The nucleotide sequence for the replication region of pVS40, a lactococcal food grade cloning vector

Abstract

The replication region of a limited host range lactococcal vector, pVS40, was located within a 2359 bp EcoRI--ClaI fragment. Within this fragment a sequence for a 1197 bp reading frame coding for a 46,826 Da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. Immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (TATAGCGTATGAAAAAACTGTG), suggesting an origin of replication. The protein has considerable homologies to certain lactococcal plasmid replication proteins.