Dinucleotide repeat polymorphisms at the D17S250 and D17S261 loci

Abstract

A human genomic Sau3AI fragment was cloned into mpl9 and selected by hybridization to poly(dC-dA) *poly(dG-dT). The cloned fragment was designated Mfd49. Sequencing of Mfd49 provided the information necessary for polymerase chain reaction primer synthesis. The clone length was > 240 bp, and the predicted length of the amplified fragment was 87 bp. Primer Sequences: GATAAATGCCAAACATGTTGT (CA strand); TGCTCTCAGGATTTCCTCCA (GT strand). Frequency: Estimated from 120 chromosomes of unrelated CEPH family grandparents (Caucasians). PIC = 0.85. Allele(bp) Frequency Allele(bp) Frequency 98 0.01 86 0.15 96 0.02 84 0.14 94 0.03 82 0.07 92 0.05 80 0.23 90 0.09 78 0.08 88 0.13