The Mechanism of GT Element-mediated Cell Type-specific Transcriptional Control

Abstract

Promoter studies have revealed that sequences related to the GT-1 binding site, known as GT elements, are conserved in plant nuclear genes of diverse functions. In this work, we addressed the issue of whether GT elements are involved in cell type-specific transcriptional regulation. We found that the inactivation of GT-1 site-mediated transcription in roots is correlated with the absence of the GT-1 binding activity in root extracts. In addition, the mutation of the related GT-1 (from the pea rbcs-3A) and the S1F (from the spinach rps1) sites resulted in an increase of their transcriptional activity in roots that contain a distinct GT element-binding factor, referred to as RGTF. Although specific to GT elements, RGTF has a different sequence requirement and a lower sequence specificity than GT-1. Interestingly, RGTF has a higher binding affinity to the mutant GT-1 and S1F sites than to the wild-type sequences. This correlation suggests that RGTF may have some role in transcriptional regulation in roots. Furthermore, root cellular protein extracts contain an inhibitory activity that prevents GT-1 from binding to DNA. This helps to explain the absence of the GT-1 binding activity in roots in which the gene of GT-1 is expressed. Together, these data suggest that the cell type-specific transcription modulation by GT elements is achieved by using two different strategies. Promoter studies have revealed that sequences related to the GT-1 binding site, known as GT elements, are conserved in plant nuclear genes of diverse functions. In this work, we addressed the issue of whether GT elements are involved in cell type-specific transcriptional regulation. We found that the inactivation of GT-1 site-mediated transcription in roots is correlated with the absence of the GT-1 binding activity in root extracts. In addition, the mutation of the related GT-1 (from the pea rbcs-3A) and the S1F (from the spinach rps1) sites resulted in an increase of their transcriptional activity in roots that contain a distinct GT element-binding factor, referred to as RGTF. Although specific to GT elements, RGTF has a different sequence requirement and a lower sequence specificity than GT-1. Interestingly, RGTF has a higher binding affinity to the mutant GT-1 and S1F sites than to the wild-type sequences. This correlation suggests that RGTF may have some role in transcriptional regulation in roots. Furthermore, root cellular protein extracts contain an inhibitory activity that prevents GT-1 from binding to DNA. This helps to explain the absence of the GT-1 binding activity in roots in which the gene of GT-1 is expressed. Together, these data suggest that the cell type-specific transcription modulation by GT elements is achieved by using two different strategies. INTRODUCTIONThe expression of nuclear genes encoding both photosynthetic and plastid ribosomal proteins (r-proteins) 2The abbreviations used are: r-proteinribosomal-proteinGUSβ-glucuronidase. is highly mesophyllous cell-specific. Plastid r-protein genes provide a good system to define cis-acting promoter elements and their binding factors involved in cell type-specific regulation. The transcription of these genes is highly activated in the leaf mesophyllous cells, compared with amyloplast-containing root cells and chromoplast-containing flower and fruit cells (1Franzetti B. Zhou D.-X. Mache R. Nucleic Acids Res. 1992; 20: 4153-4157Crossref PubMed Scopus (19) Google Scholar, 2Lagrange T. Franzetti F. Axelos M. Mache R. Lerbs-Mache S. Mol. Cell. Biol. 1993; 13: 2614-2622Crossref PubMed Scopus (41) Google Scholar, 3Li Y.-F. Zhou D.-X. Clabault G. Bisanz-Seyer C. Mache R. Plant Mol. Biol. 1995; 28: 595-604Crossref PubMed Scopus (4) Google Scholar). In contrast to photosynthetic genes, the transcriptional activation of r-protein genes in the mesophyllous cells is light-independent (3Li Y.-F. Zhou D.-X. Clabault G. Bisanz-Seyer C. Mache R. Plant Mol. Biol. 1995; 28: 595-604Crossref PubMed Scopus (4) Google Scholar). This specific pattern of transcriptional regulation of the r-protein genes suggests the existence of either specific transcriptional activators in chloroplast-containing cells and/or repressors in nonphotosynthetic cells. Studies on the rps1 gene coding for the r-protein CS1 have led to the identification of a promoter sequence that is specifically recognized by a leaf factor, known as S1F (4Zhou D.-X. Li Y.-F. Rocipon M. Mache R. J. Biol. Chem. 1992; 267: 23515-23519Abstract Full Text PDF PubMed Google Scholar). It has been shown that the S1F binding site had a negative function in regulating the rps1 promoter in root cells and in protoplasts (4Zhou D.-X. Li Y.-F. Rocipon M. Mache R. J. Biol. Chem. 1992; 267: 23515-23519Abstract Full Text PDF PubMed Google Scholar, 5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google Scholar). It looked likely that the S1F binding site was involved in the cell type-specific regulation of the rps1 gene.Interestingly, the S1F binding site found also in other r-protein genes (2Lagrange T. Franzetti F. Axelos M. Mache R. Lerbs-Mache S. Mol. Cell. Biol. 1993; 13: 2614-2622Crossref PubMed Scopus (41) Google Scholar) is related to the GT-1 binding site of the pea rbcs-3A gene as shown by competition binding assays (5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google Scholar). The GT-1 binding site initially identified as Box II by Fluhr et al. (6Fluhr R. Kuhlemeier C. Chua N.-H. Science. 1986; 232: 1106-1112Crossref PubMed Scopus (170) Google Scholar) and five other similar sequences found in the pea rbcs-3A gene (7Green P.J. Kay S.A. Chua N.-H. EMBO J. 1987; 6: 2543-2549Crossref PubMed Scopus (267) Google Scholar) have been shown to play an important role in the light-regulated transcription of the gene (8Kuhlemeier C. Cuozzo M. Green P.J. Goyvaerts E. Ward K. Chua N.-H. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 4662-4666Crossref PubMed Scopus (89) Google Scholar). Sequences homologous to Box II have also been found within upstream regions of numerous other genes including ones not regulated by light (9Gilmartin P.M. Sarokin L. Memelink J. Chua N.-H. Plant Cell. 1990; 2: 369-378Crossref PubMed Scopus (375) Google Scholar). Specifically, cis-elements involved in tissue-specific (52/56 box in the pollen-specific lat52) (10Eyal Y. Curie C. McCormick S. Plant Cell. 1995; 7: 373-384Crossref PubMed Scopus (96) Google Scholar), defense-related (SBF-1 binding sites in the soybean chs15) (11Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google Scholar), light-repressed (the GT-2 binding sites in the rice phya) (12Dehesh K. Bruce W.B. Quail P.H. Science. 1990; 250: 1397-1399Crossref PubMed Scopus (90) Google Scholar), and circadian clock-controlled (CGF site in cab2) (13Anderson S.L. Teakle G.R. Martino-Catt S.J. Kay S.A. Plant J. 1994; 6: 457-470Crossref PubMed Scopus (95) Google Scholar) transcriptional regulation have been shown to be related to the GT-1 binding site as demonstrated by competition binding assays (Table I). These GT-1 binding site (Box II)-related elements are known as GT elements. The sequences of the defined GT elements show much variation when compared with the pea rbcs-3A gene Box II core sequence GGTTAA (Table I). This core sequence has been shown to be required for the GT-1 binding in vitro (14Green P.J. Youg M.-H. Cuozzo M. Kano-Murakami Y. Silverstein P. Chua N.-H. EMBO J. 1988; 7: 4035-4044Crossref PubMed Scopus (165) Google Scholar) and the light-responsive function in vivo (15Lam E. Chua N.-H. Science. 1990; 248: 471-474Crossref PubMed Scopus (144) Google Scholar). One common characteristic to all GT elements is a core sequence rich in nucleotides T and A rather than G and T, as indicated by the name. The flanking sequences are quite divergent. The diversity of GT elements suggests that a single binding factor such as GT-1 can bind to many related GT elements. Alternatively, there may be different GT element-binding proteins with different specificities and functions. A few GT element-binding factors have been characterized, among which GT-1 and GT-2 have been cloned (12Dehesh K. Bruce W.B. Quail P.H. Science. 1990; 250: 1397-1399Crossref PubMed Scopus (90) Google Scholar, 16Perisic O. Lam E. Plant Cell. 1992; 4: 831-838Crossref PubMed Scopus (79) Google Scholar, 17Gilmartin P.M. Memelink J. Hiratsuka K. Kay S.A. Chua N.-H. Plant Cell. 1992; 4: 839Crossref PubMed Scopus (94) Google Scholar). GT-1 and GT-2 are related proteins with one or two trihelical DNA-binding motifs, each of which recognizes different degenerated GT elements. For example, each of the two trihelical domains of GT-2 has a higher binding affinity to either GT2 or GT3 boxes of the rice phya gene, but both domains bind only poorly to the GT-1 site (18Dehesh K. Hung H. Tepperman J.M. Quail P.H. EMBO J. 1992; 11: 4131-4144Crossref PubMed Scopus (69) Google Scholar), whereas the trihelix of GT-1 has at least a 20-fold higher affinity to Box II than to any other tested GT elements (19Hiratsuka K. Wu X. Fukuzawa H. Chua N.-H. Plant Cell. 1994; 6: 1805-1813Crossref PubMed Scopus (54) Google Scholar). Interestingly, the genes for both GT-1 and GT-2 are expressed in all parts of the plants and are not regulated by light (17Gilmartin P.M. Memelink J. Hiratsuka K. Kay S.A. Chua N.-H. Plant Cell. 1992; 4: 839Crossref PubMed Scopus (94) Google Scholar, 18Dehesh K. Hung H. Tepperman J.M. Quail P.H. EMBO J. 1992; 11: 4131-4144Crossref PubMed Scopus (69) Google Scholar, 19Hiratsuka K. Wu X. Fukuzawa H. Chua N.-H. Plant Cell. 1994; 6: 1805-1813Crossref PubMed Scopus (54) Google Scholar). These observations have led to the suggestion that either the transcriptional activity of the factors is regulated by post-translational modification or additional factors may be needed to regulate their activity.Table IA compilation of related GT elementsMotifGeneSequenceFactorReferenceBox IIrbcs-3AGTGTGGTTAATATGGT-114Green P.J. Youg M.-H. Cuozzo M. Kano-Murakami Y. Silverstein P. Chua N.-H. EMBO J. 1988; 7: 4035-4044Crossref PubMed Scopus (165) Google ScholarBox IIIrbcs-3ATAGTGAAAATGATAGT-114Green P.J. Youg M.-H. Cuozzo M. Kano-Murakami Y. Silverstein P. Chua N.-H. EMBO J. 1988; 7: 4035-4044Crossref PubMed Scopus (165) Google ScholarGT-2 boxphyaGGTAATTGT-212Dehesh K. Bruce W.B. Quail P.H. Science. 1990; 250: 1397-1399Crossref PubMed Scopus (90) Google ScholarBox 1chs15TAAAAGTTAAAAACSBF-111Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google ScholarBox 2chs15CTGTGATTAAATATSBF-111Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google ScholarBox 3chs15TATTGGTTACTAAASBF-111Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google ScholarSite 1rps1TCATGGTAACAATTS1F5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google ScholarSite 3rps1AGTTAGTTAAAAGAS1F5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google ScholarCGF sitecab2TAAAGATTACTTCAGATATAACCGF-113Anderson S.L. Teakle G.R. Martino-Catt S.J. Kay S.A. Plant J. 1994; 6: 457-470Crossref PubMed Scopus (95) Google Scholar52/56 boxlat52TATGTGGTTATATAGT-110Eyal Y. Curie C. McCormick S. Plant Cell. 1995; 7: 373-384Crossref PubMed Scopus (96) Google Scholar Open table in a new tab In the present work, we have compared first the transcriptional function of the GT-1 binding site in leaf and root cells. Second, we have examined whether root cells contain any distinct GT element binding activity. Further, we have tried to find out how the transcription repression in roots mediated by GT elements is achieved. The results presented in this paper describe a novel mechanism of differential cell type-specific transcription mediated by GT elements.DISCUSSIONThe highly cell type-specific nature of the expression of genes encoding both the photosynthetic and the plastid ribosomal proteins indicates that internal developmental signals are involved in the regulation. These internal signals include both cell identity and a possible “chloroplast factor,” which seems to be important to couple gene expression of photosynthetic proteins with the presence of chloroplasts in the cell (23Susek R.E. Ausubel F.M. Chory J. Cell. 1993; 74: 787-799Abstract Full Text PDF PubMed Scopus (457) Google Scholar). However, the expression of nuclear genes encoding plastid r-proteins is not dependent on the presence of chloroplasts (24Harrak H. Lagrange T. Bisanz-Seyer C. Lerbs-Mache S. Mache R. Plant Physiol. 1995; 108: 685-692Crossref PubMed Scopus (34) Google Scholar). Therefore, cell type-specific transcription factors are likely to be involved in the regulation of both types of nuclear genes. Promoter studies have shown that the GT-1 binding site is a cis-element with several copies in the promoters of both photosynthetic and ribosomal protein genes (5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google Scholar, 9Gilmartin P.M. Sarokin L. Memelink J. Chua N.-H. Plant Cell. 1990; 2: 369-378Crossref PubMed Scopus (375) Google Scholar). Previous studies have shown that the GT-1 site confers light responsiveness to a chimeric promoter construct (15Lam E. Chua N.-H. Science. 1990; 248: 471-474Crossref PubMed Scopus (144) Google Scholar). Data presented in this article show that the mutation of the GT-1 site decreased the promoter activity about 3-4-fold in leaves, indicating that the GT-1 site has a positive function in transcription in leaves. On the other hand, this mutation provoked an increase of transcription activity in roots (Fig. 1). results with the S1F binding site in transcription in the mutation of the S1F binding site within a rps1 promoter not the promoter activity in (5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google Scholar). The the GT-1 and the S1F sites their activity in is not at However, these data the that the GT-1 binding site is involved in leaf cell activation and that in roots wild-type GT elements have lower transcription activity than their mutant on these data one can the that GT elements are root negative transcription of root protein extracts have led to the identification of an additional GT element-binding which has higher binding activity to the mutant sequences than to the types of both the GT-1 and the S1F This higher RGTF binding activity of the mutant sequences is correlated to their higher transcriptional activity in roots. The higher root transcriptional activity of the mutant GT elements was to the that the have higher affinity binding sites of RGTF than the wild-type sequences. This suggests that the GT-1 site is not an or a binding site of RGTF. on the root activity of the wild-type Box or of mutant (Fig. we suggest that the transcriptional activation activity of RGTF is seems not to be a highly DNA-binding factor, on the observations that recognizes of the of the GT-1 binding site (Fig. and However, the RGTF binding of Box II sequences when the to the (Fig. The two nucleotides in the core sequence of Box II are for the binding of RGTF. of by decreased by about the binding activity compared with the wild-type sequence (Fig. In the to in the core sequence the RGTF binding activity about (Fig. These data with a binding RGTF has specific binding sequence These binding of RGTF to bind to a of promoter sequences. RGTF seems not to be a It was also in leaf extracts (Fig. when the GT-1 binding activity was that RGTF may be a of factor in different cell It is that the II in assays with leaf extracts also the of the leaf was not by the competition of the Box II mutant which is specific to RGTF but not to GT-1 (Fig. and Therefore, the binding of RGTF seems to be It is also that RGTF is a different of RGTF to different sequences. RGTF play some role in a lower but of expression in cells of GT genes including plastid r-protein and photosynthetic genes. transcriptional activity of Box II in roots with the absence of the GT-1 binding activity in root protein extracts. This suggests that GT-1 is a on the results from the cloned or GT-1 GT-1 is in roots (17Gilmartin P.M. Memelink J. Hiratsuka K. Kay S.A. Chua N.-H. Plant Cell. 1992; 4: 839Crossref PubMed Scopus (94) Google Scholar, M.J. M.A. Lamb C. Dixon R.A. Proc. Natl. Acad. Sci. U. S. A. 1991; PubMed Scopus (54) Google Scholar). The absence of GT-1 binding activity in root extracts can be by at either or post-translational The data shown in demonstrated that a root cellular activity the binding activity of GT-1. This root seems to be specific to the root extracts to similar as the leaf extracts when with binding sites U. EMBO J. 1990; PubMed Scopus Google data not The studies with or a that may not be involved in the data not out the that specific to are It is not at this whether the inhibitory activity is in the or in the of root cells, the root extracts we used in this are cellular protein extracts. this inhibitory activity seems to be root cell-specific. assays with leaf protein extracts to the as leaf nuclear extracts not on the we as (Fig. In leaf cells, GT-1 to Box II or related GT elements and In root cells, the binding activity of GT-1 is by an and the transcriptional activation mediated by GT-1 is However, RGTF can bind to GT elements and transcription to an expression of different genes in roots. The activation on the binding affinity of RGTF to the This of regulation to the of expression of genes in root cells. INTRODUCTIONThe expression of nuclear genes encoding both photosynthetic and plastid ribosomal proteins (r-proteins) 2The abbreviations used are: r-proteinribosomal-proteinGUSβ-glucuronidase. is highly mesophyllous cell-specific. Plastid r-protein genes provide a good system to define cis-acting promoter elements and their binding factors involved in cell type-specific regulation. The transcription of these genes is highly activated in the leaf mesophyllous cells, compared with amyloplast-containing root cells and chromoplast-containing flower and fruit cells (1Franzetti B. Zhou D.-X. Mache R. Nucleic Acids Res. 1992; 20: 4153-4157Crossref PubMed Scopus (19) Google Scholar, 2Lagrange T. Franzetti F. Axelos M. Mache R. Lerbs-Mache S. Mol. Cell. Biol. 1993; 13: 2614-2622Crossref PubMed Scopus (41) Google Scholar, 3Li Y.-F. Zhou D.-X. Clabault G. Bisanz-Seyer C. Mache R. Plant Mol. Biol. 1995; 28: 595-604Crossref PubMed Scopus (4) Google Scholar). In contrast to photosynthetic genes, the transcriptional activation of r-protein genes in the mesophyllous cells is light-independent (3Li Y.-F. Zhou D.-X. Clabault G. Bisanz-Seyer C. Mache R. Plant Mol. Biol. 1995; 28: 595-604Crossref PubMed Scopus (4) Google Scholar). This specific pattern of transcriptional regulation of the r-protein genes suggests the existence of either specific transcriptional activators in chloroplast-containing cells and/or repressors in nonphotosynthetic cells. Studies on the rps1 gene coding for the r-protein CS1 have led to the identification of a promoter sequence that is specifically recognized by a leaf factor, known as S1F (4Zhou D.-X. Li Y.-F. Rocipon M. Mache R. J. Biol. Chem. 1992; 267: 23515-23519Abstract Full Text PDF PubMed Google Scholar). It has been shown that the S1F binding site had a negative function in regulating the rps1 promoter in root cells and in protoplasts (4Zhou D.-X. Li Y.-F. Rocipon M. Mache R. J. Biol. Chem. 1992; 267: 23515-23519Abstract Full Text PDF PubMed Google Scholar, 5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google Scholar). It looked likely that the S1F binding site was involved in the cell type-specific regulation of the rps1 gene.Interestingly, the S1F binding site found also in other r-protein genes (2Lagrange T. Franzetti F. Axelos M. Mache R. Lerbs-Mache S. Mol. Cell. Biol. 1993; 13: 2614-2622Crossref PubMed Scopus (41) Google Scholar) is related to the GT-1 binding site of the pea rbcs-3A gene as shown by competition binding assays (5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google Scholar). The GT-1 binding site initially identified as Box II by Fluhr et al. (6Fluhr R. Kuhlemeier C. Chua N.-H. Science. 1986; 232: 1106-1112Crossref PubMed Scopus (170) Google Scholar) and five other similar sequences found in the pea rbcs-3A gene (7Green P.J. Kay S.A. Chua N.-H. EMBO J. 1987; 6: 2543-2549Crossref PubMed Scopus (267) Google Scholar) have been shown to play an important role in the light-regulated transcription of the gene (8Kuhlemeier C. Cuozzo M. Green P.J. Goyvaerts E. Ward K. Chua N.-H. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 4662-4666Crossref PubMed Scopus (89) Google Scholar). Sequences homologous to Box II have also been found within upstream regions of numerous other genes including ones not regulated by light (9Gilmartin P.M. Sarokin L. Memelink J. Chua N.-H. Plant Cell. 1990; 2: 369-378Crossref PubMed Scopus (375) Google Scholar). Specifically, cis-elements involved in tissue-specific (52/56 box in the pollen-specific lat52) (10Eyal Y. Curie C. McCormick S. Plant Cell. 1995; 7: 373-384Crossref PubMed Scopus (96) Google Scholar), defense-related (SBF-1 binding sites in the soybean chs15) (11Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google Scholar), light-repressed (the GT-2 binding sites in the rice phya) (12Dehesh K. Bruce W.B. Quail P.H. Science. 1990; 250: 1397-1399Crossref PubMed Scopus (90) Google Scholar), and circadian clock-controlled (CGF site in cab2) (13Anderson S.L. Teakle G.R. Martino-Catt S.J. Kay S.A. Plant J. 1994; 6: 457-470Crossref PubMed Scopus (95) Google Scholar) transcriptional regulation have been shown to be related to the GT-1 binding site as demonstrated by competition binding assays (Table I). These GT-1 binding site (Box II)-related elements are known as GT elements. The sequences of the defined GT elements show much variation when compared with the pea rbcs-3A gene Box II core sequence GGTTAA (Table I). This core sequence has been shown to be required for the GT-1 binding in vitro (14Green P.J. Youg M.-H. Cuozzo M. Kano-Murakami Y. Silverstein P. Chua N.-H. EMBO J. 1988; 7: 4035-4044Crossref PubMed Scopus (165) Google Scholar) and the light-responsive function in vivo (15Lam E. Chua N.-H. Science. 1990; 248: 471-474Crossref PubMed Scopus (144) Google Scholar). One common characteristic to all GT elements is a core sequence rich in nucleotides T and A rather than G and T, as indicated by the name. The flanking sequences are quite divergent. The diversity of GT elements suggests that a single binding factor such as GT-1 can bind to many related GT elements. Alternatively, there may be different GT element-binding proteins with different specificities and functions. A few GT element-binding factors have been characterized, among which GT-1 and GT-2 have been cloned (12Dehesh K. Bruce W.B. Quail P.H. Science. 1990; 250: 1397-1399Crossref PubMed Scopus (90) Google Scholar, 16Perisic O. Lam E. Plant Cell. 1992; 4: 831-838Crossref PubMed Scopus (79) Google Scholar, 17Gilmartin P.M. Memelink J. Hiratsuka K. Kay S.A. Chua N.-H. Plant Cell. 1992; 4: 839Crossref PubMed Scopus (94) Google Scholar). GT-1 and GT-2 are related proteins with one or two trihelical DNA-binding motifs, each of which recognizes different degenerated GT elements. For example, each of the two trihelical domains of GT-2 has a higher binding affinity to either GT2 or GT3 boxes of the rice phya gene, but both domains bind only poorly to the GT-1 site (18Dehesh K. Hung H. Tepperman J.M. Quail P.H. EMBO J. 1992; 11: 4131-4144Crossref PubMed Scopus (69) Google Scholar), whereas the trihelix of GT-1 has at least a 20-fold higher affinity to Box II than to any other tested GT elements (19Hiratsuka K. Wu X. Fukuzawa H. Chua N.-H. Plant Cell. 1994; 6: 1805-1813Crossref PubMed Scopus (54) Google Scholar). Interestingly, the genes for both GT-1 and GT-2 are expressed in all parts of the plants and are not regulated by light (17Gilmartin P.M. Memelink J. Hiratsuka K. Kay S.A. Chua N.-H. Plant Cell. 1992; 4: 839Crossref PubMed Scopus (94) Google Scholar, 18Dehesh K. Hung H. Tepperman J.M. Quail P.H. EMBO J. 1992; 11: 4131-4144Crossref PubMed Scopus (69) Google Scholar, 19Hiratsuka K. Wu X. Fukuzawa H. Chua N.-H. Plant Cell. 1994; 6: 1805-1813Crossref PubMed Scopus (54) Google Scholar). These observations have led to the suggestion that either the transcriptional activity of the factors is regulated by post-translational modification or additional factors may be needed to regulate their activity.Table IA compilation of related GT elementsMotifGeneSequenceFactorReferenceBox IIrbcs-3AGTGTGGTTAATATGGT-114Green P.J. Youg M.-H. Cuozzo M. Kano-Murakami Y. Silverstein P. Chua N.-H. EMBO J. 1988; 7: 4035-4044Crossref PubMed Scopus (165) Google ScholarBox IIIrbcs-3ATAGTGAAAATGATAGT-114Green P.J. Youg M.-H. Cuozzo M. Kano-Murakami Y. Silverstein P. Chua N.-H. EMBO J. 1988; 7: 4035-4044Crossref PubMed Scopus (165) Google ScholarGT-2 boxphyaGGTAATTGT-212Dehesh K. Bruce W.B. Quail P.H. Science. 1990; 250: 1397-1399Crossref PubMed Scopus (90) Google ScholarBox 1chs15TAAAAGTTAAAAACSBF-111Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google ScholarBox 2chs15CTGTGATTAAATATSBF-111Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google ScholarBox 3chs15TATTGGTTACTAAASBF-111Lawton M.A. Dean S.M. Dron M. Kooter J.M. Kragh K.M. Harrison M.J. Yu L. Tanguay L. Dixon R.A. Lamb C. Plant Mol. Biol. 1991; 16: 235-249Crossref PubMed Scopus (93) Google ScholarSite 1rps1TCATGGTAACAATTS1F5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google ScholarSite 3rps1AGTTAGTTAAAAGAS1F5Villain P. Clabault G. Mache R. Zhou D.-X. J. Biol. Chem. 1994; 269: 16626-16630Abstract Full Text PDF PubMed Google ScholarCGF sitecab2TAAAGATTACTTCAGATATAACCGF-113Anderson S.L. Teakle G.R. Martino-Catt S.J. Kay S.A. Plant J. 1994; 6: 457-470Crossref PubMed Scopus (95) Google Scholar52/56 boxlat52TATGTGGTTATATAGT-110Eyal Y. Curie C. McCormick S. Plant Cell. 1995; 7: 373-384Crossref PubMed Scopus (96) Google Scholar Open table in a new tab In the present work, we have compared first the transcriptional function of the GT-1 binding site in leaf and root cells. Second, we have examined whether root cells contain any distinct GT element binding activity. Further, we have tried to find out how the transcription repression in roots mediated by GT elements is achieved. The results presented in this paper describe a novel mechanism of differential cell type-specific transcription mediated by GT elements.