Publication | Closed Access
Loquat Is a New Natural Host of Apple Stem Grooving Virus and Apple Chlorotic Leaf Spot Virus in China
12
Citations
4
References
2019
Year
Apple StemPlant-pathogen InteractionPlant VirusPlant-virus InteractionMedicinePathogenesisPathologyVirologyHomeplant DiseasevolPlant PathologyMicrobiologyCitrus EngineeringNew Natural HostPlant Health
HomePlant DiseaseVol. 103, No. 12Loquat Is a New Natural Host of Apple Stem Grooving Virus and Apple Chlorotic Leaf Spot Virus in China PreviousNext DISEASE NOTES OPENOpen Access licenseLoquat Is a New Natural Host of Apple Stem Grooving Virus and Apple Chlorotic Leaf Spot Virus in ChinaQiyan Liu, Zhiyou Xuan, Jiaxing Wu, Yuanjian Qiu, Min Li, Song Zhang, Di Wu, Ruhui Li, and Mengji CaoQiyan LiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China, Zhiyou XuanNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China, Jiaxing WuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China, Yuanjian QiuNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China, Min LiNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China, Song ZhangNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China, Di WuCollege of Horticulture and Landscape Architecture, Southwest University, Chongqing, 400715, China, Ruhui Lihttp://orcid.org/0000-0002-9271-4208USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A., and Mengji Cao†Corresponding author: M. Cao; E-mail Address: caomengji@cric.cnhttp://orcid.org/0000-0003-0396-262XNational Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, ChinaAcademy of Agricultural Sciences, Southwest University, Chongqing 400715, China AffiliationsAuthors and Affiliations Qiyan Liu1 2 Zhiyou Xuan1 2 Jiaxing Wu1 2 Yuanjian Qiu1 2 Min Li1 2 Song Zhang1 2 Di Wu3 Ruhui Li4 Mengji Cao1 2 † 1National Citrus Engineering and Technology Research Center, Citrus Research Institute, Southwest University, Beibei, Chongqing 400712, China 2Academy of Agricultural Sciences, Southwest University, Chongqing 400715, China 3College of Horticulture and Landscape Architecture, Southwest University, Chongqing, 400715, China 4USDA-ARS, National Germplasm Resources Laboratory, Beltsville, MD 20705, U.S.A. Published Online:26 Sep 2019https://doi.org/10.1094/PDIS-04-19-0721-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Loquat (Eriobotrya japonica) is an evergreen tree species in the family Rosaceae. It is native to the cooler mountain regions of China to south-central China and cultivated in Asia and Europe for its fruit and as an ornamental (Janick et al. 2015; Lin et al. 2010). Leaves and fruits of loquats have traditionally been considered to have high medicinal value (Lin et al. 2007). In March 2018, a leaf curl symptom was observed on loquat trees in an orchard in Chongqing. A literature search did not reveal any reports describing viral pathogens infecting loquats, although several bacterial and fungal diseases have been documented (Man in 't Veld et al. 2001; Wimalajeewa et al. 1978). To investigate the etiology of the symptoms, total RNA was extracted using EASYspin Plus Complex Plant RNA Kit (Aidlab Biotech) from the leaves of one symptomatic loquat tree. An rRNA-depleted library was subsequently built and sequenced by Illumina HiSeq X-ten platform. A total of 4,627,397 paired-end reads of 150 bp were obtained after removing the reads mapped to apple genome (Velasco et al. 2010). De novo assembly of the reads generated 112,563 contigs (>200 nt). BLAST analyses revealed that two contigs of 6,432 and 6,402 nt, and one contig of 7,501 nt, had high identities with Apple stem grooving virus and Apple chlorotic leaf spot virus, the members of the genus Capillovirus and Trichovirus, respectively. Virus infection in the loquat sample was reconfirmed by direct tissue blot immunoassay assay using the polyclonal antibody of ASGV and ACLSV (kindly gifted by Ni Hong of Huazhong Agriculture University). To obtain the complete viral genome sequences, reverse transcription PCR (RT-PCR) was performed using overlapping primer pairs designed from contig sequences of each virus. The 5′ and 3′ terminal sequences of each virus were amplified by rapid amplification of cDNA ends (RACE kit, Invitrogen). The amplicons were purified, cloned into the pGEM-T Easy Vector, and sequenced as described by Cao et al. (2018). The complete sequences of the viral isolates were determined to be 6,496 nt (ASGV-L2, MK599421), 6,496 nt (ASGV-L3, MK599422), and 7,542 nt (ACLSV-L1, MK599420). Global sequence alignment of ASGV-L2 and ASGV-L3 using the Needleman–Wunsch algorithm showed 87.9% nt identity. Sequence and phylogenetic analyses revealed that ASGV-L2 and ASGV-L3 were separated into two evolutionary paths most closely with ASGV isolates MTH (KC588948; 90.7% nt identity) and HH (JN701424; 91.4% nt identity) from citrus. Likewise, analyses suggested ACLSV-L1 is closest (83.7% nt identity) to ACLSV-SY02 isolate of hawthorn (KU870524). To further validate the ACLSV and ASGV infections in the loquats, isolate-specific primer pairs ASGV-L2F-1996 (CTTGGTCACAAAGGGTCTCTCA)/ASGV-L2R-2382 (AATCCAAGTCTTAGCCCAACAA), ASGV-L3F-2150 (AAGAAGGTGGTGAAGCACAGAT)/ASGV-L3R-2565 (TTCCATAAAGGTCCCATCAATC), and ACLSV-L1F-3748 (AATGACTTCACGGGCATAGATC)/ACLSV-L1R-4621 (GGTATTTTCCTTTACTTTCCGC), with 386-, 415-, and 873-bp expected amplicons, respectively, were used in RT-PCR to test 54 samples (30 were symptomatic and 24 asymptomatic). The results, in which 24 symptomatic samples were positive for ASGV (L2 and L3, 80%) and seven were positive for ACLSV (23%), whereas ASGV-infected asymptomatic samples were only three, showed association of ASGV with the symptoms. To our knowledge, this is the first report of natural infection of viral pathogens in loquats, showing the expanding host range of the viruses and our knowledge of virus diversity.The author(s) declare no conflict of interest.References:Cao, M., et al. 2018. Arch. Virol. 163:3479. https://doi.org/10.1007/s00705-018-4039-8 Crossref, ISI, Google ScholarJanick, J., et al. 2015. Acta Hortic. 1092:25. https://doi.org/10.17660/ActaHortic.2015.1092.2 Crossref, Google ScholarLin, S., et al. 2007. Chron. Hortic. 47:12. Google ScholarLin, S., et al. 2010. Hortic. Rev. (Am. Soc. Hortic. Sci.) 23. doi: 10.1002/9780470650752.ch5doi.org/10.1002/9780470650752.ch5 Google ScholarMan in 't Veld, W. A. et al. 2001. Plant Dis. 85:98. https://doi.org/10.1094/PDIS.2001.85.1.98B Link, Google ScholarVelasco, R., et al. 2010. Nat. Genet. 42:833. https://doi.org/10.1038/ng.654 Crossref, ISI, Google ScholarWimalajeewa, D. L. S., et al. 1978. Australas. Plant Pathol. 7:33. https://doi.org/10.1071/APP9780033 Crossref, Google ScholarThe authors thank Ni Hong of Huazhong Agriculture University, who kindly gifted the polyclonal antibody of ASGV and ACLSV to them.The author(s) declare no conflict of interest.Funding: This research was supported by the Intergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China's National Key R&D Programme (NKP) (2017YFE0110900), Fundamental Research Funds for the Central Universities (XDJK2018AA002), Chongqing Research Program of Basic Research and Frontier Technology (cstc2017jcyjBX0016), and Overseas Expertise Introduction Project for Discipline Innovation (111 Center) (B18044).DetailsFiguresLiterature CitedRelated Vol. 103, No. 12 December 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionChlorotic symptom of Paris polyphylla var. yunnanensis infected by PMMoV-QJ (Wen et al.). Photo credit: M. F. Zhao. Symptoms of Puccinia triticina on wheat (Brar et al.). Photo credit: G. S. Brar. Metrics Downloaded 3,053 times Article History Issue Date: 21 Nov 2019Published: 26 Sep 2019First Look: 19 Jul 2019Accepted: 15 Jul 2019 Pages: 3290-3290 Information© 2019 The American Phytopathological SocietyFundingIntergovernmental International Science, Technology and Innovation (STI) Collaboration Key Project of China's National Key R&D Programme (NKP)Grant/Award Number: 2017YFE0110900Fundamental Research Funds for the Central UniversitiesGrant/Award Number: XDJK2018AA002Chongqing Research Program of Basic Research and Frontier TechnologyGrant/Award Number: cstc2017jcyjBX0016Overseas Expertise Introduction Project for Discipline Innovation (111 Center)Grant/Award Number: B18044KeywordsloquatvirusASGVACLSVNGSThe author(s) declare no conflict of interest.Cited ByBiological and molecular characterization of two isolates of apple stem grooving virus revealed distinct properties and indicates virus emergence driven by recombination30 September 2021 | Journal of Phytopathology, Vol. 149First report of Cnidium officinale as a natural host plant of Apple stem grooving virus in South Korea28 July 2021 | Plant Disease, Vol. 44Loquat (Eriobotrya japonica) Is a New Natural Host of Apple Stem Pitting Virus13 November 2020 | Plants, Vol. 9, No. 11Frontiers in Microbiology, Vol. 11Complete nucleotide sequence of loquat virus A, a member of the family Betaflexiviridae with a novel genome organization26 October 2019 | Archives of Virology, Vol. 165, No. 1
| Year | Citations | |
|---|---|---|
Page 1
Page 1