained sequences, a with an molecular mass of was determined as a homolog of in M. gryphiswaldense (12Grünberg K. Wawer C. Tebo B.M. Schüler D. Appl. Environ. Microbiol. 2001; 67: 4573-4582Google Scholar). The molecular by Tricine/SDS the reported of The protein was as The N-terminal amino acid of the spots at and 7 showed of homology to other and were as Mms5, Mms6, and Mms7, respectively. These proteins have the common sequence from several sequencing that are different proteins. is to the C-terminal of in M. It was reported that the mass of on the SDS gel and the molecular mass calculated from the gene are different (12Grünberg K. Wawer C. Tebo B.M. Schüler D. Appl. Environ. Microbiol. 2001; 67: 4573-4582Google Scholar). These the of of The obtained sequence is the of after amino acid of tightly bound BMP amino acid in a new on the obtained amino acid sequences, primers were designed for the gene sequencing of Mms5 and Mms6. DNA coding were obtained from the AMB-1 sequence for the and several regions were of the FASTA and searches showed that the obtained and amino acid of Mms5 and Mms6 have to are located a in the AMB-1 genome The gene homolog of mms6 was also in the genome sequence of obtained from the data base. The amino acid sequence of Mms6, Mms7, and Mms13 M. magneticum AMB-1 magnetotacticum and respectively. were identified in four proteins. The gene encoding Mms5 was not in the genome sequence of obtained from the data base. The amino acid sequence of Mms6 from the gene is in The sequence encodes a The N-terminal sequence obtained directly from the purified protein is within this sequence. A to by a was using the T. S. Scholar). was a the and the N-terminal sequence obtained by Edman This may be to by specific after protein The N-terminal region hydrophobic amino and computer analysis that this is a region. the C-terminal region of Mms6 is highly with a pI of Amino containing hydroxyl groups were also the region the and C-terminal regions amino as and These features were also observed in Mms5, Mms7, and The proteins are in The hydrophilic in mineral-associated proteins J. Biol. Chem. 2001; 276: Scholar, of Scholar) or with the mineral M. J. Biol. Chem. as previously and of Mms5, Mms6, Mms7, and hydrophobic hydrophilic region. are amino acid in the Mms6 was in E. coli The gene encoding the of Mms6 was amplified by PCR and cloned into the The was coli and The protein was purified from the cell using a acid The N-terminal amino acid of the purified protein was sequenced and that the protein was in E. The protein was and the was removed by The protein sample after step was by gel electrophoresis and Western using anti-His antibody The of and proteins were The of Mms6 was in the presence and of the 7 This that the observed iron is mainly from Mms6, not from the bovine serum albumin not of 10 mm the of to Mms6 and 7 of of to Mms6 not to was also observed in the presence of and This was observed in the presence of and To the of Mms6 on crystal formation, magnetite was the of observed a which to and finally to at The magnetic iron in the presence of Mms6 showed with from 20 to 30 8 The of analysis that the particles were mainly of not The of the was similar to that of BMPs in M. magneticum AMB-1. the magnetic particles in the of Mms6 were in and 8 The observed crystals are similar to as that crystal formation have been isolated from K. J. S. A. Scholar, E. Y. T. J.G. H. J. Biochem. Scholar, K. S. M. J. Biochem. 2000; Scholar) and associated with mineral S. T. T. T. K. Tanaka M. K. Science. Scholar, E. J. Biol. Chem. 2000; Scholar). of by proteins has been reported in E. Y. T. J.G. H. J. Biochem. Scholar, K. S. M. J. Biochem. 2000; K. J. S. A. Scholar, N. M. Science. 1999; and M. J. Biol. Chem. Scholar). of the proteins associated with BMPs has been using SDS (4Gorby Y.A. Beveridge T.J. Blakemore R.P. J. Bacteriol. 1988; 170: 834-841Google Scholar, Y. Denda K. Fukumori Y. Gene (Amst.). 1996; 171: 99-102Google Scholar, K. Wawer C. Tebo B.M. Schüler D. Appl. Environ. Microbiol. 2001; 67: 4573-4582Google Scholar) and (8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google Scholar, Y. Takeyama H. Matsunaga T. Appl. Biochem. Biotechnol. 2000; Scholar) of magnetite crystal formation by the proteins has been this several different protein fractions were by with urea, SDS, and hydrofluoric proteins as (10Okuda Y. Denda K. Fukumori Y. Gene (Amst.). 1996; 171: 99-102Google Scholar, Y. Takeyama H. Matsunaga T. Appl. Biochem. Biotechnol. 2000; (8Matsunaga T. Tsujimura N. Okamura Y. Takeyama H. Biochem. Biophys. Res. Commun. 2000; 268: 932-937Google and (7Okamura Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar) and proteins were removed by with a solution. proteins Mms6, Mms7, and were observed in the same fraction as two-dimensional gel electrophoresis. The four protein spots were in the fraction obtained by SDS The protein solution showed a and the presence of iron was showed in the and of BMPs before and after this that the of the particles were The presence of specific is proteins and BMP protein was not observed in the BMP crystal the proteins bound to the important roles in crystal The four proteins Mms6, Mms7, and showed sequence to proteins. The observed was to the BMP membrane proteins and reported in M. gryphiswaldense (12Grünberg K. Wawer C. Tebo B.M. Schüler D. Appl. Environ. Microbiol. 2001; 67: 4573-4582Google Scholar). features observed within their may a The proteins are mainly of two hydrophobic N-terminal and hydrophilic C-terminal regions. The surrounding the BMP crystal consists of a lipid bilayer membrane (4Gorby Y.A. Beveridge T.J. Blakemore R.P. J. Bacteriol. 1988; 170: 834-841Google Scholar, Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar). The hydrophobic of the N-terminal region may be into the lipid The dense carboxyl and hydroxyl groups in the C-terminal regions may directly with the mineral the proteins that directly with two are initiation of crystal nucleation K. J. S. A. Scholar, K. S. M. J. Biochem. 2000; N. M. Science. 1999; Scholar) and and of crystal growth M. J. Biol. Chem. Scholar, S. S. A. Scholar) and of morphology S. N. and Scholar, N. S. E. M. Science. Scholar). The initiation from the and of on or in the The acidic groups from and are to have with and to as The hydroxyl groups in and also These of amino bind to as and of Scholar). The of groups to and is The iron assay that the observed iron is from the carboxyl and hydroxyl the hydrophilic C-terminal region in Mms6 is considered to crystal nucleation in magnetite It has been reported that a acidic protein dense in the N-terminal region that are for the crystal growth M. J. Biol. Chem. Scholar). the and is the mineral S. S. A. the observed of Mms6 is also to iron a control mechanism of morphology is magnetic the of BMP membrane has been to through of the cytoplasmic membrane (4Gorby Y.A. Beveridge T.J. Blakemore R.P. J. Bacteriol. 1988; 170: 834-841Google Y. Takeyama H. Matsunaga T. J. Biol. Chem. 2001; 276: 48183-48188Google Scholar). The biological through the formation of the chemical process of magnetite formation to be and the of the and mineral through BMP synthesis was R.B. Blakemore R.B. Biophys. Scholar). The first step the of by the of iron of iron to magnetite the nucleation and growth similar to the formation of S. Science. Scholar). have been using groups of lipid as molecular for crystal synthesis by concentrations at M. T. Y. J. Appl. 1999; Scholar). The groups from iron and magnetite magnetite has been in iron by adding Mms6. The observed the of iron and through magnetite. was observed BMP and the crystals obtained from in using Mms6. The C-terminal of the proteins tightly bound to BMPs as for magnetite crystal formation and the of magnetite crystals this the of proteins tightly associated with BMP crystals and their have been Mms6 nucleation for of iron in the BMP S. and S. and for