Letters in Applied Microbiology · 1993 · 23 citations · 12 references
Life SciencesMicrobiologyMolecular BiologyDna ReplicationGenomicsMicrobial GeneticsMolecular CloningPlasmid BiologyPlasmid GeneticsPlasmid ReplicationReplication In ProkaryotesReplication OriginsInitiation Of Plasmid ReplicationPlasmid CloningPlasmid Replication In Gram-positive BacteriaPlasmid Replication OriginsPlasmid Replication ProteinsPlasmid VectorsReplication Origin RecognitionReplication Origin Structure
The replication region of a limited host range lactococcal vector, pVS40, was located within a 2359 bp EcoRI--ClaI fragment. Within this fragment a sequence for a 1197 bp reading frame coding for a 46,826 Da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. Immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (TATAGCGTATGAAAAAACTGTG), suggesting an origin of replication. The protein has considerable homologies to certain lactococcal plasmid replication proteins.
12
Molecular cloning: A laboratory manual
Prescott L. Deininger · Analytical Biochemistry · 1990 · 86.2K citations