Concepedia

Publication | Open Access

Whole genome sequencing of a novel temperate bacteriophage of<i>P. aeruginosa</i>: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

53

Citations

39

References

2006

Year

Abstract

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

References

YearCitations

Page 1