Publication | Closed Access
Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia
22
Citations
0
References
2009
Year
Pepper FieldsPlant VirusPlant-virus InteractionPathogenesisVirologyPlant PathologyPepper SamplesVirus ClassificationMicrobiologyMedicinePlant-pathogen InteractionNew Begomovirus AssociatedLeaf Curling
Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.