Concepedia

Publication | Closed Access

First Report of <i>Phoma glomerata</i> Associated with the Ascochyta Blight Complex on Field Pea (<i>Pisum sativum</i>) in Australia

33

Citations

0

References

2013

Year

Abstract

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 10<sup>6</sup> conidia ml<sup>-1</sup> from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.