Biochemical Characterization of Various Catalytic Complexes of the Brain Platelet-activating Factor Acetylhydrolase

Abstract

Brain intracellular platelet-activating factor acetylhydrolase (PAF-AH) isoform I is a member of a family of complex enzymes composed of mutually homologous α1 and α2 subunits, both of which account for catalytic activity, and the β subunit. We previously demonstrated that the expression of one catalytic subunit, α1, is developmentally regulated, resulting in a switching of the catalytic complex from α1/α2 to α2/α2 during brain development (Manya, H., Aoki, J., Watanabe, M., Adachi, T., Asou, H., Inoue, Y., Arai, H., and Inoue, K. (1998) J. Biol. Chem. 273, 18567–18572). In this study, we explored the biochemical differences in three possible catalytic dimers, α1/α1, α1/α2, and α2/α2. The α2/α2 homodimer exhibited different substrate specificity from the α1/α1homodimer and the α1/α2 heterodimer, both of which showed similar substrate specificity. The α2/α2 homodimer hydrolyzed PAF and 1-O-alkyl-2-acetyl-sn-glycero-3-phosphorylethanolamine (AAGPE) most efficiently among 1-O-alkyl-2-acetyl-phospholipids. In contrast, both α1/α1 and α1/α2hydrolyzed 1-O-alkyl-2-acetyl-sn-glycero-3-phosphoric acid more efficiently than PAF. AAGPE was the poorest substrate for these enzymes. The β subunit bound to all three catalytic dimers but modulated the enzyme activity in a catalytic dimer composition-dependent manner. The β subunit strongly accelerated the enzyme activity of the α2/α2 homodimer but rather suppressed the activity of the α1/α1 homodimer and had little effect on that of the α1/α2heterodimer. The (His149 to Arg) mutant β, which has been recently identified in isolated lissencephaly sequence patients, lost the ability to either associate with the catalytic complexes or modulate their enzyme activity. The enzyme activity of PAF-AH isoform I may be regulated in multiple ways by switching the composition of the catalytic subunit and by manipulating the β subunit. Brain intracellular platelet-activating factor acetylhydrolase (PAF-AH) isoform I is a member of a family of complex enzymes composed of mutually homologous α1 and α2 subunits, both of which account for catalytic activity, and the β subunit. We previously demonstrated that the expression of one catalytic subunit, α1, is developmentally regulated, resulting in a switching of the catalytic complex from α1/α2 to α2/α2 during brain development (Manya, H., Aoki, J., Watanabe, M., Adachi, T., Asou, H., Inoue, Y., Arai, H., and Inoue, K. (1998) J. Biol. Chem. 273, 18567–18572). In this study, we explored the biochemical differences in three possible catalytic dimers, α1/α1, α1/α2, and α2/α2. The α2/α2 homodimer exhibited different substrate specificity from the α1/α1homodimer and the α1/α2 heterodimer, both of which showed similar substrate specificity. The α2/α2 homodimer hydrolyzed PAF and 1-O-alkyl-2-acetyl-sn-glycero-3-phosphorylethanolamine (AAGPE) most efficiently among 1-O-alkyl-2-acetyl-phospholipids. In contrast, both α1/α1 and α1/α2hydrolyzed 1-O-alkyl-2-acetyl-sn-glycero-3-phosphoric acid more efficiently than PAF. AAGPE was the poorest substrate for these enzymes. The β subunit bound to all three catalytic dimers but modulated the enzyme activity in a catalytic dimer composition-dependent manner. The β subunit strongly accelerated the enzyme activity of the α2/α2 homodimer but rather suppressed the activity of the α1/α1 homodimer and had little effect on that of the α1/α2heterodimer. The (His149 to Arg) mutant β, which has been recently identified in isolated lissencephaly sequence patients, lost the ability to either associate with the catalytic complexes or modulate their enzyme activity. The enzyme activity of PAF-AH isoform I may be regulated in multiple ways by switching the composition of the catalytic subunit and by manipulating the β subunit. platelet-activating factor acetylhydrolase platelet-activating factor diisopropylfluorophosphate 1-O-alkyl-2-acetyl-sn-glycero-3-phosphorylethanolamine 1-O-alkyl-2-acetyl-sn-glycero-3-phosphoric acid polymerase chain reaction polyacrylamide gel electrophoresis Brain platelet-activating factor acetylhydrolase (PAF-AH1 isoform I) was first identified in bovine brain as an oligomeric enzyme consisting of two catalytic α1 and α2 subunits and a noncatalytic β subunit (1Hattori M. Arai H. Inoue K. J. Biol. Chem. 1993; 268: 18748-18753Abstract Full Text PDF PubMed Google Scholar). The oligomeric brain PAF-AH contains a dimer of two highly homologous catalytic subunits, α1 and α2, that share 63% amino acid sequence identity but are not related to any other known proteins (2Hattori M. Adachi H. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1994; 269: 23150-23155Abstract Full Text PDF PubMed Google Scholar, 3Hattori M. Adachi H. Aoki J. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1995; 270: 31345-31352Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). The α1and α2 subunits form a heterodimer in the PAF-AH purified from the bovine brain cortex (1Hattori M. Arai H. Inoue K. J. Biol. Chem. 1993; 268: 18748-18753Abstract Full Text PDF PubMed Google Scholar). They can also form a catalytically active homodimer when expressed individually in Escherichia coli (3Hattori M. Adachi H. Aoki J. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1995; 270: 31345-31352Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Recently, the crystal structure of the α1/α1 homodimer was determined (4Ho Y.S. Swenson L. Derewenda L.S. Wei Y. Dauter Z. Hattori M. Adachi T. Aoki J. Arai H. Inoue K. Derewenda Z.S. Nature. 1997; 385: 89-93Crossref PubMed Scopus (157) Google Scholar). Surprisingly, the α1 subunit has a tertiary fold reminiscent of small GTPases such as p21ras and harbors a chymotrypsin-like Ser-Asp-His triad in its active site (4Ho Y.S. Swenson L. Derewenda L.S. Wei Y. Dauter Z. Hattori M. Adachi T. Aoki J. Arai H. Inoue K. Derewenda Z.S. Nature. 1997; 385: 89-93Crossref PubMed Scopus (157) Google Scholar). Although the catalytic subunits of PAF acetylhydrolase were first identified as a α1/α2 heterodimer from young adult bovine brain (1Hattori M. Arai H. Inoue K. J. Biol. Chem. 1993; 268: 18748-18753Abstract Full Text PDF PubMed Google Scholar), recent studies have revealed that the α2/α2 homodimers are present in vivo as well (5Manya H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). We have demonstrated in a previous study that expression of the α1 polypeptide is restricted to actively migrating neurons at the embryonic and early postnatal stages in rats and that switching of the catalytic dimer from the α1/α2 heterodimer to the α2/α2 homodimers occurs in these cells during brain development (5Manya H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 6Albrecht U. Abu-Issa R. Ratz B. Hattori M. Aoki J. Arai H. Inoue K. Eichele G. Dev. Biol. 1996; 180: 579-593Crossref PubMed Scopus (73) Google Scholar). Although both the α1/α2 heterodimer and the α2/α2 homodimer hydrolyze PAF equallyin vitro, it is essential to elucidate the differences between those catalytic dimers in order to understand the significance of the switching of catalytic subunits and the function of this enzyme. In the present study, we studied the biochemical properties of three possible catalytic dimers, α1/α1, α1/α2, and α2/α2, and their complexes with the β subunit. One striking feature of brain PAF-AH isoform I is that the gene for the β subunit is identical to a causative gene (LIS1) for Miller-Dieker lissencephaly (7Hattori M. Adachi H. Tsujimoto M. Arai H. Inoue K. Nature. 1994; 370: 216-218Crossref PubMed Scopus (454) Google Scholar). Miller-Dieker lissencephaly is a genetic brain malformation manifested as a smooth cerebral surface caused by abnormal neuronal migration at early developmental stages. Recent data demonstrated that deletions or mutations of the β/LIS1 gene accounts for approximately 40% of classic lissencephaly (8Pilz D.T. Matsumoto N. Minnerath S. Mills P. Gleeson J.G. Allen K.M. Walsh C.A. Barkovich A.J. Dobyns W.B. Ledbetter D.H. Ross M.E. Hum. Mol. Genet. 1998; 7: 2029-2037Crossref PubMed Scopus (296) Google Scholar). Point mutations in the β subunit were recently reported in the LIS1 gene from isolated lissencephaly sequence patients (9Lo N.C. Chong C.S. Smith A.C. Dobyns W.B. Carrozzo R. Ledbetter D.H. Hum. Mol. Genet. 1997; 6: 157-164Crossref PubMed Scopus (281) Google Scholar). In one case of the mutant β, histidine 149 was replaced with arginine. Although it is assumed that this amino acid substitution may produce a radical change in steric hindrance due to the loss of a imidazolic ring, direct evidence for the functional abnormality of this mutation has not been presented so far. The effect of mutation in the β subunit on the interaction with α subunit was also examined. Recombinant α1 and α2 were expressed either by the E. coli system (3Hattori M. Adachi H. Aoki J. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1995; 270: 31345-31352Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar) or the baculovirus system. Recombinant β was expressed by the baculovirus system, since protein was not recovered from soluble fractions of E. coli. The production of recombinant baculoviruses was designed as follows. The coding regions of bovine α1, α2, and β cDNA were inserted into the SalI/NotI sites of pFASTBAC (Life Technologies, Inc.). His149 → Arg mutant β was prepared as follows: two oligonucleotides, 5′-GGGGGGAATTCATGTGTCCTGGCCTCTGGGGGACA-3′ (nucleotide positions 124 of bovine β cDNA (7Hattori M. Adachi H. Tsujimoto M. Arai H. Inoue K. Nature. 1994; 370: 216-218Crossref PubMed Scopus (454) Google Scholar)) and 5′-GAGCCCCCAGAGCGACACCAATGA-3′ (nucleotide positions 485–508 of bovine β cDNA), were used as primers in a polymerase chain reaction (PCR) to introduce a mutation. The amplified PCR product and oligonucleotide, CCCCCGGATCCCTACACACAGGCCATTTTCAGGTC (nucleotide positions 1348–1371 of bovine β), were then used as primers for a second PCR. The resulting PCR product was introduced into theSalI/NotI sites of the pFASTBAC plasmid. Recombinant baculoviruses were prepared according to the manufacturer's protocol (Bac to Bac System, Life Technologies, Inc.). For infection, Sf9 cells were mixed with the recombinant viruses at a multiplicity of infection of 10 in various combinations of recombinant viruses and incubated at 27 °C for 72 h. The Sf9 cells (4 × 108) infected with each baculovirus were homogenized in 10 ml of SET buffer (10 mm Tris-HCl, 250 mm sucrose, pH 7.4), and the cell supernatants was recovered by ultracentrifugation at 100,000 × g. Each recombinant protein was purified using DEAE ion exchange, hydroxyapatite, and anion exchange column chromatographies as follows. All column chromatographies were performed at 4 °C using fast protein liquid chromatography system (Amersham Pharmacia Biotech). DEAE-ion exchange chromatography was performed essentially as described previously (5Manya H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). The cell supernatants obtained from the infected Sf9 cells were loaded onto a DEAE-Sepharose Fast Flow column (5 ml, Amersham Pharmacia Biotech) (flow rate 1 ml/min), which had been equilibrated with buffer A (0.1 m NaCl, 10 mmTris-HCl, 10% glycerol, pH 7.4) and eluted with a linear gradient of 0.1–1 m NaCl in buffer A. The active fractions as judged by PAF-AH activity assay were further applied onto hydroxyapatite column (Econo-Pac CHT II, 5 × 50 mm, Bio-Rad) (flow rate 0.8 ml/min), which had been equilibrated with buffer B (1 mmKH2PO4, 10% glycerol, pH 6.8). The proteins were eluted with a linear gradient of 1–400 mmKH2PO4 in buffer B. Each catalytic dimer was separated by anion exchange column (POROS HQ/M, 4.6 × 100 mm) (Perspective Biosystems, Inc. Framingham, MA.). After the column was first equilibrated with buffer C (10 mm Tris-HCl, 1 mm EDTA, 10% glycerol, pH 7.4), the active fractions from hydroxyapatite column chromatography which was dialyzed against buffer C were loaded onto the column and eluted with a linear gradient of 0–0.5 m NaCl in buffer C (flow rate 4 ml/min). For the production of the β protein, the Sf9 cells (4 × 108) infected with β baculovirus were homogenized in 10 ml of SET buffer (10 mm Tris-HCl, 250 mm sucrose, pH 7.4), and the cell supernatants were recovered by ultracentrifugation at 100,000 × g. The β protein was purified by DEAE-Sepharose and hydroxyapatite column chromatographies, as described above. PAF-AH assays were performed as described previously (5Manya H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), except that the radioactivity of liberated [3H]acetate was counted by a β-counter. A kinetic study was performed using various concentrations of PAF as a substrate of an assay as described previously (2Hattori M. Adachi H. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1994; 269: 23150-23155Abstract Full Text PDF PubMed Google Scholar). Cross-linking was performed as described previously (5Manya H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Briefly, each sample was dialyzed against 100 mm sodium phosphate (pH 8.0), cross-linked by adding 10 mm BS3 (Pierce), and then subjected to SDS-PAGE and Western blotting. Polyclonal anti-α1, -α2, and β were used to detect cross-linked products, since our monoclonal antibodies failed to react with the BS3-treated polypeptides. (AAGPE) and 1-O-alkyl-2-acetyl-sn-glycero-3-phosphoric acid were prepared according to the described by K. J. Biol. Chem. Full Text PDF PubMed Google Scholar) using exchange reaction by Briefly, PAF 5 mixed with was subjected to reaction in the of mm for For PAF 5 mixed with was subjected to reaction in the of The resulting were isolated by assays using these PAF were performed as described except that was when liberated acid was separated from the substrate when was of catalytic subunits was performed as described previously (3Hattori M. Adachi H. Aoki J. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1995; 270: 31345-31352Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), except that Life was used in this Briefly, of recombinant catalytic subunits was incubated with of for at The of into the catalytic subunits was by SDS-PAGE and In order to various combinations of catalytic dimers, the α1 and α2 subunits of brain PAF-AH were expressed in the Sf9 cells by the Sf9 cells with recombinant The expression of catalytic dimers in the of Sf9 cells infected with both the α1 and α2 viruses was with anion exchange column α1and α2 subunits were in a when expressed individually in Sf9 cells A and In contrast, when these two subunits were in the three of activity were the column chromatography 1 we that the α1 polypeptide was in both the first and second and the α2 polypeptide was in the second and data that the α1/α2 heterodimer and the α1/α1 and α2/α2 homodimers were in the Sf9 cells infected with both α1 and α2 The was but not the present of the catalytic subunits in each in C was by of each activity with the BS3 similar The obtained from the first and fractions with the and and the from the second with both the and antibodies that these three fractions the α1/α1, α1/α2, and α2/α2 using recombinant we first the substrate of three different catalytic The used in this study were with different Each recombinant catalytic complex in the Sf9 cells was purified to 4 by chromatographies, as described in the α2/α2 homodimer exhibited different substrate specificity from the α1/α1homodimer and the α1/α2 heterodimer, both of which showed similar substrate specificity to each The α2/α2 homodimer hydrolyzed PAF and 1-O-alkyl-2-acetyl-sn-glycero-3-phosphorylethanolamine (AAGPE) more efficiently than 1-O-alkyl-2-acetyl-sn-glycero-3-phosphoric acid In contrast, both α1/α1 and α1/α2 hydrolyzed more efficiently than PAF. AAGPE was the poorest substrate for these enzymes. The α2/α2 homodimer hydrolyzed PAF than the α1/α2 heterodimer and the α1/α1 AAGPE was used as a change in composition of the catalytic dimer from α1/α2 to a in the catalytic was demonstrated from these that the catalytic complexes of PAF-AH isoform I can hydrolyze PAF with a different on the composition of the catalytic subunit. it was that the α1/α2 heterodimer and the α2/α2 both of which were in exhibited different substrate of α1/α1, α1/α2, and The catalytic of three possible dimers were using and as in the α1/α2 heterodimer exhibited a substrate specificity similar to the α1/α1 homodimer rather than the α2/α2 that by the α1 subunit in the α1/α2 this we performed an active site study using which to an active the recombinant α1/α1 and α2/α2 homodimers were incubated with both α1 and were with The α1 subunit was with this when the α1/α2 heterodimer was data are with previous that the α1 subunit is by in the purified PAF-AH from bovine brain (1Hattori M. Arai H. Inoue K. J. Biol. Chem. 1993; 268: 18748-18753Abstract Full Text PDF PubMed Google Scholar). data that a of the α2 subunit catalytic is to be in the the in the α2/α2 homodimer is catalytically we each catalytic dimer can associate with the β subunit. Each catalytic dimer was prepared by Sf9 cells as described above. The recombinant β subunit also prepared by baculovirus system in Sf9 cells was purified to by column chromatographies, as described Each catalytic dimer was incubated with the β subunit on for and then the was with hydroxyapatite column each purified catalytic dimer was applied to the the activity was eluted as a of the catalytic complexes with the β subunit activity the catalytic subunit and the β subunit the of catalytic dimers with the β subunit. We then the effect of the β subunit on the enzyme activity of each catalytic in the enzyme activity of the α2/α2 homodimer by adding the recombinant In the β (5 the enzyme activity of the approximately β to more than 5 not a further in enzyme activity not the present In contrast, β suppressed the activity of the α1/α1homodimer and essentially had effect on that of the α1/α2 heterodimer We performed the using the β purified from bovine brain of the recombinant β, essentially the not We also the effect of the β subunit on catalytic activity in Sf9 The Sf9 cells were infected with either the α1 baculovirus or the α2 baculovirus with of β and the of the infected cells were for protein expression and PAF-AH activity. The PAF-AH activity of the α1/α1 homodimer was in to the of the β that of the α2/α2 homodimer was rather not The of α1 and α2 subunit expression were not by the of the β subunit. also the that the β subunit the activity of the α2/α2 homodimer but that of the α1/α1 β/LIS1 protein the mutant β be expressed in Sf9 cells and The mutant β subunit exhibited effect on the catalytic activity of all the catalytic dimers not the β subunit, as judged from the of a of the α dimer on a hydroxyapatite column the mutant β not associate with catalytic subunits Brain PAF-AH PAF-AH isoform I) contains two mutually homologous α1 and α2 subunits, both of which can form a homodimer and a heterodimer, and in the α1/α2 heterodimer and the α2/α2 homodimer have been in vivo (1Hattori M. Arai H. Inoue K. J. Biol. Chem. 1993; 268: 18748-18753Abstract Full Text PDF PubMed Google Scholar, H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). In α1 expression is restricted in early neurons at embryonic stages at which the cell migration is most and switching of catalytic subunits from the α1/α2 heterodimer to the α2/α2 homodimer occurs during brain development (5Manya H. Aoki J. Watanabe M. Adachi T. Asou H. Inoue Y. Arai H. Inoue K. J. Biol. Chem. 1998; 273: 18567-18572Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). is also well that the other subunit of PAF-AH isoform β, is a product of the causative gene for Miller-Dieker which has a in neuronal migration during brain was essential to the biochemical differences of each catalytic dimer in order to understand the of In the present study, we have demonstrated that each catalytic dimer exhibited substrate specificity and that their enzyme activity is modulated by the β subunit in catalytic subunit composition-dependent manner. we showed that PAF-AH isoform I has specificity for the to the of as a substrate K. Hattori M. Adachi H. Tsujimoto M. Arai H. Inoue K. J. Biol. Chem. 1995; 270: Full Text Full Text PDF PubMed Scopus Google Scholar). The essential amino acid in the of has also been from studies (4Ho Y.S. Swenson L. Derewenda L.S. Wei Y. Dauter Z. Hattori M. Adachi T. Aoki J. Arai H. Inoue K. Derewenda Z.S. Nature. 1997; 385: 89-93Crossref PubMed Scopus (157) Google Scholar). it was the enzyme may the substrate with a different In this study, we demonstrated that the enzyme hydrolyzed the substrate with a other than acid is an for the production of PAF the Biol. 1996; PubMed Google Scholar) and is by of the enzyme this reaction is in the brain fractions in in the brain as with the 1995; PubMed Scopus Google Scholar). The present data that PAF-AH isoform I can hydrolyze as well as PAF the that the enzyme may the intracellular PAF by not PAF but also an for PAF it is also possible that may a in the cell as a of intracellular A. T. T. T. H. Life PubMed Scopus Google Scholar), the of which is regulated by PAF-AH isoform (AAGPE) or can also be in Y. J. Biol. Chem. Full Text PDF PubMed Google Scholar) demonstrated is in cells by with PAF with They also reported the of a that the from PAF to with the of Y. J. Biol. Chem. Full Text PDF PubMed Google Scholar). the α2/α2 homodimer AAGPE it is highly possible that can be hydrolyzed by the enzyme as has not been reported so that may have a in the it is a in vivo substrate for PAF-AH isoform switching the composition of the catalytic subunit from α1/α2 to a change in the of substrate The substrate specificity and the activity of the α1/α2 heterodimer were similar to the α1/α1 homodimer but not to the α2/α2 We previously reported that a that to an active with the α1 subunit in the isoform that the catalytic of the α2 subunit is to be A study of the α1/α1 homodimer revealed that the two active sites are at the of the catalytic from each other (4Ho Y.S. Swenson L. Derewenda L.S. Wei Y. Dauter Z. Hattori M. Adachi T. Aoki J. Arai H. Inoue K. Derewenda Z.S. Nature. 1997; 385: 89-93Crossref PubMed Scopus (157) Google Scholar). that these two active sites not function since this catalytic is of one PAF we that one active is for is also possible that one active of two in the catalytic of all three dimers are to be A substrate specificity study as well as have demonstrated that by the α1 subunit may in the α1/α2 We have the α1/α2 heterodimer and the α2/α2 homodimer in but the α1/α1 homodimer has not been is possible that the α1/α1homodimer in but the α1/α2 heterodimer can be for the α1/α1 homodimer in of substrate specificity. amino acid is for the substrate specificity in the catalytic to the crystal structure of the α1/α1 the amino acid and are to the catalytic and a of PAF (4Ho Y.S. Swenson L. Derewenda L.S. Wei Y. Dauter Z. Hattori M. Adachi T. Aoki J. Arai H. Inoue K. Derewenda Z.S. Nature. 1997; 385: 89-93Crossref PubMed Scopus (157) Google Scholar). these of the are into and the α2 subunit (4Ho Y.S. Swenson L. Derewenda L.S. Wei Y. Dauter Z. Hattori M. Adachi T. Aoki J. Arai H. Inoue K. Derewenda Z.S. Nature. 1997; 385: 89-93Crossref PubMed Scopus (157) Google Scholar). mutation study demonstrated that the exchange of into the α1 subunit a substrate specificity similar to that of We previously that the β subunit not a on catalytic activity, on the that the β subunit can be loss of enzyme activity from the complex purified from bovine brain (7Hattori M. Adachi H. Tsujimoto M. Arai H. Inoue K. Nature. 1994; 370: 216-218Crossref PubMed Scopus (454) Google Scholar). We demonstrated in the present study that this was for the α1/α2 The rate of PAF by the accelerated 4 by the of β, the rate of by the α1/α1 was suppressed by In the composition of the catalytic subunit of PAF-AH from the α1/α2 heterodimer to the α2/α2 homodimer during in the catalytic subunit from α1/α2 to in a in the PAF-AH activity, since α2/α2 PAF than α1/α2 and the enzyme activity of α2/α2 is accelerated by study that PAF-AH activity in the brain is in than that in embryonic the expression of α2 and β were the during this in enzyme activity can be by the change in the composition of the catalytic subunit. The change in PAF-AH activity during brain development PAF in with this A. T. T. T. H. Life PubMed Scopus Google Scholar) have reported that PAF in the young brain is than that in the adult In we have demonstrated that the enzyme activity of PAF-AH isoform I is regulated in multiple ways by switching the of the catalytic subunit and by manipulating the β subunit. We have also the that other than PAF may be for the enzyme. is at present which effect is in vivo and the in for this enzyme be to the in vivo substrate for this enzyme and its