Publication | Closed Access
Use of the 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) protecting group in the solid-phase synthesis of oligo- and poly-ribonucleotides
39
Citations
31
References
1993
Year
Bioorganic ChemistryEngineeringMolecular BiologyChemical BiologyProtein SynthesisNucleic Acid ChemistryMacromolecular AssembliesBiochemistryBioconjugationOligonucleotideYeast Alanine TrnaBiomolecular EngineeringSynthetic StrategySolid-phase SynthesisNatural SciencesNucleic Acid BiochemistrySynthetic BiologyRibonucleic AcidPeptide Synthesis
An approach to the solid-phase synthesis of oligo- and poly-ribonucleotides is described. The synthetic strategy involves the use of building blocks in which two acid-labile groups, 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) and 9-phenylxanthen-9-yl (Px), respectively, are used to protect the 2′- and 5′-hydroxy functions of ribonucleoside building blocks. The adenine, cytosine and guanine base residues are protected with pivaloyl, benzoyl and phenylacetyl groups, respectively. 2-Cyanoethyl N,N-diisopropylphosphoramidites are used in the coupling steps, and 5-(3nitrophenyl)-1H-tetrazole is used as the activating agent. Following the chain-assembly process, 2′-protected oligo-and poly-ribonucleotides are released from the functionalized controlled-pore glass solid support; the latter stabilized ribonucleic acid (RNA) sequences are purified before they are fully unblocked by treatment with 0.01 mol dm–3 hydrochloric acid (pH 2) at room temperature for 20 h. The efficacy of this methodology is illustrated by the synthesis of the 3′-terminal decamer (r[UCGUCCACCA]), nonadecamer (r[AUUCCGGACUCGUCCACCA]), and heptatriacontamer (37-mer, r[GGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCACCA]) sequences of yeast alanine tRNA (tRNAAla).
| Year | Citations | |
|---|---|---|
Page 1
Page 1