Publication | Open Access
The Membrane Association Domain of RGS16 Contains Unique Amphipathic Features That Are Conserved in RGS4 and RGS5
101
Citations
20
References
1999
Year
Regulators of G protein signaling (RGS proteins) modulate G protein-mediated signaling pathways by acting as GTPase-activating proteins for Gi, Gq, and G12 α-subunits of heterotrimeric G proteins. Although it is known that membrane association is critical for the biological activities of many RGS proteins, the mechanism underlying this requirement remains unclear. We reported recently that the NH2 terminus of RGS16 is required for its function in vivo. In this study, we show that RGS16 lacking the NH2 terminus is no longer localized to the plasma membrane as is the wild type protein, suggesting that membrane association is important for biological function. The region of amino acids 7–32 is sufficient to confer the membrane-targeting activity, of which amino acids 12–30 are predicted to adopt an amphipathic α-helix. Site-directed mutagenesis experiments showed that the hydrophobic residues of the nonpolar face of the helix and the strips of positively charged side chains positioned along the polar/nonpolar interface of the helix are crucial for membrane association. Subcellular fractionation by differential centrifugation followed by conditions that distinguish peripheral membrane proteins from integral ones indicate that RGS16 is a peripheral membrane protein. We show further that RGS16 membrane association does not require palmitoylation. Our results, together with other recent findings, have defined a unique membrane association domain with amphipathic features. We believe that these structural features and the mechanism of membrane association of RGS16 are likely to apply to the homologous domains in RGS4 and RGS5. Regulators of G protein signaling (RGS proteins) modulate G protein-mediated signaling pathways by acting as GTPase-activating proteins for Gi, Gq, and G12 α-subunits of heterotrimeric G proteins. Although it is known that membrane association is critical for the biological activities of many RGS proteins, the mechanism underlying this requirement remains unclear. We reported recently that the NH2 terminus of RGS16 is required for its function in vivo. In this study, we show that RGS16 lacking the NH2 terminus is no longer localized to the plasma membrane as is the wild type protein, suggesting that membrane association is important for biological function. The region of amino acids 7–32 is sufficient to confer the membrane-targeting activity, of which amino acids 12–30 are predicted to adopt an amphipathic α-helix. Site-directed mutagenesis experiments showed that the hydrophobic residues of the nonpolar face of the helix and the strips of positively charged side chains positioned along the polar/nonpolar interface of the helix are crucial for membrane association. Subcellular fractionation by differential centrifugation followed by conditions that distinguish peripheral membrane proteins from integral ones indicate that RGS16 is a peripheral membrane protein. We show further that RGS16 membrane association does not require palmitoylation. Our results, together with other recent findings, have defined a unique membrane association domain with amphipathic features. We believe that these structural features and the mechanism of membrane association of RGS16 are likely to apply to the homologous domains in RGS4 and RGS5. regulator of G protein signaling green fluorescent protein Gα-interacting protein Regulators of G protein signaling (RGS1 proteins) have emerged as major modulators of diverse aspects of biological activities (1Koelle M.R. Horvitz H.R. Cell. 1996; 84: 115-125Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar, 2Dohlman H.G. Thorner J. J. Biol. Chem. 1997; 272: 3871-3874Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar, 3Berman D.M. Gilman A.G. J. Biol. Chem. 1998; 273: 1269-1272Abstract Full Text Full Text PDF PubMed Scopus (447) Google Scholar, 4Kehrl J.H. Immunity. 1998; 8: 1-10Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). It has been well established that RGS proteins act as GTPase-activating factors for many of the heterotrimeric G protein α-subunits (5Berman D.M. Wilkie T.M. Gilman A.G. Cell. 1996; 86: 445-452Abstract Full Text Full Text PDF PubMed Scopus (660) Google Scholar, 6Watson N. Linder M.E. Druey K.M. Kehrl J.H. Blumer K.J. Nature. 1996; 383: 172-175Crossref PubMed Scopus (482) Google Scholar, 7Hunt T.W. Fields T.A. Casey P.J. Peralta E.G. Nature. 1996; 383: 175-177Crossref PubMed Scopus (311) Google Scholar). The core RGS domain is responsible for GTPase-activating protein activity, although it is not sufficient for biological functionin vivo (8Dohlman H.G. Song J. Ma D. Courchesne W.E. Thorner J. Mol. Cell. Biol. 1996; 16: 5194-5209Crossref PubMed Google Scholar, 9Faurobert E. Hurley J.B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2945-2950Crossref PubMed Scopus (94) Google Scholar, 10Chen C. Lin S.C. FEBS Lett. 1998; 422: 359-362Crossref PubMed Scopus (36) Google Scholar, 11Popov S. Yu K. Kozasa T. Wilkie T.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7216-7220Crossref PubMed Scopus (150) Google Scholar, 12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar). Many RGS proteins have been shown to be membrane-associated. GAIP behaves as an integral membrane protein as judged by its resistance to the stripping effect of Na2CO3 treatment (13De Vries L. McCaffery J.M. Fischer T. Hubler L. McQuistan T. Watson N. Farquhar M.G. Mol. Biol. Cell. 1998; 9: 1123-1134Crossref PubMed Scopus (89) Google Scholar). Plasma membrane association has also been shown to be required for RGS4 function (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar). RGSZ1, a Gz-selective RGS protein in the brain, is also tightly membrane-bound and requires membrane association for its GTPase-activating protein activity toward Gz (14Wang J. Ducret A. Tu Y. Kozasa T. Aebesold R. Ross E.M. J. Biol. Chem. 1998; 273: 26014-26025Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar,15Glick J.L. Meigs T.E. Miron A. Casey P.J. J. Biol. Chem. 1998; 273: 26008-26013Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). However, it is unclear how they are targeted to the membrane. RET-RGS1, another potentially membrane-bound RGS member, contains a putative transmembrane domain and multiple cysteine residues for palmitoylation (9Faurobert E. Hurley J.B. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2945-2950Crossref PubMed Scopus (94) Google Scholar). GAIP and RGS4 also possess cysteine string motifs in their NH2 terminus and have been shown to be palmitoylated (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar, 13De Vries L. McCaffery J.M. Fischer T. Hubler L. McQuistan T. Watson N. Farquhar M.G. Mol. Biol. Cell. 1998; 9: 1123-1134Crossref PubMed Scopus (89) Google Scholar). Although palmitoylated GAIP is found only in pellet fractions, the functional significance of palmitoylation has yet to be established. Surprisingly, palmitoylation of RGS4 is shown not to be required for membrane targeting (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar). It is intriguing that a defective RGS4, which can no longer bind to G proteins, can be recruited to plasma membrane by a constitutively activating Gα subunit (16Druey K.M. Sullivan B.M. Brown D. Fischer E.R. Watson N. Blumer K.J. Gerfen C.R. Scheschonka A. Kehrl J.H. J. Biol. Chem. 1998; 273: 18405-18410Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). These data suggest that RGS association with the plasma membrane may not be through simple binding to GTP-bound G proteins on the membrane but may rather involve an independent mechanism. It has been shown recently that RGS4 requires its NH2terminus for membrane association and biological function as assessed by its ability to substitute the function of Sst2p, an RGS member in yeast (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar). As noted by Linder and colleagues (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar), the RGS4 NH2-terminal 33-amino acid domain is conserved in RGS5 and RGS16 and is predicted to adopt an amphipathic helix with clusters of basic residues. In this study, we demonstrate that the NH2-terminal domain of RGS16 is also required for membrane association and biological activity. Furthermore, with the aid of computer modeling, we found that the RGS16 membrane association domain has structural features most reminiscent of those found in the membrane intercalating domain of CTP:phosphocholine cytidylyltransferase (17Dunne S.J. Cornell R.B. Johnson J.E. Glover N.R. Tracey A.S. Biochemistry. 1996; 35: 11975-11984Crossref PubMed Scopus (91) Google Scholar). With that in perspective, we have carried out extensive mutational analysis to study the structure-function relationship of the RGS16 NH2-terminal domain. Our results fine map the core membrane association domain to the NH2-terminal amino acids 7–32 region. The bulk of this region consists of an amphipathic helix. The hydrophobic residues of the nonpolar face and the positive charge side chains positioned along the polar/nonpolar interface of the amphipathic helix are essential for membrane association. Moreover, we show that the conserved palmitoylation site in RGS16, Cys-12, which has been shown to be palmitoylated in RGS4, plays a minor role in membrane association. Taken together, our findings and work done by others have defined a unique amphipathic domain that will provide a structural basis for RGS membrane association and biological activities. To visualize the subcellular localization of RGS16 protein in yeast cells, the coding region of RGS16 was fused to green fluorescent protein (GFP) cDNA and was expressed in yeast cells under the control of a galactose-inducible promoter in the pMW29 vector as described previously (18Chen C. Zheng B. Han J. Lin S.-C. J. Biol. Chem. 1997; 272: 8679-8685Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Briefly, aBamHI site was introduced to RGS16 cDNA just before the stop codon by polymerase chain reaction. The sense and the antisense oligonucleotide primers were CTCGAGATGTGCCGCACCCTAGCCACCTTCC and CGGGTCGACTCGGAAGTGTGTGCCTAGGAATT, respectively. The polymerase chain reaction product was then treated with Klenow DNA polymerase and polynucleotide kinase and ligated to BamHI/Klenow-treated pBluescript (Stratagene) for sequencing analysis. The entire coding region of RGS16 was fused in-frame to GFP in pEGFPN1 (CLONTECH) through the BamHI site to create RGS16-GFP chimeric cDNA. The fusion cDNA fragment was then cloned into the yeast expression vector pMW29 to generate the pMW29-RGS16-GFP construct. Two deletion mutants, (7–201)RGS16 and (11–201)RGS16, were generated by polymerase chain reactions. The 5′-primers were CATATGACCTTCCCCAACACCTGCCTG and CATATGACCTGCCTGGAGAGAGCTAAAG, respectively; the common 3′-primer was GGGTCAAGTGTGTGAAGGCTCAGCTGGGC. The resultant NH2termini of these three deletion mutants were used to replace the wild type NH2 terminus of the above created pMW29-RGS16-GFP through the internal SacI site, creating pMW29-(7–201)-GFP and pMW29-(11–201)-GFP. To create RGS16 NH2-terminal GFP fusion constructs, the NH2-terminal coding fragments for the wild type RGS16 and individual deletion mutants were digested withSacI, blunt ended with Klenow polymerase, and released from the pBluescript with XhoI. These fragments were then fused in-frame to the start of the GFP coding region in the pEGFPN1 vector, which was cut with BamHI, Klenow treated (blunt ended), and digested with XhoI. The XhoI/NotI fragments of the generated RGS16 NH2terminal GFP fusion cDNA were blunt ended with Klenow polymerase and ligated to theSmaI site of pMW29, resulting in pMW29-(1–32)GFP, pMW29-(7–32)-GFP, and pMW29-(11–32)-GFP. A standard polymerase chain reaction method was used to produce six point mutations near the 5′-end of RGS16, C2A, F8D, F8G, F8K, P9A, P9D, and P9G. The other mutants, C12A, R15A, R15E, A16D, K17A, K17E, F19A, F19D, F19E, F19N, F19T, K20A, K20E, R22A, R22E, L23D, and were created by mutagenesis the mutagenesis the above generated mutants R22A, R22E, K20A, and as mutants and were respectively. The fragments point were released from the pBluescript with to replace their wild type in The of the oligonucleotide primers for mutagenesis are The ability of individual RGS16 fusion GFP to the signaling in yeast was as described previously with C. Lin S.C. FEBS Lett. 1998; 422: 359-362Crossref PubMed Scopus (36) Google Scholar). The yeast was (8Dohlman H.G. Song J. Ma D. Courchesne W.E. Thorner J. Mol. Cell. Biol. 1996; 16: 5194-5209Crossref PubMed Google Scholar). The of to the of was The expression of RGS16 were by (CLONTECH) as described previously C. Lin S.C. FEBS Lett. 1998; 422: 359-362Crossref PubMed Scopus (36) Google Scholar). cells were in to The yeast cells were then a of on were a with an The of cells in were a and with fractionation by differential was carried out as described A. S. Biochemistry. 1997; PubMed Scopus Google Scholar). Briefly, yeast pMW29-RGS16-GFP and were in with to were and with and were by with centrifugation for the was then for to generate a pellet and a was further for to generate a pellet and a and were with the in the as their To RGS16-GFP fusion proteins in an of individual was on a to an and with the C. Lin S.C. FEBS Lett. 1998; 422: 359-362Crossref PubMed Scopus (36) Google the to the To the of the membrane association of wild type RGS16 and proteins, the was with of Na2CO3 on for these were for pellet was in the as that of its were on the and by as of was The was on of protein Sci. 1996; PubMed Scopus Google Scholar). The region predicted to an was to the membrane domain of The was on the of and C. S. J. Mol. Biol. PubMed Scopus Google Scholar). The to the resulting in the of side chains with We have shown previously that of amino acids RGS16 in the yeast and yet the core RGS domain of the features of a GTPase-activating protein C. Lin S.C. FEBS Lett. 1998; 422: 359-362Crossref PubMed Scopus (36) Google Scholar, C. Zheng B. Han J. Lin S.-C. J. Biol. Chem. 1997; 272: 8679-8685Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Linder and colleagues (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google have shown that a domain in RGS4 as a membrane targeting and is also required for RGS4 function. to study this membrane association is a requirement for RGS function. We fused the RGS16 NH2terminus to GFP to this region confer membrane-targeting activity to a protein in As shown in the amino acids were sufficient to GFP to the plasma membrane. We then the of the mutants of RGS16 is to its to to the plasma membrane the and In the yeast cells, in to are in the of and a on a on an RGS16 can substitute for the yeast in the of signaling and (18Chen C. Zheng B. Han J. Lin S.-C. J. Biol. Chem. 1997; 272: 8679-8685Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). of amino acids not RGS16 membrane association biological activity However, of amino acids RGS16 in membrane association and in of signaling that membrane of RGS16 is important for its function in the analysis and as in the NH2-terminal membrane association amino acids and respectively. To the role of these three amino acids and were As shown above deletion of not membrane association biological activity, of RGS16 in membrane association and of To fine map residues essential for membrane residues and of RGS16 were these amino acids are conserved in RGS4, and RGS16 is an amino acid with conserved hydrophobic side chain in RGS4 and and in is a conserved In RGS16, of the hydrophobic side chain to a of biological activity, with a in membrane association of the conserved and no effect on RGS16 function. which charge and RGS16 membrane association. The requirement of to be hydrophobic and the effect with and suggest that the side chains of these residues may with the plasma membrane. The above results, in of the amino acids 7–32 as the core membrane association of conserved residues and in amino acids 7–32 on RGS16 function. The conserved was to was to in the of yeast cells GFP fusion are shown on the are on analysis of expression of fusion proteins is shown in the wild by Linder and colleagues (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google suggest that the NH2-terminal amino acids of RGS4 be for membrane region is conserved RGS4, as well as We to study the role and structural features of the helix acids in to residues and We predicted its protein computer and the of the with structure-function analysis. The predicted of the helix is that of an amphipathic helix with a of hydrophobic residues on and strips of positively charged residues along the polar/nonpolar interface of the amphipathic were for the hydrophobic and basic residues to the of these residues toward membrane The hydrophobic consists of nonpolar residues. mutations of of these nonpolar residues to an F19D, L23D, and in a of RGS16 biological activity the and mutations RGS16 as judged by its to that by cells with GFP To the of in membrane was and was by a of residues with a of F19T, F19N, F19E, and As shown in the mutations to a in the of to a in the of and a in its in the on the predicted of the amphipathic helix the of positively charged residues along the polar/nonpolar interface is reminiscent of those found in the amphipathic of cytidylyltransferase (17Dunne S.J. Cornell R.B. Johnson J.E. Glover N.R. Tracey A.S. Biochemistry. 1996; 35: 11975-11984Crossref PubMed Scopus (91) Google and D. FEBS Lett. PubMed Scopus Google Scholar). In the as a membrane-targeting domain with positive charge residues positioned along the polar/nonpolar To study the role of these basic a of and mutations was basic was with an The in the of membrane targeting and mutations no a of basic residues was to in the of membrane targeting and We the mutagenesis with a mutations were defective the of which in the of membrane targeting and biological activity. the the effect with other mutations R15E, and In the the was others The of function resulting from the of the basic residues with a nonpolar an the of these basic residues. not mutations on these basic residues have a effect on RGS16 biological activity, the role of these basic residues likely on their along the amphipathic helix of positively charged residues in the membrane association region on the function of plasma positively charged and were to and were to residues These mutants were for their ability to and subcellular The on yeast cells were expressed to those of vector GFP and wild type RGS16 plasma in a positively charged and were to and were to residues These mutants were for their ability to and subcellular The on yeast cells were expressed to those of vector GFP and wild type RGS16 respectively. To the membrane localization of RGS16 in we by differential centrifugation from yeast cells with the wild type RGS16 and from yeast cells as a were then to analysis the As most of the RGS16 was in the membrane pellet with in the In the protein was To the of the RGS16 with the plasma fractions, were treated with conditions that peripheral membrane proteins integral membrane proteins. RGS16 was the membrane with but was only released from the membrane by treatment with These data indicate that RGS16 is a peripheral membrane protein. and of RGS4 have been shown to be palmitoylation (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar). RGS16 contains cysteine residues the In this study, we and to and the effect of these residues on RGS16 activity and its membrane association. Although of to effect on membrane association on the activity of the was to the functional of RGS16 is with the results with that the amino acids are not essential for RGS16 function We have shown previously that the core RGS domain of RGS16 activity in G protein binding and GTPase-activating protein activity in but requires the NH2 terminus for biological activity in vivo as by its ability to signaling in Our work in this study that RGS16 NH2 terminus plays a critical role in membrane association and also that membrane association may be important for RGS biological in with has been shown with The amino acids of RGS4, and RGS16 are It was that the entire domain of amino acids in RGS4 a amphipathic helix and is required for membrane association (12Srinivasa S.P. Bernstein L.S. Blumer K.J. Linder M.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5584-5589Crossref PubMed Scopus (131) Google Scholar). However, our analysis that may be putative in the NH2-terminal amino acids Our deletion experiments suggest that the of amino acids which the is not for biological activity. The of the NH2 terminus acids which consists of the putative from amino acids has been defined as core membrane association domain. Furthermore, through mutational we show that the amphipathic features of the membrane-targeting activity for RGS16, and these are likely by the homologous RGS4 and by RGS5. of the predicted of the RGS16 amphipathic helix many found in amphipathic in membrane the membrane association domains of CTP:phosphocholine cytidylyltransferase and (17Dunne S.J. Cornell R.B. Johnson J.E. Glover N.R. Tracey A.S. Biochemistry. 1996; 35: 11975-11984Crossref PubMed Scopus (91) Google Scholar, D. FEBS Lett. PubMed Scopus Google Scholar). the nonpolar face of the amphipathic consists of a of hydrophobic strips of positively charged residues are positioned along the polar/nonpolar The important factors to membrane association are hydrophobic of the nonpolar face of the helix and the core the of the helix. the side chains of and which strips of positive along the polar/nonpolar interface of the and the charged of the in the are mutations on hydrophobic residues on the nonpolar side of the putative amphipathic helix to a of function. the hydrophobic and to be the most with their in the of the core amphipathic helix. The requirement of for membrane is further by a of mutations on a As with no However, mutations to of in in membrane association. However, it be noted that of the NH2-terminal mutants the biological activity with GFP As shown the RGS domain of RGS16 GTPase-activating protein activity with the wild type protein C. Lin S.C. FEBS Lett. 1998; 422: 359-362Crossref PubMed Scopus (36) Google Scholar). with the of the RGS16 NH2-terminal mutants of the proteins which on the membrane with the most may to the activities. most mutations on the basic residues to a of function. A of basic residues with an effect on RGS16 with is with the that multiple basic residues are positioned the polar/nonpolar The effect of of a positive charge may be by as its can be by basic residues. However, with a will the polar/nonpolar to of and membrane is by the that mutations on the basic residues have their is that the has no effect on biological activity of is with the predicted of the amphipathic the side chain of is toward the core and from the polar/nonpolar the of the positive side chain of has no effect on the Many membrane association involve of hydrophobic and a of basic residues. In kinase proteins the hydrophobic is a S. A. Sci. Full Text PDF PubMed Scopus Google Scholar, S. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google in CTP:phosphocholine it is the hydrophobic side chains in the nonpolar face of the amphipathic (17Dunne S.J. Cornell R.B. Johnson J.E. Glover N.R. Tracey A.S. Biochemistry. 1996; 35: 11975-11984Crossref PubMed Scopus (91) Google Scholar). In the of RGS16 and most RGS4 and the mechanism used may that of CTP:phosphocholine However, are The of the predicted amphipathic of RGS16 is the of CTP:phosphocholine the RGS16 has the conserved palmitoylation site the amphipathic helix. Although on RGS4 and RGS16 in yeast not demonstrate of palmitoylation in membrane it is to out its role in It is of to the role of palmitoylation in RGS proteins. As a our findings suggest that RGS16 with the plasma membrane through hydrophobic nonpolar residues of RGS16 and membrane and through the basic residues and the in the membrane. However, the mechanism of RGS membrane association is by reported RGS4 and RGS16 to be in the membrane in yeast cells, but these proteins are in the in cells (16Druey K.M. Sullivan B.M. Brown D. Fischer E.R. Watson N. Blumer K.J. Gerfen C.R. Scheschonka A. Kehrl J.H. J. Biol. Chem. 1998; 273: 18405-18410Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). L. and S.-C. data not of a constitutively activating can a G RGS4 protein to the plasma membrane (16Druey K.M. Sullivan B.M. Brown D. Fischer E.R. Watson N. Blumer K.J. Gerfen C.R. Scheschonka A. Kehrl J.H. J. Biol. Chem. 1998; 273: 18405-18410Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Furthermore, a recent that the of A. E. S. Kehrl J.H. Mol. Cell. Biol. PubMed Google Scholar). These point to a that may be a mechanism the subcellular of RGS proteins which of G protein is that G protein binding of a to the membrane-targeting region of the RGS proteins for to the membrane. In we have a membrane protein that to the region required for membrane association. and S. C. The biological significance of this remains to be our extensive mutational analysis and computer have defined a unique membrane association domain that is by RGS4, and the structural basis of the RGS membrane targeting domains will how RGS proteins function to signaling pathways by G
| Year | Citations | |
|---|---|---|
Page 1
Page 1