Concepedia

Publication | Open Access

Transforming Growth Factor β Activates the Promoter of Cyclin-dependent Kinase Inhibitor p15 through an Sp1 Consensus Site

248

Citations

24

References

1995

Year

Abstract

Transforming growth factor β (TGF-β) causes growth arrest in the G1 phase in many cell types. One probable pathway for this growth inhibition is through the TGF-β-mediated up-regulation of the cyclin-dependent kinase (CDK) inhibitor p15INK4B, which specifically inhibits the enzymatic activities of CDK4 and CDK6. An active cyclin D-CDK4/6 complex is required for pRb phosphorylation to allow the cell cycle to progress from G1 to S phase. To study the molecular mechanism of the p15INK4B induction by TGF-β, we isolated a 780-base pair promoter sequence of the human p15 gene and inserted this fragment upstream of a luciferase reporter gene. When this construct was transiently transfected into HaCaT cells, luciferase activity was induced more than 10-fold upon TGF-β treatment, indicating that the induction of p15INK4B expression by TGF-β is partly exerted at the transcription level. Promoter deletion analysis revealed that the sequence from -110 to -40 relative to the transcription start site is capable of conferring the 10-fold induction by TGF-β. Within this region there are three Sp1 consensus sites. Mutation of one of these sites, GGGGCGGAG, substantially reduced both the induction by TGF-β and the basal promoter activity, whereas mutations in the other two Sp1 sites and the spacer sequences had little effect. In addition, gel mobility shift assay indicates that the transcription factors Sp1 and Sp3 bind to this Sp1 site. Taken together, these data suggest that a specific Sp1 consensus site is involved in the mediation of TGF-β induction as well as the basal promoter activity of the p15 gene and that Sp1 and Sp3 transcription factors might be involved in this regulation. Transforming growth factor β (TGF-β) causes growth arrest in the G1 phase in many cell types. One probable pathway for this growth inhibition is through the TGF-β-mediated up-regulation of the cyclin-dependent kinase (CDK) inhibitor p15INK4B, which specifically inhibits the enzymatic activities of CDK4 and CDK6. An active cyclin D-CDK4/6 complex is required for pRb phosphorylation to allow the cell cycle to progress from G1 to S phase. To study the molecular mechanism of the p15INK4B induction by TGF-β, we isolated a 780-base pair promoter sequence of the human p15 gene and inserted this fragment upstream of a luciferase reporter gene. When this construct was transiently transfected into HaCaT cells, luciferase activity was induced more than 10-fold upon TGF-β treatment, indicating that the induction of p15INK4B expression by TGF-β is partly exerted at the transcription level. Promoter deletion analysis revealed that the sequence from -110 to -40 relative to the transcription start site is capable of conferring the 10-fold induction by TGF-β. Within this region there are three Sp1 consensus sites. Mutation of one of these sites, GGGGCGGAG, substantially reduced both the induction by TGF-β and the basal promoter activity, whereas mutations in the other two Sp1 sites and the spacer sequences had little effect. In addition, gel mobility shift assay indicates that the transcription factors Sp1 and Sp3 bind to this Sp1 site. Taken together, these data suggest that a specific Sp1 consensus site is involved in the mediation of TGF-β induction as well as the basal promoter activity of the p15 gene and that Sp1 and Sp3 transcription factors might be involved in this regulation. INTRODUCTIONTransforming growth factor βs (TGF-βs) 1The abbreviations used are: TGF-βtransforming growth factor βCDKcyclin-dependent kinasebpbase pair(s)TBPTATA box-binding proteinRLUrelative light unitTAFTBP-associated factor. represent a large family of cytokines with diverse activities in the regulation of cell growth, differentiation, and morphogenesis(1Massague J. Annu. Rev. Cell Biol. 1990; 6: 597-641Crossref PubMed Scopus (2996) Google Scholar, 2Lyons R.M. Moses H.L. Eur. J. Biochem. 1990; 187: 467-473Crossref PubMed Scopus (346) Google Scholar, 3Roberts A.M. Sporn M.B. Sporn M.B. Boberts A.B. Peptide Growth Factors and Their Receptors. Springer-Verlag, Berlin1990: 421-427Google Scholar). TGF-β causes growth inhibition of most epithelial, endothelial, fibroblast, neuronal, lymphoid, and hematopoietic cell types(3Roberts A.M. Sporn M.B. Sporn M.B. Boberts A.B. Peptide Growth Factors and Their Receptors. Springer-Verlag, Berlin1990: 421-427Google Scholar). TGF-β treatment induces growth arrest in the G1 phase of the cell cycle, and this effect has been attributed largely to an inhibition of phosphorylation of the retinoblastoma susceptibility gene product, pRb (4Laiho M. Decaprio J.A. Ludlow J.W. Livingston D.M. Massague J. Cell. 1990; 62: 175-185Abstract Full Text PDF PubMed Scopus (676) Google Scholar). Progression through the G1 phase of the cell cycle requires phosphorylation of pRb by G1 cyclin-dependent kinase (CDK) complexes, particularly the cyclin D-CDK4 and cyclin D-CDK6 complexes(5Sherr C.J. Roberts J.M. Genes & Dev. 1995; 9: 1149-1163Crossref PubMed Scopus (3205) Google Scholar). Phosphorylation of pRb releases transcription factors, including members of the E2F transcription factor family, required for the G1 to S phase transition of the cell cycle(6Nevins J.R. Science. 1992; 258: 424-429Crossref PubMed Scopus (1364) Google Scholar).Two distinct families of CDK inhibitors, represented by p16 and p21, have been identified recently and shown to be capable of binding to and inhibiting the activities of various CDK enzymes (for a recent review, see (5Sherr C.J. Roberts J.M. Genes & Dev. 1995; 9: 1149-1163Crossref PubMed Scopus (3205) Google Scholar)). The p16INK4 family of CDK inhibitors specifically interacts with two closely related CDK proteins, CDK4 and CDK6, both of which have been strongly implicated as the physiological pRb kinases. One member of this family, p15INK4B, was specifically up-regulated by TGF-β in human keratinocyte HaCaT cells(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar). The steady-state level of p15INK4B mRNA was induced 30-fold upon TGF-β treatment, implicating p15INK4B as a primary effector of the TGF-β-mediated cell cycle arrest(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar). Previously it was shown that treatment of HaCaT cells with TGF-β caused rapid transcriptional induction of the p21 gene (also known as cip1/WAF1/sdi1) through a p53-independent pathway, suggesting that p21 is also involved in mediating the cell cycle arrest caused by TGF-β(8Datto M.B. Li Y. Panus J.F. Howe D.J. Xiong Y. Wang X.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5545-5549Crossref PubMed Scopus (851) Google Scholar).The signaling pathways downstream of the TGF-β receptor complex that lead to the inhibition of cell cycle progression are still poorly understood. Since both CDK inhibitors, p15 and p21, are up-regulated by TGF-β treatment, they could be coordinately regulated through a similar mechanism. In this study, we attempt to elucidate the mechanism through which TGF-β specifically up-regulates the expression of p15INK4B by a detailed analysis of the p15INK4Bpromoter sequences.EXPERIMENTAL PROCEDURESIsolation of p15 Genomic DNAA human placenta genomic library cloned in λ FIX II (Stratagene, La Jolla, CA) was screened with the full-length human p16 cDNA(9Serrano M. Hannon G.J. Beach D. Nature. 1993; 366: 704-707Crossref PubMed Scopus (3354) Google Scholar). Of 1.2 million phage plaques screened, eight positives were isolated. Two oligonucleotide primers, 5′ primer (5′ AGGATCCATGGTGATGATGGGCAGCGCCCGC 3′) and 3′ primer (5′ GAAGCTTGGGTAAGAAAATAAAGTCGTTG 3′), specific to p15 cDNA were designed based on the previously published MTS2 genomic sequence (10Kamb A. Gruis N.A. Weaver Feldhaus J. Liu Q. Harshman K. Tavtigian S.V. Stockert E. Day R. Johnson B.E. Skolnick M.H. Science. 1994; 264: 436-440Crossref PubMed Scopus (2810) Google Scholar) and used in polymerase chain reaction amplification to distinguish p15 from p16. Three p15 genomic clones were obtained, and clone G8 was confirmed by DNA sequencing to correspond to the p15 gene as compared with the p15 cDNA sequence(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar, 11Guan K.L. Jenkins C.W. Li Y. Nichols M.A. Wu X. O'Keefe C.L. Matera A.G. Xiong Y. Genes & Dev. 1994; 8: 2939-2952Crossref PubMed Scopus (726) Google Scholar). A 1.2-kilobase pair DNA fragment containing a 440-bp exon 1 and 780-bp sequence upstream of 5′-cDNA was isolated from clone G8 and completely sequenced by Sanger's method(12Sanger F. Nicklen S. Coulson A.R. Bio/Technology. 1992; 24: 104-108PubMed Google Scholar).Plasmid ConstructsThe HindIII/SacI, ScaI/SacI, SphI/SacI, SmaI/SacI, PvuII/SacI, and EcoRI/SacI fragments of clone G8 were inserted between the SmaI and SacI sites of the pGL2-basic luciferase reporter plasmid (Promega, Madison, WI) to generate p15P751-luc, p15P463-luc, p15P165-luc, p15P113-luc, p15P35-luc, and p15P23-luc, respectively. Linker scanning mutants of the p15P113-LS series were made by site-directed mutagenesis(13Kunkel T.A. Bebenek K. McClary J. Methods Enzymol. 1991; 204: 125-139Crossref PubMed Scopus (633) Google Scholar), and mutant sequences are indicated in Fig. 3A. p15P97-luc, p15P69-luc, p15P47-luc, and p15P35-luc were constructed by inserting the HindIII/SacI fragment of p15P113-LS1, XbaI/SacI fragment of the p15P113-LS3, and HindIII/SacI fragment of the p15P113-LS4 between the SmaI and SacI sites of pGL2-basic luciferase reporter plasmid. All mutations were verified by restriction enzyme digestion and DNA sequencing.Gel Mobility Shift AssayComplementary oligonucleotides from -68 to -82 on the p15 promoter were annealed and labeled with [γ-32P]ATP by T4 polynucleotide kinase. HaCaT cells were treated with or without TGF-β for 20 h, and the nuclear extract was prepared according to Dignam et al.(14Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9143) Google Scholar). 1 μg of total nuclear protein was incubated with 0.5 μg of poly(dI•dC) as well as the appropriate oligonucleotide competitors or antisera (as indicated in the figure legend) for 20 min on ice in a 20-μl reaction containing 20 mM Hepes (pH 7.5), 5 mM MgCl2, 60 mM KCl, 1 mM dithiothreitol, 0.1% Triton X-100, and 6% glycerol. 0.2 ng of the end-labeled probe (2 × 105 cpm) were then added, and the incubation was continued for 20 min at 30°C. The protein-DNA complexes were resolved on a 4% non-denaturing polyacrylamide gel. The gel was dried and exposed to x-ray film. Rabbit anti-human Sp1 and Sp3 antibodies were generous gifts from Dr. J. Horowitz.Luciferase AssaysHaCaT cells were plated onto 6-well plates at a density of 100,000 cells/well. Cells were grown for 48 h and transfected with 6 μg of plasmid DNA per well with the DEAE-dextran method as described elsewhere(8Datto M.B. Li Y. Panus J.F. Howe D.J. Xiong Y. Wang X.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5545-5549Crossref PubMed Scopus (851) Google Scholar). Human TGF-β1 was added to a concentration of 100 pM, and luciferase activity was assayed 20 h later as described(8Datto M.B. Li Y. Panus J.F. Howe D.J. Xiong Y. Wang X.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5545-5549Crossref PubMed Scopus (851) Google Scholar). For each transfected plasmid, two duplicates were assayed under the same conditions, and the mean relative light units (RLU) were used in all the figures.RESULTS AND DISCUSSIONA 780-bp genomic DNA fragment, which contains sequences upstream of the previously reported 5′-ends of the p15INK4B cDNA(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar, 11Guan K.L. Jenkins C.W. Li Y. Nichols M.A. Wu X. O'Keefe C.L. Matera A.G. Xiong Y. Genes & Dev. 1994; 8: 2939-2952Crossref PubMed Scopus (726) Google Scholar), was cloned from a human genomic library. The 5′-end of the p15 mRNA was mapped to the adenosine in the sequence CCCCACTCT as shown in Fig. 3A by S1 nuclease protection assay (data not shown). Thus, the cloned 780-bp DNA fragment largely contains the p15 promoter sequence. The sequence around the initiation site matches the initiator sequence as defined by Smale and Baltimore(15Smale S.T. Baltimore D. Cell. 1989; 57: 103-113Abstract Full Text PDF PubMed Scopus (1147) Google Scholar). No apparent TATA sequence was found around the -25 to -30 region. Therefore, the p15 promoter may be defined as a TATA-less/initiator promoter. The p15 promoter sequences are highly GC-rich (70% G + C from -200 to -1).To determine its inducibility by TGF-β, the 750-bp p15 promoter sequence was inserted upstream of a luciferase reporter gene in the vector pGL2-basic (Fig. 1). When the resultant construct, p15P751-luc, was transiently transfected into HaCaT cells, a 10-15-fold induction of luciferase activity was routinely observed upon TGF-β treatment as measured by RLU (Fig. 1). Thus, the p15 promoter is capable of being induced by TGF-β, and the transcription activation is at least partly responsible for the accumulation of p15 mRNA upon TGF-β treatment(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar).Figure 1:Deletion analysis of the p15 promoter. Luciferase (Luc) constructs with progressive deletions of the p15 promoter sequences are shown. The restriction sites used in the of these deletion constructs are The initiator sequence is indicated as an and the transcription initiation site is indicated by an The deletion constructs were transiently transfected into HaCaT cells and the RLU measured cells were treated with or without 100 human the mean RLU of two under the same assay The by TGF-β treatment are shown to the of specific promoter that the TGF-β a series of 5′ promoter deletion constructs were (Fig. 1). deletion constructs were transiently transfected into HaCaT cells and assayed for luciferase activities in the or of TGF-β. Fig. 1 that deletions to the of -110 relative to the initiation site not the of induction by TGF-β the promoter activities in the of TGF-β sequences from -110 to TGF-β induction (Fig. indicating that a is in this are three Sp1 binding sites the -110 to -30 sequences upstream of the transcription initiation site of the p15 gene. a GC-rich sequence capable of binding to Sp1 and Sp3 was shown to be responsible for the induction of p21 gene by TGF-β M.B. Wang J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar). this sequence is to the Sp1 consensus site in the -110 to -30 fragment of the p15 promoter. To the that this or the other two Sp1 consensus sites, may be involved in the mediation of p15 promoter induction by TGF-β, we more 5′ promoter deletion constructs to one two or all three Sp1 consensus sites and assayed for luciferase activities in the or of TGF-β (Fig. Fig. that deletion of the Sp1 consensus site had little effect on the induction by TGF-β or the basal promoter activity of the p15 luciferase construct, whereas deletion to the Sp1 consensus site reduced TGF-β induction from of the promoter to of all three Sp1 consensus sites reduced TGF-β induction to the level. data suggest that the Sp1 consensus site is the most sequence for the induction by TGF-β or the basal promoter activity of the human p15 analysis of the Sp1 consensus sites on the p15 promoter. p15P113-luc, which contains three Sp1 consensus sites and is by TGF-β, is shown. Luciferase (Luc) constructs with one two and three Sp1 consensus sites are also shown. constructs were transiently transfected into HaCaT cells and the luciferase activity assayed as described in the of Fig. induction by TGF-β is the of the Sp1 consensus site in conferring the transcription inducibility of the p15 promoter by TGF-β, a series of scanning constructs were made in the promoter of which contains upstream of the transcription initiation site and is capable of being induced by TGF-β (Fig. The scanning constructs were transiently transfected into HaCaT cells and assayed for luciferase activities in the or of the of p15P113-LS3, all mutants not the of induction upon TGF-β treatment or the basal transcription activity (Fig. p15P113-LS3, which contains a in the Sp1 site the -110 to -30 the of induction from of the promoter to (Fig. In addition, the basal promoter activity of was also reduced the level (Fig. with the promoter deletion these data suggest that a specific Sp1 consensus site is for the mediation of TGF-β induction of the p15 gene as well as its basal promoter protein factors with the Sp1 we used DNA sequences from -68 to -82 on the p15 promoter the Sp1 site in the gel mobility shift shown in Fig. three protein complexes and were observed this probe was incubated with nuclear extract prepared from HaCaT All three complexes are specific to the probe they were by an of (Fig. and were to the of oligonucleotides (Fig. and was the human Sp1 transcription factor was in the binding reaction and the complex between Sp1 and the Sp1 site on the p15 promoter (Fig. complexes II and represent the complexes between Sp3 and the Sp1 site on the p15 promoter both complexes were the binding reaction the transcription factor Sp3 (Fig. with the promoter these data that the Sp1 site the -110 to -30 region on the p15 which is capable of conferring the TGF-β inducibility of the p15 to the transcription factors Sp1 and binding to the Sp1 site on the p15 promoter. oligonucleotides the Sp1 site on the p15 promoter were labeled with [γ-32P]ATP and used in the gel mobility shift Three protein-DNA complexes and as indicated by were observed the probe was incubated with 1 μg of nuclear protein In and or human Sp1 were in the binding respectively. In 5 and or human Sp3 were in the binding In and a or of oligonucleotides was in the binding In and a or of the oligonucleotides was in the binding 1 is probe consensus sites are in gene including many and D.J. J.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: PubMed Scopus Google Scholar, R. Cell. Full Text PDF PubMed Scopus Google Scholar, R. Science. PubMed Scopus Google Scholar). The well transcription factor Sp1 to its binding site and transcription through its with the factor E. R. Proc. Natl. Acad. Sci. U. S. A. 1994; PubMed Scopus Google Scholar). suggest that Sp1 and a member of the Sp1 family, are involved in the regulation of many including and through a the pRb D.J. J.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: PubMed Scopus Google Scholar, Li R. Cell. Biol. 1992; PubMed Scopus Google Scholar, Y. J.M. Proc. Natl. Acad. Sci. U. S. A. 1993; PubMed Scopus Google Scholar, A.G. R. M.A. R. Roberts A.B. Sporn M.B. 1993; PubMed Scopus Google Scholar). A has been to that the between pRb and Sp1 in in the of D.J. J.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: PubMed Scopus Google Scholar). we that a specific Sp1 consensus site is involved in the mediation of TGF-β induction of the p15 gene and that the Sp1 and Sp3 could bind to this specific Sp1 site. The same site is also responsible for the basal promoter is that basal transcription is also capable of being regulated in cells, through the of factors For transcription activation is by and C.J. R. R. Science. 1995; PubMed Scopus Google Scholar) and the of and the complex on an promoter it the complex on an K. R. Cell. 1995; Full Text PDF PubMed Scopus Google Scholar). A in has been shown to cell cycle R. Science. 1994; PubMed Scopus Google Scholar, K. S. R. Y. M. Roeder R.G. Nature. 1993; PubMed Scopus Google Scholar). is that could the from growth and the transcription complex on GC-rich sequence in the p21 promoter capable of binding to the Sp1 and Sp3 was shown to be responsible for the induction of the p21 gene by TGF-β in HaCaT M.B. Wang J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar). this GC-rich for was capable of conferring TGF-β inducibility inserted into an M.B. Wang J. Biol. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar). on these it is that the same binding may be involved in the regulation of both p15 and p21 capable of binding to GC-rich sequences including the Sp1 consensus sites have been of these factors have with Sp1 and to the Sp1 transcription factor family, as Sp3 and D.J. J.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: PubMed Scopus Google Scholar), whereas are from as and binding protein R. Cell. 1989; Full Text PDF PubMed Scopus Google Scholar, R. J. Biol. 1989; 264: Full Text PDF PubMed Google Scholar). Sp3 and binding protein have been shown to bind to the including Sp1 consensus sites, and transcription from R. Cell. 1989; Full Text PDF PubMed Scopus Google Scholar, S. M. J. 1994; PubMed Scopus Google Scholar). are to determine its family or other binding are involved in the regulation of p15 and p21 by TGF-β. is that the sequence and the between binding sites for various transcription factors could the between the and transcription and a of transcription regulation. INTRODUCTIONTransforming growth factor βs (TGF-βs) 1The abbreviations used are: TGF-βtransforming growth factor βCDKcyclin-dependent kinasebpbase pair(s)TBPTATA box-binding proteinRLUrelative light unitTAFTBP-associated factor. represent a large family of cytokines with diverse activities in the regulation of cell growth, differentiation, and morphogenesis(1Massague J. Annu. Rev. Cell Biol. 1990; 6: 597-641Crossref PubMed Scopus (2996) Google Scholar, 2Lyons R.M. Moses H.L. Eur. J. Biochem. 1990; 187: 467-473Crossref PubMed Scopus (346) Google Scholar, 3Roberts A.M. Sporn M.B. Sporn M.B. Boberts A.B. Peptide Growth Factors and Their Receptors. Springer-Verlag, Berlin1990: 421-427Google Scholar). TGF-β causes growth inhibition of most epithelial, endothelial, fibroblast, neuronal, lymphoid, and hematopoietic cell types(3Roberts A.M. Sporn M.B. Sporn M.B. Boberts A.B. Peptide Growth Factors and Their Receptors. Springer-Verlag, Berlin1990: 421-427Google Scholar). TGF-β treatment induces growth arrest in the G1 phase of the cell cycle, and this effect has been attributed largely to an inhibition of phosphorylation of the retinoblastoma susceptibility gene product, pRb (4Laiho M. Decaprio J.A. Ludlow J.W. Livingston D.M. Massague J. Cell. 1990; 62: 175-185Abstract Full Text PDF PubMed Scopus (676) Google Scholar). Progression through the G1 phase of the cell cycle requires phosphorylation of pRb by G1 cyclin-dependent kinase (CDK) complexes, particularly the cyclin D-CDK4 and cyclin D-CDK6 complexes(5Sherr C.J. Roberts J.M. Genes & Dev. 1995; 9: 1149-1163Crossref PubMed Scopus (3205) Google Scholar). Phosphorylation of pRb releases transcription factors, including members of the E2F transcription factor family, required for the G1 to S phase transition of the cell cycle(6Nevins J.R. Science. 1992; 258: 424-429Crossref PubMed Scopus (1364) Google Scholar).Two distinct families of CDK inhibitors, represented by p16 and p21, have been identified recently and shown to be capable of binding to and inhibiting the activities of various CDK enzymes (for a recent review, see (5Sherr C.J. Roberts J.M. Genes & Dev. 1995; 9: 1149-1163Crossref PubMed Scopus (3205) Google Scholar)). The p16INK4 family of CDK inhibitors specifically interacts with two closely related CDK proteins, CDK4 and CDK6, both of which have been strongly implicated as the physiological pRb kinases. One member of this family, p15INK4B, was specifically up-regulated by TGF-β in human keratinocyte HaCaT cells(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar). The steady-state level of p15INK4B mRNA was induced 30-fold upon TGF-β treatment, implicating p15INK4B as a primary effector of the TGF-β-mediated cell cycle arrest(7Hannon G.J. Beach D. Nature. 1994; 371: 257-261Crossref PubMed Scopus (1882) Google Scholar). Previously it was shown that treatment of HaCaT cells with TGF-β caused rapid transcriptional induction of the p21 gene (also known as cip1/WAF1/sdi1) through a p53-independent pathway, suggesting that p21 is also involved in mediating the cell cycle arrest caused by TGF-β(8Datto M.B. Li Y. Panus J.F. Howe D.J. Xiong Y. Wang X.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5545-5549Crossref PubMed Scopus (851) Google Scholar).The signaling pathways downstream of the TGF-β receptor complex that lead to the inhibition of cell cycle progression are still poorly understood. Since both CDK inhibitors, p15 and p21, are up-regulated by TGF-β treatment, they could be coordinately regulated through a similar mechanism. In this study, we attempt to elucidate the mechanism through which TGF-β specifically up-regulates the expression of p15INK4B by a detailed analysis of the p15INK4Bpromoter

References

YearCitations

Page 1