Publication | Open Access
Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA Asp
10
Citations
23
References
1981
Year
A mitochondrial aspartate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAUUm(1)AGUAAAAUAAUUACA psi AACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCAOH, can be arranged in a cloverleaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-psi-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G.C base pair adjacent to loop IV, predominance of A.U base pairs in general, and presence of m1A in position 9. The RNA exhibits 82 and 70% homology with the DNA-derived putative sequences of human placenta and beef heart mitochondrial tRNA Asp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.
| Year | Citations | |
|---|---|---|
Page 1
Page 1