The Nuclear Receptor Corepressors NCoR and SMRT Decrease Peroxisome Proliferator-activated Receptor γ Transcriptional Activity and Repress 3T3-L1 Adipogenesis

Abstract

The peroxisome proliferator-activated receptor γ (PPARγ) is a central regulator of adipogenesis and recruits coactivator proteins in response to ligand. However, the role of another class of nuclear cofactors, the nuclear receptor corepressors, in modulating PPARγ transcriptional activity is less clear. Such corepressors include the nuclear receptor corepressor (NCoR) and the silencing mediator of retinoid and thyroid hormone receptors (SMRT). Our data suggest that PPARγ recruits SMRT and NCoR in the absence of ligand and that these corepressors are capable of down-regulating PPARγ-mediated transcriptional activity. The addition of the PPARγ ligand pioglitazone results in dissociation of the PPARγ-corepressor complex. To define the role of SMRT and NCoR in PPARγ action, 3T3-L1 cells deficient in SMRT or NCoR were generated by RNA interference. When these cells are exposed to differentiation media, they exhibit increased expression of adipocyte-specific genes and increased production of lipid droplets, as compared with control cells. These data suggest that the nuclear receptor corepressors decrease PPARγ transcriptional activity and repress the adipogenic program in 3T3-L1 cells. The peroxisome proliferator-activated receptor γ (PPARγ) is a central regulator of adipogenesis and recruits coactivator proteins in response to ligand. However, the role of another class of nuclear cofactors, the nuclear receptor corepressors, in modulating PPARγ transcriptional activity is less clear. Such corepressors include the nuclear receptor corepressor (NCoR) and the silencing mediator of retinoid and thyroid hormone receptors (SMRT). Our data suggest that PPARγ recruits SMRT and NCoR in the absence of ligand and that these corepressors are capable of down-regulating PPARγ-mediated transcriptional activity. The addition of the PPARγ ligand pioglitazone results in dissociation of the PPARγ-corepressor complex. To define the role of SMRT and NCoR in PPARγ action, 3T3-L1 cells deficient in SMRT or NCoR were generated by RNA interference. When these cells are exposed to differentiation media, they exhibit increased expression of adipocyte-specific genes and increased production of lipid droplets, as compared with control cells. These data suggest that the nuclear receptor corepressors decrease PPARγ transcriptional activity and repress the adipogenic program in 3T3-L1 cells. The thyroid hormone receptors (TRs) 1The abbreviations used are: TR, thyroid hormone receptor; RAR, retinoic acid receptor; PPAR, peroxisome proliferator-activated receptor; NCoR, nuclear receptor corepressor; SMRT, silencing mediator of retinoid and thyroid hormone receptors; siRNA, small interference RNA; UAS-Luc, upstream activating sequence-luciferase; PBS, phosphate-buffered saline; C/EBP, CCAAT enhancer-binding protein; ID, interacting domain; CBP, cAMP-responsive element-binding protein-binding protein. 1The abbreviations used are: TR, thyroid hormone receptor; RAR, retinoic acid receptor; PPAR, peroxisome proliferator-activated receptor; NCoR, nuclear receptor corepressor; SMRT, silencing mediator of retinoid and thyroid hormone receptors; siRNA, small interference RNA; UAS-Luc, upstream activating sequence-luciferase; PBS, phosphate-buffered saline; C/EBP, CCAAT enhancer-binding protein; ID, interacting domain; CBP, cAMP-responsive element-binding protein-binding protein. and retinoic acid receptors (RARs) are nuclear receptors that repress gene transcription in the absence of their respective ligands. This ligand-independent repression is mediated by nuclear receptor corepressors, such as the nuclear receptor corepressor protein (NCoR) and the silencing mediator of retinoid and thyroid hormone receptors (SMRT) (1.Horlein A.J. Naar A.M. Heinzel T. Torchia J. Gloss B. Kurokawa R. Ryan A. Kamei Y. Soderstrom M. Glass C.K. Rosenfeld M.G. Nature. 1995; 377: 397-404Crossref PubMed Scopus (1688) Google Scholar, 2.Chen J.D. Evans R.M. Nature. 1995; 377: 454-457Crossref PubMed Scopus (1694) Google Scholar). NCoR and SMRT are recruited by TR and RAR isoforms in the absence of ligand and are released upon ligand binding. NCoR and SMRT, in turn, recruit a complex with histone deacetylase activity to repress transcription of target genes. More recently, NCoR and SMRT have been shown to be recruited by other nuclear receptors, some of which bind nuclear receptor corepressors in the presence of antagonists. However, it has been controversial whether NCoR and SMRT play a significant role in gene regulation by the peroxisome proliferator-activated receptor γ (PPARγ) isoforms (3.Zamir I. Zhang J. Lazar M.A. Genes Dev. 1997; 11: 835-846Crossref PubMed Scopus (200) Google Scholar). Two types of PPARγ isoforms exist, PPARγ1 and PPARγ2. These receptors differ only in their amino-terminal A/B domain, such that PPARγ2 contains an extra 30 amino acids (4.Rosen E.D. Spiegelman B.M. J. Biol. Chem. 2001; 276: 37731-37734Abstract Full Text Full Text PDF PubMed Scopus (1063) Google Scholar). The function of PPARγ2 has attracted considerable interest because it is specifically expressed in adipocytes and is an essential regulator of adipogenesis. In addition, many important adipocyte-specific genes contain response elements for PPARγ in their promoter regions. Although PPARγ clearly recruits coactivators in response to exogenous ligands, its ability to recruit corepressors is less certain. In contrast to the TR, PPARγ does not appear to be a strong repressor in the absence of its ligand. Such experiments, however, have been limited by the lack of information concerning physiologic endogenous ligands. Early work into PPARγ and corepressor recruitment suggested that PPARγ might not recruit NCoR or SMRT in the presence of DNA response elements (3.Zamir I. Zhang J. Lazar M.A. Genes Dev. 1997; 11: 835-846Crossref PubMed Scopus (200) Google Scholar). Another report suggested that PPARγ could recruit the corepressor SMRT in the presence of signaling by epidermal growth factor (5.Lavinsky R.M. Jepsen K. Heinzel T. Torchia J. Mullen T.M. Schiff R. Del-Rio A.L. Ricote M. Ngo S. Gemsch J. Hilsenbeck S.G. Osborne C.K. Glass C.K. Rosenfeld M.G. Rose D.W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2920-2925Crossref PubMed Scopus (577) Google Scholar). Later work suggested that PPARγ can recruit nuclear receptor corepressors in cells (6.Wang L.H. Yang X.Y. Zhang X. Huang J. Hou J. Li J. Xiong H. Mihalic K. Zhu H. Xiao W. Farrar W.L. Immunity. 2004; 20: 205-218Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 7.Gurnell M. Wentworth J.M. Agostini M. Adams M. Collingwood T.N. Provenzano C. Browne P.O. Rajanayagam O. Burris T.P. Schwabe J.W. Lazar M.A. Chatterjee V.K. J. Biol. Chem. 2000; 275: 5754-5759Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar), and overexpression of NCoR or SMRT has been shown to repress PPARγ-mediated gene transcription in certain cell types (8.Krogsdam A.M. Nielsen C.A. Neve S. Holst D. Helledie T. Thomsen B. Bendixen C. Mandrup S. Kristiansen K. Biochem. J. 2002; 363: 157-165Crossref PubMed Scopus (82) Google Scholar). In addition, mutant PPARγ receptors found in patients with PPARγ resistance bind corepressors but release them aberrantly in the presence of exogenous ligands (9.Agostini M. Gurnell M. Savage D.B. Wood E.M. Smith A.G. Rajanayagam O. Garnes K.T. Levinson S.H. Xu H.E. Schwabe J.W. Willson T.M. O'Rahilly S. Chatterjee V.K. Endocrinology. 2004; 145: 1527-1538Crossref PubMed Scopus (54) Google Scholar). Finally, a recent study suggested that NCoR is required for the NAD-dependent deacetylase Sirt1 to decrease fat accumulation (10.Picard F. Kurtev M. Chung N. Topark-Ngarm A. Senawong T. Oliveira R.M. Leid M. McBurney M.W. Guarente L. Nature. 2004; 429: 771-776Crossref PubMed Scopus (1624) Google Scholar). The 3T3-L1 cell line has been used as a model of adipogenesis because, in the presence of defined hormonal stimulation, 3T3-L1 fibroblasts differentiate into adipocytes. This process has been carefully investigated and is accompanied by an increase in PPARγ2 expression. In turn, PPARγ2 plays a central role in adipogenesis, by increasing the expression of C/EBPα and other downstream adipocyte-specific genes (11.Rosen E.D. Walkey C.J. Puigserver P. Spiegelman B.M. Genes Dev. 2000; 14: 1293-1307PubMed Google Scholar). In the following experiments, we show that PPARγ2 can recruit NCoR and SMRT in 3T3-L1 cells and that these corepressors repress PPARγ-mediated gene transcription. We then generate stable populations of cells deficient in NCoR or SMRT using siRNA technology; 3T3-L1 cells lacking either NCoR or SMRT exhibit enhanced expression of adipocyte-specific genes, suggesting that nuclear receptor corepressors modulate adipogenesis via effects on PPARγ activity. Plasmids—Plasmids for Gal4-TR, Gal4-RAR, upstream activating sequence-luciferase (UAS-Luc), VP16-NCoR, VP16-SMRT, Gal4-NCoR, and Gal4-SMRT have previously been described (12.Cohen R.N. Brzostek S. Kim B. Chorev M. Wondisford F.E. Hollenberg A.N. Mol. Endocrinol. 2001; 15: 1049-1061Crossref PubMed Scopus (102) Google Scholar, 13.Cohen R.N. Putney A. Wondisford F.E. Hollenberg A.N. Mol. Endocrinol. 2000; 14: 900-914Crossref PubMed Scopus (89) Google Scholar, 14.Cohen R.N. Wondisford F.E. Hollenberg A.N. Mol. Endocrinol. 1998; 12: 1567-1581Crossref PubMed Scopus (63) Google Scholar). Gal4-PPARγ was constructed by placing the coding sequence for the PPARγ ligand-binding domain downstream of the Gal4 DNA-binding domain in the vector pECE. VP16-PPARγ2 was constructed by placing the entire coding sequence of PPARγ2 downstream of VP16 in the vector pVP16 (Clontech). PPRE-Luc was made by placing two copies of the modified DR+1 element AGGACAAAGGTCA (15.Park Y. Freedman B.D. Lee E.J. Park S. Jameson J.L. Diabetologia. 2003; 46: 365-377Crossref PubMed Scopus (250) Google Scholar) upstream of luciferase in the pGL2 promoter vector (Promega). The NCoR and SMRT cDNA sequences were placed in the expression vector pSG5. The siRNA constructs were made by placing annealed oligonucleotides representing NCoR or SMRT sequences and into the pSilencer-Hygro vector (Ambion) per the manufacturer's instructions. The sense strand of the NCoR sequence was as follows (including linkers): GATCCAGGAAGAGTGTTCCTGATTTTCAAGAGAAATCAGGAACACTCTTCCTTTTTTTGGAAA. The sense strand of the SMRT sequence was as follows (including linkers): GATCCGTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTTGGAAA. The negative control siRNA construct used was provided by Ambion. Cell Culture and Transfection—3T3-L1 cells were cultured in Dulbecco's modified Eagle's medium supplemented with penicillin, streptomycin, glutamine, and 10% calf serum. The cells were transfected with Lipofectamine Plus (Invitrogen) per the manufacturer's instructions, with the following exceptions. For mammalian two-hybrid assays, 3 h after transfection (in serum-free medium), the cells were washed with PBS and placed in fresh serum-free media, with or without varying concentrations of pioglitazone (a generous gift from Takeda Pharmaceuticals); luciferase activity was assessed 20–24 h later. For NCoR or SMRT overexpression studies, the cells were transfected on day 1, and 3 h after transfection, the cells were washed in PBS and changed to full medium. On day 2, the cells were washed with PBS again and changed to serum-free medium. Luciferase activity was measured on day 3. All of the transient transfections were performed in triplicate and repeated at least three times. For stable transfections, 6 μg of the indicated siRNA construct in pSilencer-Hygro were transfected in cell culture dishes and placed in fresh medium 3 h later. The following day, the cells were washed with PBS and placed in full medium supplemented with hygromycin. The cells were placed in fresh hygromycin-containing medium every 3–4 days. When the cells were about 75% confluent, they were split into new culture dishes with fresh hygromycin. 3T3-L1 Cell Differentiation—The 3T3-L1 cells were allowed to grow until confluency and then refed with fresh medium for 2 more days. The cells were placed in medium containing 10% fetal calf serum, insulin, dexamethasone, and isobutylmethylxanthine for 3 days, as previously described (16.Brady M.J. Kartha P.M. Aysola J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). 3 days, the cells were placed in medium with fresh 10% fetal calf and for 2 days. differentiation the cells were either for or allowed to differentiate and then and with O. 3T3-L1 cell the cells were for either cell NCoR, and or and protein which were then by to and with The used were as (a generous gift from from the sequence and For the cell were with the then on and with the was by of in of 3T3-L1 cells were with 10% for at and then washed with The cells were with an of of for with by with SMRT and NCoR a and contain amino-terminal and interacting The nuclear receptors and corepressors are on these which contain sequences of the amino acid X. Lazar M.A. Nature. PubMed Scopus Google Scholar, L. J.D. Li C. Chatterjee K. Evans R.M. Schwabe J.W. Genes Dev. PubMed Scopus Google Scholar, E.M. Kurokawa R. A. Rose D.W. Glass C.K. Rosenfeld M.G. Genes Dev. PubMed Scopus Google Scholar). SMRT contains two interacting NCoR contains a domain that is to the other two To whether PPARγ recruits SMRT and NCoR in 3T3-L1 we used a mammalian two-hybrid The ligand-binding of and were placed downstream of the Gal4 DNA-binding These Gal4 constructs were then with constructs and a vector to in 3T3-L1 cells. with data (12.Cohen R.N. Brzostek S. Kim B. Chorev M. Wondisford F.E. Hollenberg A.N. Mol. Endocrinol. 2001; 15: 1049-1061Crossref PubMed Scopus (102) Google Scholar, 13.Cohen R.N. Putney A. Wondisford F.E. Hollenberg A.N. Mol. Endocrinol. 2000; 14: 900-914Crossref PubMed Scopus (89) Google Scholar), more with NCoR SMRT, and more with NCoR however, Gal4-PPARγ was to recruit NCoR and SMRT to a as in 3T3-L1 cells. To whether PPARγ2 could recruit corepressors, PPARγ2 was placed downstream of VP16 and with Gal4-SMRT or shown in PPARγ2 with SMRT and NCoR in 3T3-L1 the with SMRT was To which SMRT was for strong the sequences in either SMRT or were has been shown that of the or to the corepressor and nuclear receptors (12.Cohen R.N. Brzostek S. Kim B. Chorev M. Wondisford F.E. Hollenberg A.N. Mol. Endocrinol. 2001; 15: 1049-1061Crossref PubMed Scopus (102) Google Scholar, X. Lazar M.A. Nature. PubMed Scopus Google Scholar). the amino acids in SMRT and were to in Gal4-SMRT to and shown in VP16-PPARγ2 with but with are These data suggest that SMRT is required for full with with data using in cells (9.Agostini M. Gurnell M. Savage D.B. Wood E.M. Smith A.G. Rajanayagam O. Garnes K.T. Levinson S.H. Xu H.E. Schwabe J.W. Willson T.M. O'Rahilly S. Chatterjee V.K. Endocrinology. 2004; 145: 1527-1538Crossref PubMed Scopus (54) Google Scholar). To that with protein in 3T3-L1 the cells were allowed to differentiate for 3 with insulin, dexamethasone, and isobutylmethylxanthine to increase endogenous PPARγ cell from these cells were with either an or control and then to using an shown in the cell containing NCoR and SMRT in 3T3-L1 cells contains suggesting that endogenous PPARγ recruits corepressors in To whether the of PPARγ and corepressors in 3T3-L1 cells is a construct was transfected into 3T3-L1 cells in the presence or absence of because PPARγ2 is not expressed at in cells. PPARγ2 in an increase in luciferase in because of the ligand-independent function in its amino of in a decrease in luciferase activity in the absence of PPARγ2. In in the presence of transfection of NCoR or SMRT in a strong decrease in luciferase activity suggesting that PPARγ2 recruits corepressors to modulate its activity in 3T3-L1 cells. PPARγ has been as a regulator of adipogenesis. We that corepressors repress PPARγ-mediated gene a decrease in corepressor might the expression of adipocyte-specific genes. we used the siRNA (Ambion) to siRNA constructs for NCoR or SMRT a negative in 3T3-L1 cells. transfection has been used by other to important in the differentiation of 3T3-L1 cells I. H. M. H. P. Hollenberg A.N. J. Biol. Chem. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). To NCoR or SMRT siRNA sequences were for their ability to decrease NCoR or SMRT by transient transfection not The siRNA constructs were then expressed in 3T3-L1 cells by transfection by with hygromycin. NCoR or SMRT siRNA constructs a negative control siRNA were then by shown in cells containing the expressed NCoR siRNA specifically NCoR without SMRT In the SMRT siRNA construct specifically SMRT and to a increase in NCoR of cells of other measured and In the of cells expressed such adipocyte-specific proteins as or not suggesting that the absence of corepressor proteins is not in for The 3T3-L1 cells were then in the presence of insulin, dexamethasone, and isobutylmethylxanthine for 3 and then for 2 days. differentiation were used to protein In cells lacking either NCoR or SMRT, was increased expression of and C/EBPα suggesting that these cells increased expression of adipocyte-specific genes. In was significant in the expression of protein 1, a protein that is expressed in and adipocytes M.J. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar). 2 of the cells were with to lipid deficient in NCoR or SMRT increased with with the data suggesting an increased expression of To the of ligand on the PPARγ-corepressor Gal4-SMRT and were with VP16-PPARγ2 and a construct in 3T3-L1 in the presence or absence of varying concentrations of is a used in the of 2 and have been shown to be ligands for PPARγ J.M. J. 2000; PubMed Scopus Google Scholar). shown in pioglitazone a strong decrease in in two-hybrid To the effects of pioglitazone on endogenous PPARγ-corepressor 3T3-L1 cells were with insulin, dexamethasone, and isobutylmethylxanthine for 3 to increase PPARγ in and then with serum-free medium with or without cell were with or and then by with an shown in with pioglitazone Although pioglitazone the was These data suggest that decrease the recruitment of corepressors to PPARγ but not are NCoR and SMRT with to to whether corepressor could modulate effects specifically by the 3T3-L1 cells deficient in SMRT or NCoR were to differentiate in a has been shown previously that and 3T3-L1 differentiation but that a of insulin, dexamethasone, and is for process Park J. Biol. Chem. 2001; 276: Full Text Full Text PDF PubMed Scopus Google Scholar). In cells deficient in corepressors not differentiate in and not a of pioglitazone was used in with and In the presence of insulin, dexamethasone, and 3T3-L1 cells were capable of into but process was enhanced in the cell SMRT and NCoR siRNA In expression of and was in these expression of protein was not was enhanced in these cells as compared with control cells not PPARγ is to be a transcription factor in the regulation of differentiation (11.Rosen E.D. Walkey C.J. Puigserver P. Spiegelman B.M. Genes Dev. 2000; 14: 1293-1307PubMed Google Scholar). is a significant in the and the increasing of is to in an increased of the and its 2 and M. Savage D.B. Chatterjee V.K. O'Rahilly S. J. Endocrinol. 2003; PubMed Scopus Google Scholar). that PPARγ and adipogenesis increase and are used in the of 2 the process J.M. J. 2000; PubMed Scopus Google Scholar). of PPARγ results in of of and increased W. Y. A. P. D. J. M. J.M. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 2003; PubMed Scopus Google Scholar, H. M. A. J. Proc. Natl. Acad. Sci. U. S. A. 2003; PubMed Scopus Google Scholar). that PPARγ has other important in addition to its effects on adipogenesis. For a of PPARγ results in and resistance A.L. W. Y. J. P. J. Evans R.M. J. 2003; PubMed Scopus Google Scholar). data suggest a role for PPARγ in function and Glass C.K. 2002; PubMed Scopus Google Scholar). However, the of PPARγ have been in adipogenesis, and differentiation a model in which to study PPARγ Although is concerning the ability of PPARγ to recruit coactivators to the expression of target genes, less is concerning the ability of PPARγ to with the nuclear receptor corepressor NCoR and In the ability of these nuclear corepressors to modulate the transcriptional activity of PPARγ has been has been to the that PPARγ is not to be a strong and PPARγ corepressors only in (3.Zamir I. Zhang J. Lazar M.A. Genes Dev. 1997; 11: 835-846Crossref PubMed Scopus (200) Google Scholar). however, have shown a significant in cells (6.Wang L.H. Yang X.Y. Zhang X. Huang J. Hou J. Li J. Xiong H. Mihalic K. Zhu H. Xiao W. Farrar W.L. Immunity. 2004; 20: 205-218Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 7.Gurnell M. Wentworth J.M. Agostini M. Adams M. Collingwood T.N. Provenzano C. Browne P.O. Rajanayagam O. Burris T.P. Schwabe J.W. Lazar M.A. Chatterjee V.K. J. Biol. Chem. 2000; 275: 5754-5759Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar). that other nuclear receptors that are not strong in are capable of corepressors to their transcriptional activity. For an nuclear recruits SMRT, which then coactivator recruitment Mol. Biol. 2002; PubMed Scopus Google Scholar). In the ability of nuclear receptors to recruit corepressors and coactivators has been shown to be a more process previously Kim Lee S. Lee Lee J.W. Mol. Endocrinol. 2003; PubMed Scopus Google Scholar), and the plays a significant role in gene regulation Huang Y. S. Mol. Endocrinol. 2004; PubMed Scopus Google Scholar). In addition, recent that mutant PPARγ receptors capable of PPARγ resistance recruit corepressors and exhibit activity (9.Agostini M. Gurnell M. Savage D.B. Wood E.M. Smith A.G. Rajanayagam O. Garnes K.T. Levinson S.H. Xu H.E. Schwabe J.W. Willson T.M. O'Rahilly S. Chatterjee V.K. Endocrinology. 2004; 145: 1527-1538Crossref PubMed Scopus (54) Google Scholar). Although the nuclear receptor corepressors NCoR and SMRT have been in the of resistance to thyroid and certain types of K. Rosenfeld M.G. J. Cell Sci. 2002; PubMed Google Scholar), the of NCoR and SMRT in cells have been to for a of For of NCoR has been found to be in the K. O. T.M. Kurokawa R. F. Glass C.K. Rose D.W. Rosenfeld M.G. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar), the ability to which of corepressors might be In work has suggested that NCoR and SMRT a of and are recruited by nuclear receptors in the absence of ligand or in the presence of certain antagonists. However, overexpression of nuclear have not been to the of these For suggested significant but in have shown that their are Endocrinology. 2002; PubMed Scopus Google Scholar). The of siRNA for the expression of in cells to for a of their We of these in 3T3-L1 cells to the of NCoR and SMRT in adipogenesis. Our data suggest that expression of either NCoR or SMRT is to increase the expression of adipocyte-specific genes and adipogenesis. Although are an in corepressor could data suggest that these effects on the transcriptional activity of This is for a of of have shown that PPARγ is a central regulator of adipogenesis, and in PPARγ activity adipogenesis N. Y. H. H. T. K. S. R. C. T. K. Y. A. K. H. M. Y. S. K. T. T. O. S. R. K. S. T. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar, E.D. P. K. Spiegelman B.M. R.M. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar, Y. P. A. Evans R.M. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar). it has been shown that mutant PPARγ receptors that recruit corepressors aberrantly can adipogenesis M. Wentworth J.M. Agostini M. Adams M. Collingwood T.N. Provenzano C. Browne P.O. Rajanayagam O. Burris T.P. Schwabe J.W. Lazar M.A. Chatterjee V.K. J. Biol. Chem. 2000; 275: 5754-5759Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, M. Gurnell M. Savage D.B. Wood E.M. Smith A.G. Rajanayagam O. Garnes K.T. Levinson S.H. Xu H.E. Schwabe J.W. Willson T.M. O'Rahilly S. Chatterjee V.K. Endocrinology. 2004; 145: 1527-1538Crossref PubMed Scopus (54) Google Scholar, Y. Freedman B.D. Lee E.J. Park S. Jameson J.L. Diabetologia. 2003; 46: 365-377Crossref PubMed Scopus (250) Google Scholar). of PPARγ to enhanced as to suggesting that PPARγ could have ligand-independent effects mediated by corepressors Y. W. Evans R.M. J.M. J. 2000; PubMed Scopus Google Scholar). Finally, data suggest that PPARγ is capable of SMRT and NCoR in 3T3-L1 cells and that these nuclear receptor corepressors repress PPARγ-mediated transcriptional activity. In addition, in SMRT or NCoR adipogenesis, either in the presence of a differentiation or that a a data suggest that a decrease in NCoR or SMRT PPARγ activity and the expression of adipocyte-specific genes. a recent report suggested that the NAD-dependent deacetylase Sirt1 PPARγ activity and fat accumulation (10.Picard F. Kurtev M. Chung N. Topark-Ngarm A. Senawong T. Oliveira R.M. Leid M. McBurney M.W. Guarente L. Nature. 2004; 429: 771-776Crossref PubMed Scopus (1624) Google Scholar). In that the Sirt1 was on NCoR and NCoR was shown to be recruited to the promoter by (10.Picard F. Kurtev M. Chung N. Topark-Ngarm A. Senawong T. Oliveira R.M. Leid M. McBurney M.W. Guarente L. Nature. 2004; 429: 771-776Crossref PubMed Scopus (1624) Google Scholar). The data are in with the data of (10.Picard F. Kurtev M. Chung N. Topark-Ngarm A. Senawong T. Oliveira R.M. Leid M. McBurney M.W. Guarente L. Nature. 2004; 429: 771-776Crossref PubMed Scopus (1624) Google Scholar) and suggest that in NCoR and SMRT by can modulate adipogenesis. Our work that PPARγ recruits NCoR and SMRT and that these nuclear receptor corepressors repress the ability of PPARγ to adipogenesis. This an or to the ability of as to increase PPARγ transcriptional activity and adipogenesis and that in corepressor activity might for of differentiation and in In in NCoR or SMRT expression function a for the adipogenic which has been shown to be important in the of and 2 We Wondisford for and Hollenberg for the of the We T. C. J. D. and R. Evans for was provided by Takeda