Assembly of Vault-like Particles in Insect Cells Expressing Only the Major Vault Protein

Abstract

Vaults are the largest (13 megadalton) cytoplasmic ribonucleoprotein particles known to exist in eukaryotic cells. They have a unique barrel-shaped structure with 8-fold symmetry. Although the precise function of vaults is unknown, their wide distribution and highly conserved morphology in eukaryotes suggests that their function is essential and that their structure must be important for their function. The 100-kDa major vault protein (MVP) constitutes ∼75% of the particle mass and is predicted to form the central barrel portion of the vault. To gain insight into the mechanisms for vault assembly, we have expressed rat MVP in the Sf9 insect cell line using a baculovirus vector. Our results show that the expression of the rat MVP alone can direct the formation of particles that have biochemical characteristics similar to endogenous rat vaults and display the distinct vault-like morphology when negatively stained and examined by electron microscopy. These particles are the first example of a single protein polymerizing into a non-spherically, non-cylindrically symmetrical structure. Understanding vault assembly will enable us to design agents that disrupt vault formation and hence aid in elucidating vault functionin vivo. Vaults are the largest (13 megadalton) cytoplasmic ribonucleoprotein particles known to exist in eukaryotic cells. They have a unique barrel-shaped structure with 8-fold symmetry. Although the precise function of vaults is unknown, their wide distribution and highly conserved morphology in eukaryotes suggests that their function is essential and that their structure must be important for their function. The 100-kDa major vault protein (MVP) constitutes ∼75% of the particle mass and is predicted to form the central barrel portion of the vault. To gain insight into the mechanisms for vault assembly, we have expressed rat MVP in the Sf9 insect cell line using a baculovirus vector. Our results show that the expression of the rat MVP alone can direct the formation of particles that have biochemical characteristics similar to endogenous rat vaults and display the distinct vault-like morphology when negatively stained and examined by electron microscopy. These particles are the first example of a single protein polymerizing into a non-spherically, non-cylindrically symmetrical structure. Understanding vault assembly will enable us to design agents that disrupt vault formation and hence aid in elucidating vault functionin vivo. major vault protein vault poly(A)DP-ribose polymerase telomerase-associated protein 1 electron microscopy phenylmethylsulfonyl fluoride vault-like particle Vaults are predominantly cytoplasmic ribonucleoprotein particles that have been conserved throughout evolution and are found in phylogenies as diverse as those of mammals, avians, amphibians, sea urchins, and slime molds (1Kedersha N.L. Miquel M.C. Bittner D. Rome L.H. J. Cell Biol. 1990; 110: 895-901Crossref PubMed Scopus (126) Google Scholar). Many different roles including nucleocytoplasmic transport have been proposed for vaults since their first description in 1986 (2Kedersha N.L. Rome L.H. J. Cell Biol. 1986; 103: 699-709Crossref PubMed Scopus (248) Google Scholar). However, their normal cellular function remains nebulous. Mammalian vaults comprise three proteins, the major vault protein (MVP)1 (3Kedersha N.L. Heuser J.E. Chugani D.C. Rome L.H. J. Cell Biol. 1991; 112: 225-235Crossref PubMed Scopus (142) Google Scholar), the vault poly(A)DP-ribose polymerase (VPARP) (4Kickhoefer V.A. Siva A.C. Kedersha N.L. Inman E.M. Ruland C. Streuli M. Rome L.H. J. Cell Biol. 1999; 146: 917-928Crossref PubMed Scopus (334) Google Scholar), and the telomerase-associated protein 1 (TEP1) (5Kickhoefer V.A. Stephen A.G. Harrington L. Robinson M.O. Rome L.H. J. Biol. Chem. 1999; 274: 32712-32717Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar) and one or more small untranslated RNAs (6Kickhoefer V.A. Searles R.P. Kedersha N.L. Garber M.E. Johnson D.L. Rome L.H. J. Biol. Chem. 1993; 268: 7868-7873Abstract Full Text PDF PubMed Google Scholar). Vaults have been implicated in the phenomenon of multidrug resistance and as prognostic markers for cancer chemotherapy failure (7Kickhoefer V.A. Rajavel K.S. Scheffer G.L. Dalton W.S. Scheper R.J. Rome L.H. J. Biol. Chem. 1998; 273: 8971-8974Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 8Izquierdo M.A. Scheffer G.L. Schroeijers A.B. de Jong M.C. Scheper R.J. Cytotechnology. 1998; 27: 137-148Crossref PubMed Google Scholar). One recent study has shown that the major vault protein is involved directly in the efflux of drugs from the nucleus (9Kitazono M. Sumizawa T. Takebayashi Y. Chen Z.S. Furukawa T. Nagayama S. Tani A. Takao S. Aikou T. Akiyama S. J. Natl. Cancer Inst. 1999; 91: 1647-1653Crossref PubMed Scopus (184) Google Scholar). Although the majority of vaults are found in the cytoplasm, small amounts have been localized to the nuclear pore complexes (10Chugani D.C. Rome L.H. Kedersha N.L. J. Cell Sci. 1993; 106: 23-29Crossref PubMed Google Scholar). Recently a 31-Å resolution structure of the vault has been published indicating that vaults have a hollow interior consistent with a transport or sequestration function. Scanning transmission electron microscopic analysis has shown that the molecular mass of the vault is 12.9 ± 1 MDa, and cryo-EM single-particle reconstruction has provided overall dimensions of 42 × 75 nm (11Kong L.B. Siva A.C. Rome L.H. Stewart P.L. Structure. 1999; 7: 371-379Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). Freeze-etch images of the vault on polylysine-coated mica show that each half of the vault midsection can open into eight distinct “petals” (3Kedersha N.L. Heuser J.E. Chugani D.C. Rome L.H. J. Cell Biol. 1991; 112: 225-235Crossref PubMed Scopus (142) Google Scholar), which has lead to the proposal that vaults may open and close in vivo. The MVP is presumed to be present in 96 copies/vault, based on the observed symmetry of the particle and the estimate that MVP accounts for ∼75% of the total protein mass in the particle. In many ways vaults are reminiscent of virus particles, in that they are MDa assemblies that have a protein shell composed of multiple copies of a single protein and have a large central cavity. The expression of specific viral proteins in baculovirus has become an invaluable tool for investigating the assembly of virus particles (12Kirnbauer R. Taub J. Greenstone H. Roden R. Durst M. Gissmann L. Lowy D.R. Schiller J.T. J. Virol. 1993; 67: 6929-6936Crossref PubMed Google Scholar, 13Roy P. Mikhailov M. Bishop D.H. Gene. 1997; 190: 119-129Crossref PubMed Scopus (26) Google Scholar, 14Li T.C. Yamakawa Y. Suzuki K. Tatsumi M. Razak M.A. Uchida T. Takeda N. Miyamura T. J. Virol. 1997; 71: 7207-7213Crossref PubMed Google Scholar). There are numerous examples where expression of a single viral protein was capable of directing the formation of virus-like particles (12Kirnbauer R. Taub J. Greenstone H. Roden R. Durst M. Gissmann L. Lowy D.R. Schiller J.T. J. Virol. 1993; 67: 6929-6936Crossref PubMed Google Scholar, 15Gheysen D. Jacobs E. de Foresta F. Thiriart C. Francotte M. Thines D. De Wilde M. Cell. 1989; 59: 103-112Abstract Full Text PDF PubMed Scopus (601) Google Scholar,16Wang M.Y. Kuo Y.Y. Lee M.S. Doong S.R. Ho J.Y. Lee L.H. Biotechnol. Bioeng. 2000; 67: 104-111Crossref PubMed Scopus (34) Google Scholar). However, other studies required expression of multiple viral proteins (13Roy P. Mikhailov M. Bishop D.H. Gene. 1997; 190: 119-129Crossref PubMed Scopus (26) Google Scholar, 14Li T.C. Yamakawa Y. Suzuki K. Tatsumi M. Razak M.A. Uchida T. Takeda N. Miyamura T. J. Virol. 1997; 71: 7207-7213Crossref PubMed Google Scholar). Currently nothing is known of the mechanisms by which vault particles are assembled within the cell. Toward this goal, we have expressed rat MVP in the Sf9 insect cell line using a baculovirus vector. Here we show that the expression of the rat MVP alone results in the formation of particles that have characteristics similar to endogenous rat vaults. The His-T7 tag was amplified by polymerase chain reaction from the pET28a plasmid (Novagen) using the T7 primer (Life Technologies, Inc.) and TCAGCCATGGCCATTTGCTGTCCACCAG, which contains a NcoI site. The amplified His-T7 tag was subcloned into the NcoI site at the ATG start site of rat MVP (22Kickhoefer V.A. Rome L.H. Gene. 1994; 151: 257-260Crossref PubMed Scopus (43) Google Scholar). The His-T7-tagged rat MVP was subcloned into the pFASTBAC vector (Life Technologies, Inc.) at the XbaI and KpnI sites. The vsvg-tagged rat MVP, described previously (23Herrmann C. Golkaramnay E. Inman E. Rome L. Volknandt W. J. Cell Biol. 1999; 144: 1163-1172Crossref PubMed Scopus (55) Google Scholar), was subcloned into the pFASTBAC vector using EcoRI. Recombinant baculovirus was then generated as directed in the Bac-to-Bac baculovirus expression system (Life Technologies, Inc.). Sf9 cells adapted for serum-free growth (Life Technologies, Inc.) were cultured at 28 °C on an orbital shaker rotating at 135–150 rpm. Cultures were seeded at 2 × 106 cells/ml, inoculated with virus at a multiplicity of infection of 2.0, and cultured for 48 h. After infection the cells were harvested by centrifugation for 5 min at 500 × g and the pellets stored at −80 °C. Infected cells were resuspended in 10 volumes of buffer A (50 mm Tris-HCl, pH 7.4, 75 mm NaCl, 0.75 mm MgCl2,) containing 1% Triton, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride (PMSF), and a protease inhibitor mixture (2 μg/ml aprotinin, 0.5 μm benzamidine, 2 μg/ml chymostatin, 5 μm leupeptin, 5 μm pepstatin), incubated on ice for 20 min, and then homogenized 10 times with a type A Dounce. Unbroken cells, organelles, and membranes were pelleted by centrifugation at 20,000 × g (S20) for 15 min at 4 °C. Large protein complexes (including vaults) were collected by further centrifugation of the supernatant at 100,000 ×g for 1 h at 4 °C. The pellet (P100) was resuspended by Dounce homogenization with 1 ml of buffer A containing 1 mm dithiothreitol, 1 mm PMSF, and the protease inhibitor mixture. This P100 fraction was then adjusted to 7% sucrose and Ficoll and centrifuged at 43,000 × g for 40 min at 4 °C. The supernatant was collected and diluted 1:3 with buffer A containing 1 mm dithiothreitol, 1 mm PMSF, and the protease inhibitor mixture and centrifuged at 100,000 ×g for at least 3 h to pellet vaults. The pellet was resuspended by Dounce homogenization in 1 ml of buffer A containing 1 mm dithiothreitol, 1 mm PMSF, and the protease inhibitor mixture. To remove contaminating ribosomes, 500 μg of RNase A and 50 units of RNase TI (Ambion) were added and incubated for 20 min at room temperature. The insoluble ribosomal proteins were then pelleted by centrifugation at 20,000 × g for 15 min at 4 °C. The supernatant was loaded onto a sucrose step gradient of 20, 30, 40, 45, 50, and 60% sucrose steps and centrifuged at 78,000 × g for 16 h. The fractions were collected and diluted 1:9 with buffer A containing 1 mm dithiothreitol, 1 mm PMSF, and the protease inhibitor mixture, and the vaults were pelleted by centrifugation at 100,000 × g for 3 h. The pellets were then resuspended in 200 μl of buffer A containing 1 mm dithiothreitol, 1 mm PMSF, and the protease inhibitor mixture and analyzed by silver staining and Western blot. Sucrose gradient fractions were prepared for electron microscopy by absorption of samples onto fresh 1.8-nm-thick carbon film mounted on carbon-coated holey- film grids for 2–5 min at 4 °C. Following sample adsorption, grids were floated for 4 min on 1 ml of 1% uranyl acetate at 4 °C and dried on filter paper prior to viewing in a JEOL 1200EX microscope. The carbon coated holey-film grids and carbon film were the gift of Dr. Sergey Ryazantsev, Department of Biological Chemistry, UCLA School of Medicine. Micrographs were produced digitally from EM negatives (3 × 4 inch) scanned at 1500 dpi resolution in TIFF format using a Scitex scanner and processed using Adobe Photoshop 6.0 software. To study vault assembly, the baculovirus system was used for the expression of epitope (either vsvg or His-T7)-tagged rat MVP in Sf9 cells. Cell extracts from uninfected (control) and infected Sf9 cells were fractionated into a soluble (S100) and particulate (pellet, P100) fraction by centrifugation at 100,000 × g. Epitope-tagged rat MVP expressed in infected Sf9 cells was found abundantly in the P100 (Fig.1 A) similar to mammalian cell expression (2Kedersha N.L. Rome L.H. J. Cell Biol. 1986; 103: 699-709Crossref PubMed Scopus (248) Google Scholar, 7Kickhoefer V.A. Rajavel K.S. Scheffer G.L. Dalton W.S. Scheper R.J. Rome L.H. J. Biol. Chem. 1998; 273: 8971-8974Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). This finding suggested that the expressed MVP was either aggregating or assembling into some type of particle in vivo. No endogenous MVP was detected in cell extracts, S100, or P100 from uninfected (control) Sf9 cells (Fig. 1 A) using an anti-MVP antibody raised to a conserved region in MVP, amino acids 593–805 (17Siva A.C. Raval-Fernandes S. Stephen A.G. La Femina M.J. Scheper R.J. Kickhoefer V.A. Rome L.H. Int. J. Cancer. 2001; 92: 195-202Crossref PubMed Scopus (75) Google Scholar). Several attempts were made to isolate vaults from uninfected Sf9 cells using a modified version of theDictyostelium (a cellular slime mold) vault purification protocol (see “Materials and Methods”). However, during the course of the purification, no proteins were detected that cross-reacted with the anti-MVP antibody described above. In addition, analysis of the purified material by electron microscopy did not reveal any vault-like particles (data not shown). Finally, no MVP homologue has yet been detected in any insect genome. Taken together the above results suggest that either Sf9 cells do not contain vaults or vaults in this organism are so highly divergent as to no longer resemble chemically or physically the vault particle that has been highly conserved from slime mold to man (1Kedersha N.L. Miquel M.C. Bittner D. Rome L.H. J. Cell Biol. 1990; 110: 895-901Crossref PubMed Scopus (126) Google Scholar). When Sf9 cells expressing tagged MVP were subjected to the vault purification protocol, analysis of the purified material showed that the tagged rat MVP was found predominantly in the 40 and 45% sucrose layers (Fig. 1 B) similar to what is found when vaults from numerous tissue culture cell lines are examined (7Kickhoefer V.A. Rajavel K.S. Scheffer G.L. Dalton W.S. Scheper R.J. Rome L.H. J. Biol. Chem. 1998; 273: 8971-8974Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). In addition, the MVP in the 45% sucrose layer constituted ∼95–99% of the material that was silver-stained (Fig. 1 B, upper panel). This fractionation of the rat MVP in the 40 and 45% sucrose layers is consistent with the expressed protein forming a large particle. Expressed rat MVP was also found in the 50 and 60% sucrose fractions, similar to our earlier studies. Because of the abundant protein expression, one concern was that the spread of material from 40–60% sucrose was due to overloading of material onto the sucrose gradient. However, when only one-fifth as much sample was loaded, the same fractionation pattern was observed, and if material from the 60% sucrose fraction was re-applied to a second gradient, it was found to fractionate in the 60% layer (data not shown). Analysis of the material fractionating in the 40 and 45% sucrose layers by electron microscopy (EM) revealed the presence of vault-like particles (VLPs) (Fig. 2, arrowheads). Although a considerable variation in particle morphology was observed, most VLPs were similar in size and shape to purified rat vaults (3Kedersha N.L. Heuser J.E. Chugani D.C. Rome L.H. J. Cell Biol. 1991; 112: 225-235Crossref PubMed Scopus (142) Google Scholar). These particles varied from 32–37 nm in width to 59–65 nm in length and displayed the distinctive bifold symmetric vault central barrel with dual caps (for a gallery of these structures see Fig.3; see also top row, Fig.3 A, for a VLP with the barrel and caps labeled). The dimensions of these particles correlates very closely with negatively stained rat liver vaults examined with the same electron microscope. However, the negatively stained vaults and VLPs are about 15–20% smaller than unstained cryo-images of rat vaults, which have 42 × 75 nm dimensions (11Kong L.B. Siva A.C. Rome L.H. Stewart P.L. Structure. 1999; 7: 371-379Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). These differences are likely due to shrinking of the negatively stained particles during air-drying and some variation in the calibration of the two different microscopes used. The presence of these apparently “complete” structures was unexpected, as vaults from most mammalian species also comprise VPARP and TEP1, two proteins that have been predicted to form the vault cap (18Kong L.B. Siva A.C. Kickhoefer V.A. Rome L.H. Stewart P.L. RNA. 2000; 6: 890-900Crossref PubMed Scopus (65) Google Scholar) as well as the vault RNA. Although it is possible that certain insect proteins could substitute for the high molecular weight VPARP and TEP1 proteins, it is very likely that these complete particles comprise MVP alone. InDictyostelium, vaults appear to be formed of two (and possibly three) highly related MVPs (19Vasu S.K. Kedersha N.L. Rome L.H. J. Biol. Chem. 1993; 268: 15356-15360Abstract Full Text PDF PubMed Google Scholar, 20Vasu S.K. Rome L.H. J. Biol. Chem. 1995; 270: 16588-16594Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). In addition, vaults isolated from Tep1-deficient mice also have a vault morphology with a central barrel and caps on either V.A. Y. L.B. Stewart P.L. Harrington L. Rome L.H. J. Cell Biol. 2001; PubMed Scopus Google Scholar). of the most highly purified fraction of VLPs from Sf9 cells sucrose to any amounts of proteins (see Although these fractions are with to protein silver-stained material is the expressed they are with to However, of the VLPs a distinctive and if one or two endogenous insect proteins were required for cap morphology they likely be with MVP and observed in the silver-stained The of distinct proteins, at of the of MVP, that multiple copies of MVP are for formation of the vault barrel and be that the caps in many of the VLPs Many were than those in vaults, and some were and (see Fig.3 A, arrowheads). A more of VLP structure will a of these it is that multiple copies of a single protein can into a or non-cylindrically symmetrical structure as as the particles formed in Sf9 cells. A, numerous VLPs from the 45% sucrose fraction from Sf9 cells are displayed in a gallery with particles to or caps that were The 50 B, a of VLPs from the 45% sucrose fraction from Sf9 cells. The 50 Large VLPs were observed that appear to be dimensions of × These which are shown in 3 B, resemble vaults generated in purified rat liver with (3Kedersha N.L. Heuser J.E. Chugani D.C. Rome L.H. J. Cell Biol. 1991; 112: 225-235Crossref PubMed Scopus (142) Google Scholar). These structures could be formed in the insect cells by endogenous on MVP or of during There was no in the VLPs formed when either the vsvg or His-T7 were used on the rat MVP, that the of MVP to form these particles is not by the of the tag (data not shown). Taken these biochemical and EM studies show that the rat MVP contains to direct assembly of vault-like particles with characteristics similar to purified endogenous rat vaults. A close of the sucrose gradient fractions that expressed MVP 45, 50, and 60% sucrose revealed structures that appear to assembly and some structures not previously observed in vault The assembly were open that were present as with the a central These open are in purified rat vault and vault (1Kedersha N.L. Miquel M.C. Bittner D. Rome L.H. J. Cell Biol. 1990; 110: 895-901Crossref PubMed Scopus (126) Google Scholar). A of these structures is shown in A. The VLP structures in the purified fractions are more to These VLP structures (see 2, which we to as appear to contain three to more than a of these images are shown in The most has (see 4 of the B, have a central that could one or two above and the of the indicating that the could also be a Although most of the in the are structures containing some and VLPs were also Although they were likely composed of to were also (Fig. 4 these structures to be at sucrose in the gradient, the mass of these structures likely their fractionation more than their Vaults have been purified from of different species (1Kedersha N.L. Miquel M.C. Bittner D. Rome L.H. J. Cell Biol. 1990; 110: 895-901Crossref PubMed Scopus (126) Google Scholar) and from different A. yet to our these have been is possible that they in baculovirus as a of MVP which could the cellular assembly or that are required for complete particle they when vault particles TEP1, and vault are at with high have been and may vaults, these structures are highly In the expression of rat MVP alone in Sf9 cells is to direct the assembly of vault-like The that no endogenous Sf9 MVP or vaults could be detected the that these VLPs are formed from the expressed rat no MVP have been in and attempts to vaults from have been However, it is possible that Sf9 cell proteins may with the VLPs or in in a that they be In no vault-like particles were formed in when MVP purified from Sf9 cell extracts was to by that cellular be required for is to assembly studies with the other vault proteins, VPARP and TEP1, and with the vault are also to their in particle morphology and Dr. Stewart for of the and