Concepedia

Abstract

(Current Biology 28, 2365–2376.e1–e5; August 6, 2018) In this article, we characterized roles for CLAVATA in the development of a moss, Physcomitrella patens, focusing on the 2D to 3D growth transition. Ongoing work to further characterize mutant phenotypes identified some phenotype discrepancies among the Ppclv1a and Ppclv1b mutant lines published in the original paper. For this reason, we implemented further checks of the published manuscript and fully sequenced both PpCLV1a and PpCLV1b loci in all mutants originally reported in the Methods S1 figure “CRISPR/Cas9 strategy for generating Ppclv1 mutants.” Although the conclusions of the paper remain valid, our investigations revealed errors that we wish to correct. We found that Ppclv1a line 18 (Figures 4D and 4K; Methods S1, CRISPR figure, panel E) contained an 805 bp deletion at the PpCLV1a locus, but while Ppclv1a line 18 plants had phenotypes resembling WT plants, there was also a 9 bp deletion at PpCLV1b. We found no mutations at PpCLV1a or PpCLV1b in Ppclv1a line 29 or Ppclv1a line 32 (Methods S1, CRISPR figure, panels F and G), and these lines were indistinguishable from WT plants. The genotype of Ppclv1b line 2 (Figures 4E and 4L; Methods S1, CRISPR figure, panel H) was reported as a 2 bp deletion, but genome walking now confirms that there is a 4 bp deletion and >6 kb insertion at PpCLV1b, and the insertion comprises sequence integrated from the pACT::Cas9 expression vector used to engineer the lines [1Lopez-Obando M. Hoffmann B. Géry C. Guyon-Debast A. Téoulé E. Rameau C. Bonhomme S. Nogué F. Simple and efficient targeting of multiple genes through CRISPR-Cas9 in Physcomitrella patens.G3 (Bethesda). 2016; 6: 3647-3653Crossref PubMed Scopus (54) Google Scholar]. The genotypes of Ppclv1b line 9 and Ppclv1b line 33 (Methods S1, CRISPR figure, panels I and J) were not previously reported, and while Ppclv1b line 9 has a 47 bp deletion at the PpCLV1b locus, Ppclv1b line 33 has no mutation at PpCLV1a or PpCLV1b, and an indistinguishable phenotype from WT plants. The reported genotypes of Ppclv1a1b lines 6, 8, and 12 were accurate (Methods S1, CRISPR figure, panels K–M). Consequently, we have re-engineered and fully sequenced PpCLV1a and PpCLV1b in three independent Ppclv1a and Ppclv1b mutant lines to verify the mutant phenotypes reported in Figure 4. The Ppclv1a and Ppclv1b mutant phenotypes previously reported hold true, and the genotypes and phenotypes of lines now in use are shown in Figure 1 below. As we checked our work, we noticed that the genotyping data shown in the Methods S1 figure “Strategy for generating Pprpk2 KO lines” (Methods S1, RPK2 figure, panels B–D) were from different lines to those shown in panel E, and we wish to substitute Figure 2 (below) for this panel. At a late stage of manuscript preparation, the labels for PpCLV1a and PpCLV1b in Figure S5 and Tables S1 and S3 were transposed from labels elsewhere in the manuscript. The correct identifiers for these genes are as follows:PpCLV1a Pp1s14_447V6.1 (V1.6 genome [2Rensing S.A. Lang D. Zimmer A.D. Terry A. Salamov A. Shapiro H. Nishiyama T. Perroud P.-F. Lindquist E.A. Kamisugi Y. et al.The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants.Science. 2008; 319: 64-69Crossref PubMed Scopus (1338) Google Scholar]) and Pp3c6_21940V1.1 (V3 genome [3Lang D. Ullrich K.K. Murat F. Fuchs J. Jenkins J. Haas F.B. Piednoel M. Gundlach H. Van Bel M. Meyberg R. et al.The Physcomitrella patens chromosome-scale assembly reveals moss genome structure and evolution.Plant J. 2018; 93: 515-533Crossref PubMed Scopus (179) Google Scholar])PpCLV1b Pp1s5_68V6.1 (V1.6 genome [2Rensing S.A. Lang D. Zimmer A.D. Terry A. Salamov A. Shapiro H. Nishiyama T. Perroud P.-F. Lindquist E.A. Kamisugi Y. et al.The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants.Science. 2008; 319: 64-69Crossref PubMed Scopus (1338) Google Scholar]) and Pp3c13_13360V1.1 (V3 genome [3Lang D. Ullrich K.K. Murat F. Fuchs J. Jenkins J. Haas F.B. Piednoel M. Gundlach H. Van Bel M. Meyberg R. et al.The Physcomitrella patens chromosome-scale assembly reveals moss genome structure and evolution.Plant J. 2018; 93: 515-533Crossref PubMed Scopus (179) Google Scholar]). The Lead Contact wishes to apologize to the scientific community for the errors above and any consequent confusion, and thanks Zoe Nemec Venza (University of Bristol), Joe Cammarata (Cornell University), and Wei Liu (University of Bristol) for doing the experimental work required for the correction. We also thank two anonymous referees for commenting on a draft correction notice. Genomic DNA was extracted using a CTAB (hexadecyltrimethylammonium bromide) protocol as described in the original paper. PpCLV1a and PpCLV1b loci were Sanger sequenced using c. 150 ng template DNA with forward and reverse primers listed in Table 1, below. Sequence traces were analyzed by hand using Chromas Lite software, aligned using BioEdit software, and compared to genome sequence data from the V1.6 Physcomitrella genome [2Rensing S.A. Lang D. Zimmer A.D. Terry A. Salamov A. Shapiro H. Nishiyama T. Perroud P.-F. Lindquist E.A. Kamisugi Y. et al.The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants.Science. 2008; 319: 64-69Crossref PubMed Scopus (1338) Google Scholar]. A genome walking protocol was adapted from [4Siebert P.D. Chenchik A. Kellogg D.E. Lukyanov K.A. Lukyanov S.A. An improved PCR method for walking in uncloned genomic DNA.Nucleic Acids Res. 1995; 23: 1087-1088Crossref PubMed Scopus (895) Google Scholar]. Genomic DNA was extracted from WT and Ppclv1b line 2 plants as above, but with an additional phenol-chloroform-isoamyl alcohol (24:24:1) step following extraction. 1 μg DNA was digested to completion using EcoRV, PvuII, or HpaI and cleaned using a Zymoclean Gel DNA Recovery kit. 20 μL each of 50 mM GenomeWalkerAdaptor1 and GenomeWalkerAdaptor2 adaptors were mixed in water, heated to 100°C for 2 min, and annealed by cooling to room temperature. To generate genome walking libraries, digested genomic DNA was ligated to the annealed adaptors using T4 DNA ligase. To isolate the 3′ junction between PpCLV1b and insert sequence, two-step touchdown nested PCR was performed using AP1 + GSP1a primers, and then AP2 + GSP2b primers and Q5 polymerase. To isolate the 5′ junction between PpCLV1b and inserted sequence, an M13 primer against the inserted sequence was used with a PpCLV1b locus-specific primer, CLV1Blocus_reverse_8. Amplicons were gel purified using a QIAquick PCR Purification kit and sent for direct sequencing. New Ppclv1a and Ppclv1b CRISPR lines were generated as described in the original paper except a single guide RNA expression vector, U3::Ppclv1a sgRNA7, was used to generate Ppclv1a crA and Ppclv1a crB lines. Plant imaging was undertaken as described in the original paper.Figure 2Strategy for Generating Pprpk2 KO LinesShow full captionMultiple knockout lines whose genotyping data are shown in Methods S1 Pprpk2 figure had similar mutant phenotypes.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table 1List of Genome Walking Primers Used to Prepare the Correction NoticePrimerSequenceGenomeWalkerAdaptor1GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGTGenomeWalkerAdaptor23′-H2N-CCCGACCA-PO4-5′GenomeWalkerAP1GTAATACGACTCACTATAGGGCGenomeWalkerAP2ACTATAGGGCACGCGTGGTGSP1aCAGGAGGAATTGGTCCGGTAAGTGAGTTGSP2bGCTGGGAAAGATCCATACTGAGAAGGAATCLV1Blocus_reverse_8AAACTCAATCGTCGCAGTGCM13fwGTAAAACGACGGCCAGAll primers in 5′-to-3′ orientation unless otherwise stated. Open table in a new tab Table 2List of Sequencing Primers Used to Prepare the Correction NoticePrimerSequenceCLV1Alocus_forward_1TGAGCCTGATTGAATCTTAACGCLV1Alocus_forward_2AACTCGCTCTCAATGGGCCTCTTCCLV1Alocus_forward_3ATCAATCGAATATGTCGTTCCGCLV1Alocus_forward_4ATTCCCAGGCTGAGATGAATGCLV1Alocus_forward_5ATAGGACCAGAGAGGTTGTTGCLV1Alocus_forward_6GATTATCCTGGATCTCTACCATTGCLV1Alocus_forward_7CGAGATGATTGTTCATCAAGCTCCLV1Alocus_forward_8TCCTCCCAGACTTACGTGTTCCLV1Alocus_reverse_1AAAGATGGAGTGCTGGACTTGCLV1Alocus_reverse_2AATCCAGGCTGCACATGGTCTTTGCLV1Alocus_reverse_3GGTACTTGACTGCTTGGACGCLV1Alocus_reverse_4CCGCAATGATGGTGCTCCTTGTAGCLV1Alocus_reverse_5ATGAGCGGGAACAATTTATCAGCLV1Alocus_reverse_6ATCCTCTGAATCCAATGCCGCLV1Alocus_reverse_7CTGGTTGGAGCAATCCCACATGAGCLV1Alocus_reverse_8GATAACTTGTCTGAAGCCCATCCLV1Alocus_reverse_9GGCCGAAGTGAGGTACATATTTAGCLV1Blocus_forward_1CTGAGTGAGAAGAGTGACACATCCLV1Blocus_forward_2ACGTCGAGTCTCTACGCAACCLV1Blocus_forward_3CCCTTTATACACAGTTCCAGCCLV1Blocus_forward_4GTATGAGAAGTCGAATACGTTGAGCLV1Blocus_forward_5GATCGACCCATTCAGAAGATTGCLV1Blocus_forward_6TGCAGGAACATGGAGTCGAGATTGCLV1Blocus_forward_7CGTGTGCATTACTTCCTGTGTTGCLV1Blocus_forward_8TCTTCACCATTCTTGCTTCTGCLV1Blocus_forward_9TGTTACTGCGAAGTGTGCTACLV1Blocus_reverse_1TTAGGGTGGTGCATGAACTGCTTGCLV1Blocus_reverse_2CGGATTCTCAGCAGAGATTCAAACCLV1Blocus_reverse_3AATAACCTCTCAGGACCAATTCCCLV1Blocus_reverse_4CGTTGGGTTTGCTTGGCTTGCLV1Blocus_reverse_5ATGAACTCGTAGGTGTCATCCCCLV1Blocus_reverse_6CAGGAAGTAATGCACACGCCCLV1Blocus_reverse_7ACGCAACTTCCATATAGTCTCTGCCLV1Blocus_reverse_7aGGAGAGACGCAACTTCCATATAGCLV1Blocus_reverse_8AAACTCAATCGTCGCAGTGC Open table in a new tab Multiple knockout lines whose genotyping data are shown in Methods S1 Pprpk2 figure had similar mutant phenotypes. All primers in 5′-to-3′ orientation unless otherwise stated. CLAVATA Was a Genetic Novelty for the Morphological Innovation of 3D Growth in Land PlantsWhitewoods et al.Current BiologyJuly 19, 2018In BriefWhitewoods, Cammarata, et al. show that a conserved CLAVATA (CLV) pathway arose in the last common ancestor of land plants. CLV regulates cell division plane orientation during the 2D to 3D growth transition in a moss, and roles for CLV are shared between mosses and flowering plants, suggesting that CLV enabled 3D growth to arise in land plants. Full-Text PDF Open Access

References

YearCitations

Page 1