Opposite Effects of the Melanocortin-2 (MC2) Receptor Accessory Protein MRAP on MC2 and MC5 Receptor Dimerization and Trafficking

Abstract

MC2 (ACTH) receptors require MC2 receptor accessory protein (MRAP) to reach the cell surface. In this study, we show that MRAP has the opposite effect on the closely related MC5 receptor. In enzyme-linked immunosorbent assay and microscopy experiments, MC2 receptor was retained in the endoplasmic reticulum in the absence of MRAP and targeted to the plasma membrane with MRAP. MC5 receptor was at the plasma membrane in the absence of MRAP, but trapped intracellularly when expressed with MRAP. Using bimolecular fluorescence complementation, where one fragment of yellow fluorescent protein (YFP) was fused to receptors and another to MRAP, we showed that MC2 receptor-MRAP dimers were present at the plasma membrane, whereas MC5 receptor-MRAP dimers were intracellular. Both MC2 and MC5 receptors co-precipitated with MRAP. MRAP did not alter expression of β2-adrenergic receptors or co-precipitate with them. To determine if MRAP affects formation of receptor oligomers, we co-expressed MC2 receptors fused to YFP fragments in the presence or absence of MRAP. YFP fluorescence, reporting MC2 receptor homodimers, was readily detectable with or without MRAP. In contrast, MC5 receptor homodimers were visible in the absence of MRAP, but little fluorescence was observed by microscopic analysis when MRAP was co-expressed. Co-precipitation of differentially tagged receptors confirmed that MRAP blocks MC5 receptor dimerization. The regions of MRAP required for its effects on MC2 and MC5 receptors differed. These results establish that MRAP forms stable complexes with two different melanocortin receptors, facilitating surface expression of MC2 receptor but disrupting dimerization and surface localization of MC5 receptor. MC2 (ACTH) receptors require MC2 receptor accessory protein (MRAP) to reach the cell surface. In this study, we show that MRAP has the opposite effect on the closely related MC5 receptor. In enzyme-linked immunosorbent assay and microscopy experiments, MC2 receptor was retained in the endoplasmic reticulum in the absence of MRAP and targeted to the plasma membrane with MRAP. MC5 receptor was at the plasma membrane in the absence of MRAP, but trapped intracellularly when expressed with MRAP. Using bimolecular fluorescence complementation, where one fragment of yellow fluorescent protein (YFP) was fused to receptors and another to MRAP, we showed that MC2 receptor-MRAP dimers were present at the plasma membrane, whereas MC5 receptor-MRAP dimers were intracellular. Both MC2 and MC5 receptors co-precipitated with MRAP. MRAP did not alter expression of β2-adrenergic receptors or co-precipitate with them. To determine if MRAP affects formation of receptor oligomers, we co-expressed MC2 receptors fused to YFP fragments in the presence or absence of MRAP. YFP fluorescence, reporting MC2 receptor homodimers, was readily detectable with or without MRAP. In contrast, MC5 receptor homodimers were visible in the absence of MRAP, but little fluorescence was observed by microscopic analysis when MRAP was co-expressed. Co-precipitation of differentially tagged receptors confirmed that MRAP blocks MC5 receptor dimerization. The regions of MRAP required for its effects on MC2 and MC5 receptors differed. These results establish that MRAP forms stable complexes with two different melanocortin receptors, facilitating surface expression of MC2 receptor but disrupting dimerization and surface localization of MC5 receptor. In mammals, the five members of the melanocortin (MC 2The abbreviations used are: MCmelanocortinACTHadrenocorticotropic hormoneERendoplasmic reticulumGPCRG protein-coupled receptorMRAPMC2-receptor accessory proteinRAMPreceptor activity-modifying proteinYFPyellow fluorescent proteinHAhamagglutininCHOChinese hamster ovaryRTreverse transcriptionELISAenzyme-linked immunosorbent assaytdtandem. ) receptor family play diverse physiological roles. MC1 receptors (melanocyte-stimulating hormone receptors) control pigmentation in many animals, MC2 receptors (ACTH receptors) regulate adrenal corticosteroid synthesis, MC3 and MC4 receptors in brain influence food intake and energy expenditure, and MC5 receptors control exocrine gland secretion (1Abdel-Malek Z.A. Cell Mol. Life Sci. 2001; 58: 434-441Crossref PubMed Scopus (143) Google Scholar). Melanocortin receptors (MC1 through MC5) are structurally related G protein-coupled receptors that respond to agonists with an increase in cAMP. The receptors differ in their affinity for physiological agonists (α-, β-, and γ-melanocyte-stimulating hormone and ACTH) and antagonists (agouti and agouti-related protein). melanocortin adrenocorticotropic hormone endoplasmic reticulum G protein-coupled receptor MC2-receptor accessory protein receptor activity-modifying protein yellow fluorescent protein hamagglutinin Chinese hamster ovary reverse transcription enzyme-linked immunosorbent assay tandem. Unlike other melanocortin receptors, MC2 receptors are selectively regulated by ACTH. The MC2 receptor is also unusual in its requirement for an accessory protein, the MC2 receptor accessory protein (MRAP) (2Metherell L.A. Chapple J.P. Cooray S. David A. Becker C. Rüschendorf F. Naville D. Begeot M. Khoo B. Nürnberg P. Huebner A. Cheetham M.E. Clark A.J. Nat. Genet. 2005; 37: 166-170Crossref PubMed Scopus (359) Google Scholar). MRAP must be expressed with the MC2 receptor in order for the receptor to undergo glycosylation, traffic to the plasma membrane, bind ACTH, and stimulate adenylyl cyclase (2Metherell L.A. Chapple J.P. Cooray S. David A. Becker C. Rüschendorf F. Naville D. Begeot M. Khoo B. Nürnberg P. Huebner A. Cheetham M.E. Clark A.J. Nat. Genet. 2005; 37: 166-170Crossref PubMed Scopus (359) Google Scholar, 3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar, 4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). Individuals with inactivating mutations of either the MC2 receptor or MRAP suffer from ACTH resistance and severe glucocorticoid deficiency (2Metherell L.A. Chapple J.P. Cooray S. David A. Becker C. Rüschendorf F. Naville D. Begeot M. Khoo B. Nürnberg P. Huebner A. Cheetham M.E. Clark A.J. Nat. Genet. 2005; 37: 166-170Crossref PubMed Scopus (359) Google Scholar). MRAP is a small protein with a conserved amino terminus, single membrane-spanning domain, and non-conserved carboxyl terminus that can also differ among splice variants. MRAP forms antiparallel homodimers, which are exceedingly rare structures, and it is these dimers that co-precipitate with the MC2 receptor (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar). Mutagenic analysis has revealed that the carboxyl-terminal region of MRAP is not essential, but the amino-terminal and transmembrane regions are necessary for function (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar, 4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 5Webb T.R. Chan L. Cooray S.N. Cheetham M.E. Chapple J.P. Clark A.J. Endocrinology. 2009; 150: 720-726Crossref PubMed Scopus (61) Google Scholar). Deletion or alanine substitution of a critical four-amino acid segment, LDYI, at residues 18–21 of the mouse sequence, results in an MRAP molecule that facilitates expression of the MC2 receptor on the plasma membrane but does not allow the receptor to bind agonist or signal (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). MRAP is not required for cell surface expression of other melanocortin receptors and can inhibit expression or signaling in some cases (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar, 6Chan L.F. Webb T.R. Chung T.T. Meimaridou E. Cooray S.N. Guasti L. Chapple J.P. Egertová M. Elphick M.R. Cheetham M.E. Metherell L.A. Clark A.J. Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 6146-6151Crossref PubMed Scopus (187) Google Scholar). The MC5 receptor was identified on the basis of its homology to other melanocortin receptors and is thought to be the ancestral ACTH (MC2) receptor (7Baron A. Veo K. Angleson J. Dores R.M. Gen. Comp. Endocrinol. 2009; 161: 13-19Crossref PubMed Scopus (29) Google Scholar). Analysis of MC5 receptor knock-out mice revealed that the MC5 receptor is important in controlling exocrine gland secretion (8Chen W. Kelly M.A. Opitz-Araya X. Thomas R.E. Low M.J. Cone R.D. Cell. 1997; 91: 789-798Abstract Full Text Full Text PDF PubMed Scopus (424) Google Scholar) and behavioral responses depending on pheromones secreted by the preputial gland (9Morgan C. Cone R.D. Behav. Genet. 2006; 36: 291-300Crossref PubMed Scopus (39) Google Scholar). MC2 and MC5 receptors are closely related, with 46% identity and 67% homology at the amino acid level, respectively. MC2 and MC5 receptors are both found on 3T3-L1 adipocytes and in some adipose tissues in animals (10Boston B.A. Ann. N.Y. Acad. Sci. 1999; 885: 75-84Crossref PubMed Scopus (79) Google Scholar, 11Boston B.A. Cone R.D. Endocrinology. 1996; 137: 2043-2050Crossref PubMed Scopus (179) Google Scholar). Furthermore, MC2 and MC5 receptors are both expressed in adrenal cortex during embryonic development, when the MC5 receptor appears before the MC2 receptor (12Nimura M. Udagawa J. Hatta T. Hashimoto R. Otani H. Anat. Embryol. (Berl.). 2006; 211: 109-117Crossref PubMed Scopus (38) Google Scholar). Mammalian MC2 and MC5 receptors are activated by different pro-opiomelanocortin peptides, responding physiologically to ACTH and melanocyte-stimulating hormone, respectively. Here we demonstrate that MC2 and MC5 receptors are also differentially regulated by MRAP, which exerts opposite effects on surface expression and dimerization of the two receptors. hMC2, MC5, and β2-adrenergic receptors with three amino-terminal HA tags and RAMP3 were obtained from Missouri S&T cDNA Resource Center and YFP-F1 and YFP-F2 constructs from Dr. Catherine Berlot (Weis Center for Research, Geisinger Clinic, Danville, PA) (13Hynes T.R. Tang L. Mervine S.M. Sabo J.L. Yost E.A. Devreotes P.N. Berlot C.H. J. Biol. Chem. 2004; 279: 30279-30286Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Construction of mouse MRAP and MRAP2 plasmids has been described before (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). ER-tracker blue-white DPX was purchased from Invitrogen. Antibodies were from AbDSerotec (Kidlington, UK) (monoclonal anti-V5), Covance (Princeton, NJ) (monoclonal HA11 anti-HA), Bio-Rad (Hercules, CA) (horseradish peroxidase-coupled anti-mouse), or Molecular Probes (Carlsbad, CA) (Alexa546-coupled anti-mouse). MC2 and MC5 receptors with amino-terminal V5 tags were made by PCR; primer sequences are available upon request. CHO cells were grown in Dulbecco's modified Eagle's medium/F-12 supplemented with 5% fetal bovine serum. Plasmids were transiently transfected 24 h before experiments using FuGENE HD (Roche Applied Science). To make 3HA-MC5R-YFP-F1 and 3HA-MC5R-YFP-F2, 3HA-MC5R with exclusion of the stop codon was amplified from the 3HA-MC5R in pcDNA3.1+ plasmid using the following primers: forward, TATATATATAGCTAGCGTTTAAACTTAAGCTTGGTACC and reverse, TATATATATAACGCGTATCCCTTCTGGGAAAGCTGCAGGCG. 3HA-MC2R-YFP-F1 and 3HA-MC2R-YFP-F2 were made by the same strategy using the following primers: forward, TATATATATAGCTAGCGTTTAAACTTAAGCTTGGTACC and reverse, TATATATATAACGCGTCCAGTACCTGCTGCAGAAGATCATC. and or YFP-F2 in were with and and the amplified receptor was of the of YFP-F1 or To make YFP-F2 was amplified from the in using the following primers: forward, and reverse, The and in were with and the and the stop codon from YFP-F2 was the MRAP in from mouse adrenal and cells was using the and using the from following the and sequences available on To on the of the plasma membrane, cells in or were with for with in 5% in with mouse or in for h at three for in and with and for described (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar). The same was in cells to expression of of In this the used was 5% in assay on were and with at in Dulbecco's modified Eagle's medium/F-12 supplemented with 5% fetal bovine for h at and with to for at of blue-white DPX from was with the with and from were were with from and to for were made using in a were and were with and and with or at at and were on protein was using from were three in with and were by on or from was described (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar) using were with from on a and using Unlike the MC2 MC5 receptor readily to the plasma membrane when expressed in CHO cells in the absence of MRAP (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar, 6Chan L.F. Webb T.R. Chung T.T. Meimaridou E. Cooray S.N. Guasti L. Chapple J.P. Egertová M. Elphick M.R. Cheetham M.E. Metherell L.A. Clark A.J. Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 6146-6151Crossref PubMed Scopus (187) Google Scholar, P. P. D. T. J. PubMed Scopus Google Scholar). MC2 and MC5 receptors are expressed in adipocytes B.A. Cone R.D. Endocrinology. 1996; 137: 2043-2050Crossref PubMed Scopus (179) Google we the effect of MRAP on the MC5 receptor using receptors at the To determine MRAP the surface expression of MC5 we transfected CHO cells with a of receptor or receptor with of receptor was by on cells and MRAP expression by in cells in MC2 receptor expression at the cell surface with of MRAP we found that MC5 receptor surface expression was by MRAP in a MRAP effect on the surface expression of the β2-adrenergic receptor that the of MC5 receptor at the plasma membrane in the presence of MRAP is not to cell and that this effect is To determine if this effect of MRAP on the MC5 receptor is of physiological we the expression of MC2 MC5 MRAP, and MRAP2 in mouse adrenal and in the adrenal cell by for were in mouse adrenal and in cells the same was the reverse to that the observed were to of cDNA and not was detectable that MRAP the of MC5 receptor on the plasma membrane by it to be retained the endoplasmic reticulum the To this we expressed MC2 or MC5 receptor in CHO cells with or without MRAP, the the and the by MC2 receptor was in the in the presence of MRAP in with (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar). In contrast, MC5 receptor was in the presence or absence of MRAP that MRAP does not of the MC5 receptor. in the presence of MRAP the MC5 receptor it did when MRAP was not To that the described were of forms of the MC5 we expressed MC5 receptor with or without MRAP, the and the with F. confirmed that MC5 receptor was in the presence of MRAP, the to be forms of MC5 in both to a not are on the MC5 and of receptor be to the of or of the in the presence of MRAP. MRAP inhibit formation of or or alter an To MC2 and MC5 receptors in we expressed the receptors fused to a fluorescent protein, with or without MRAP. the two of the fluorescent protein, it is not to dimers R.E. Nat. 2004; PubMed Scopus Google Scholar). In the absence of MRAP, the MC2 receptor was retained in the and the fluorescence with a for the MRAP was MC2 receptor was at the plasma membrane MC5 receptor the opposite MRAP, the receptor was at the plasma membrane, but when MRAP was MC5 receptor was retained the cell and with the is that of the MC5 receptor was found in the receptor glycosylation, a that is in the These results that MRAP to MC5 receptor by the The described that MRAP or differentially regulate MC2 and MC5 receptor surface To determine if this is to a or receptors and MRAP, we receptor with MRAP. MC2 receptor co-precipitated with MRAP (3Sebag J.A. Hinkle P.M. Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 20244-20249Crossref PubMed Scopus (144) Google Scholar). MC5 receptor also co-precipitated with MRAP also showed that the β2-adrenergic receptor does not with MRAP to establish that the of MRAP with MC2 and MC5 receptors are To receptor-MRAP complexes in cells and the localization of MC2 and MC5 receptors with localization of receptor-MRAP we used bimolecular fluorescence Nat. Mol. Cell Biol. 2006; PubMed Scopus Google Scholar). fused an amino-terminal fragment of the YFP to the terminus of MC2 and MC5 receptors and the carboxyl-terminal fragment of YFP to the terminus of MRAP. YFP fluorescence can be if the two fragments are to the fluorescence the localization of either MC2 receptor-MRAP or MC5 receptor-MRAP depending on the constructs The MC2 receptor-MRAP was visible at the plasma membrane the that MRAP is for the of the MC2 receptor from the to the surface. the other the MC5 receptor-MRAP was in that a of MRAP with MC5 receptor is for the receptor from to the plasma described control experiments to the bimolecular fluorescence in this (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). obtained fluorescence when both YFP fragments were fused to the terminus of MRAP dimers were not or when YFP fragments were fused to either of MRAP and expressed with the YFP fragments fused to G protein or G protein These results show that the not dimerization. of the melanocortin receptors been to homodimers and 2006; PubMed Scopus Google Scholar, C. C. PubMed Scopus Google Scholar, R. J. 2005; PubMed Scopus Google Scholar). To determine if MC2 or MC5 receptors homodimers or and if complexes are by MRAP, we co-expressed MC2 receptor fused to YFP-F1 with MC2 receptor fused to YFP-F2 in the presence or absence of MRAP. In the absence of MRAP, the YFP fluorescence, reporting two MC2 receptors in was readily detectable MRAP was fluorescence was detectable and on the plasma membrane To bimolecular fluorescence complementation, we the of YFP fluorescence in transfected which were identified by with to the V5 that was present on both and MRAP. MRAP did not alter the YFP fluorescence of cells MC2 receptors fused to YFP fragments did MRAP the expression of MC2 fragments by in cells These results that MC2 receptors homodimers or and that MRAP does not alter the formation of the same was for the MC5 YFP fluorescence was in the absence of MRAP but was when MRAP was present analysis revealed that the YFP fluorescence was by MRAP These that MC5 receptors homodimers or in and that MRAP the formation of The of by in was not by MRAP, the of fluorescence was not to an in protein expression Furthermore, in the same MC5 protein readily fluorescence when it was co-expressed with the To that MC5 receptors and that the of the receptor is by MRAP, we expressed receptor and receptor with or without MRAP, the and the of receptor co-precipitated with the receptor by of the receptor was with receptor in the absence of MRAP In the presence of MRAP, receptor co-precipitated with receptor confirmed that MRAP a in of receptor with receptor The results of both the and bimolecular fluorescence that the MC5 receptor is by MRAP. were to dimers of MC2 and MC5 receptors by bimolecular fluorescence but were to the effect of MRAP the of was in a signal not To determine the regions of MRAP that are necessary to MC5 receptor in we and of MRAP and RAMP3 and expressed these with MC5 receptor. receptor was by on MC5 receptor surface expression was when the receptor was expressed with a of MRAP MC5 receptor was also by an MRAP where the transmembrane of MRAP was by the transmembrane region of an accessory protein that does not regulate melanocortin receptor of the amino which are for the of MRAP (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google did not the effect of MRAP on surface localization of the MC5 receptor. of the amino of MRAP the effect of MRAP on MC5 receptor The of MRAP and RAMP3 were on The of effect of on MC5 receptor dimerization was not to this was expressed at or MRAP In the that was expressed at the was which surface expression of the MC5 receptor. These results demonstrate that the conserved terminus of MRAP is required for MRAP to inhibit MC5 receptor localization on the plasma the unusual of MRAP, which appears to be for its with the MC2 does not to be necessary for MRAP to MC5 receptor to the cell surface. The identified mouse MRAP2 protein, which can surface expression of MC2 receptor but not ACTH signaling (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google MRAP with the MC5 its surface expression used the bimolecular fluorescence to if was a the of MRAP, MRAP and MRAP2 to MC5 receptor and receptor dimerization. To MC5 receptor we YFP fluorescence in cells and with MRAP, MRAP or described the YFP fluorescence of transfected by surface with an was In the presence of YFP fluorescence was readily that RAMP3 does not with MC5 receptor MRAP, or MRAP2 was YFP fluorescence was with a in MC5 receptor did not inhibit MC5 receptor results were obtained when the of YFP fluorescence in cells was by a cell not These results show that is a the of MC5 receptor to and its presence at the plasma membrane, that MC5 receptor be trapped The described the of accessory in melanocortin receptor that MRAP has effects on the structurally MC2 and MC5 receptors. The of MRAP is The MC2 receptor MRAP to traffic to the plasma membrane, whereas MRAP the MC5 receptor from the cell surface. MC2 and MC5 receptors were expressed in the same MRAP surface expression of MC2 receptors and trapped MC5 receptors one does not not The absence of receptor on the cell surface with or without MRAP and MC2 receptors, analysis of the influence of MRAP on the of either receptor. The of MRAP required for these opposite are the MRAP did not the surface expression of the β2-adrenergic receptor another that the of MRAP on MC2 and MC5 receptors is Individuals MRAP protein severe glucocorticoid deficiency from resistance to ACTH (2Metherell L.A. Chapple J.P. Cooray S. David A. Becker C. Rüschendorf F. Naville D. Begeot M. Khoo B. Nürnberg P. Huebner A. Cheetham M.E. Clark A.J. Nat. Genet. 2005; 37: 166-170Crossref PubMed Scopus (359) Google Scholar) but that a for MRAP in other receptor The of MC5 in MRAP be by the presence of the MRAP, to regulate surface expression of the MC5 receptor. The of MRAP and MRAP2 make it to determine which are regulated by these accessory knock-out animals MRAP, and both are is not make the MC2 receptor on MRAP for when the other melanocortin receptors can function without The transmembrane regions of the melanocortin receptors are and in cases been with little effect on receptor or responses M. M. J. Biol. Chem. 2007; Full Text Full Text PDF PubMed Scopus (39) Google Scholar, M. M. D. 2009; PubMed Scopus Google Scholar). The effects of MRAP on both MC2 and MC5 receptors require the conserved MRAP amino terminus, but MRAP has it is this with MC2 receptor from the or of the the MC5 results that the amino-terminal region of MRAP with one of the of the the MC5 receptor surface MRAP with both MC2 and MC5 receptors, and forms complexes in which YFP fragments are to or at MRAP with the MC2 receptor at two receptor to the plasma membrane and and be to receptor by MRAP a and affinity be to of the receptor with G which affinity of receptor the MC2 the function of MRAP and the MRAP transmembrane domain, but is retained in MRAP of the amino The of MRAP to ACTH to the MC2 receptor amino from residues (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). In contrast, MRAP of MC5 receptor does not on the transmembrane of MRAP, the in (4Sebag J.A. Hinkle P.M. J. Biol. Chem. 2009; 284: 610-618Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar) or the carboxyl-terminal but it does require the amino-terminal of show that MRAP formation of MC5 receptor MRAP bimolecular fluorescence MC5 fragment In MRAP of MC5 receptors tagged with different The MC2 receptor appears to with or without MRAP. is that melanocortin receptors must to traffic to the cell but and of is and MC1 and MC3 receptors been to and 2006; PubMed Scopus Google Scholar, C. C. PubMed Scopus Google Scholar, R. J. 2005; PubMed Scopus Google Scholar). In dimerization of in the at in receptor and dimerization effects of some receptor mutations S. S. M. Sci. 2005; Full Text Full Text PDF PubMed Scopus Google Scholar, S. M. 2004; PubMed Scopus Google in the melanocortin receptor family J. E. J.A. C. J. 2006; Full Text Full Text PDF PubMed Scopus Google Scholar). The described can be if MRAP a critical dimerization in MC5 receptor and is a the of different MRAP and MRAP2 to MC5 receptor dimerization and to receptor to the plasma of and receptors is by R. A. L.A. Proc. Natl. Acad. Sci. U.S.A. PubMed Scopus Google a of the family of accessory that and receptor expression M. J. C. M. C. W. J. Biol. Chem. 2006; Full Text Full Text PDF PubMed Scopus Google Scholar, H. M. H. Cell. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). are not is little where MRAP, and MC5 receptor are expressed in Analysis of by and in that both receptors are expressed in adipose and adrenal it is not if in the same showed that the for is present in mouse adrenal in the adrenal cell that MRAP, and MC5 receptor be expressed physiological agonists and antagonists regulate melanocortin receptors is in the and diverse unusual of the melanocortin is the of different from a to the five receptors with of The described that an increase in MRAP expression to ACTH and to hormone in MC2 and MC5 receptors, whereas a in MRAP responses in the opposite In this the accessory MRAP and MRAP2 a to the melanocortin signaling