Relative stability of AT and GC pairs in parallel DNA duplex formed by a natural sequence

Abstract

The low-cooperative melting of parallel DNA formed by a natural 40 bp long sequence from Drosophila: 5'-d(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)-3' 5'-d(ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)-3' that possesses a normal nucleotide content was studied by using the special method of measuring the fluorescence of its complex with acriflavine as well as by conventional thermal denaturation. Acriflavine allows discrimination of the melting of AT and GC pairs because its fluorescence is quenched by neighbouring G bases. We have observed that about 40% of AT pairs melt at 14 degrees C while the remainder melt at 42 degrees C. The GC pairs remain stable up to approximately 40 degrees C and melt at 54 degrees C. The higher stability of GC pairs suggests the formation of cis Watson-Crick pairs in parallel DNA.