Journal of Biological Chemistry · 2008 · 69 citations · 24 references
The TIM23 complex is the major translocase of the mitochondrial inner membrane responsible for the import of essentially all matrix proteins and a number of inner membrane proteins. Tim23 and Tim50, two essential proteins of the complex, expose conserved domains into the intermembrane space that interact with each other. Here, we describe in vitro reconstitution of this interaction using recombinantly expressed and purified intermembrane space domains of Tim50 and Tim23. We established two independent methods, chemical cross-linking and surface plasmon resonance, to track their interaction. In addition, we identified mutations in Tim23 that abolish its interaction with Tim50 in vitro. These mutations also destabilized the interaction between the two proteins in vivo, leading to defective import of preproteins via the TIM23 complex and to cell death at higher temperatures. This is the first study to describe the reconstitution of the Tim50-Tim23 interaction in vitro and to identify specific residues of Tim23 that are vital for the interaction with Tim50. The TIM23 complex is the major translocase of the mitochondrial inner membrane responsible for the import of essentially all matrix proteins and a number of inner membrane proteins. Tim23 and Tim50, two essential proteins of the complex, expose conserved domains into the intermembrane space that interact with each other. Here, we describe in vitro reconstitution of this interaction using recombinantly expressed and purified intermembrane space domains of Tim50 and Tim23. We established two independent methods, chemical cross-linking and surface plasmon resonance, to track their interaction. In addition, we identified mutations in Tim23 that abolish its interaction with Tim50 in vitro. These mutations also destabilized the interaction between the two proteins in vivo, leading to defective import of preproteins via the TIM23 complex and to cell death at higher temperatures. This is the first study to describe the reconstitution of the Tim50-Tim23 interaction in vitro and to identify specific residues of Tim23 that are vital for the interaction with Tim50. Maintenance and growth of mitochondria depend on the constitutive import of newly synthesized proteins that are encoded by nuclear DNA, translated on cytoplasmic ribosomes as precursors and eventually taken up from the cytosol. The latter process is mediated by several complex sorting and import machineries, protein translocases, and insertases that are located in the outer and inner mitochondrial membranes (1Schatz G. Dobberstein B. Science. 1996; 271: 1519-1526Crossref PubMed Scopus (917) Google Scholar, 2Neupert W. Herrmann J.M. Annu. Rev. Biochem. 2007; 76: 723-749Crossref PubMed Scopus (1081) Google Scholar, 3Bolender N. Sickmann A. Wagner R. Meisinger C. Pfanner N. EMBO Rep. 2008; 9: 42-49Crossref PubMed Scopus (235) Google Scholar). The port of entry for almost all of the precursor proteins is the TOM (translocase of the outer mitochondrial membrane) complex. Once the precursor protein has started to cross the outer membrane through the TOM complex, sorting signals trigger transport to its final destination, a process facilitated by one of the various import complexes (2Neupert W. Herrmann J.M. Annu. Rev. Biochem. 2007; 76: 723-749Crossref PubMed Scopus (1081) Google Scholar, 4Pfanner N. Curr. Biol. 2000; 10: R412-R415Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 5Rapaport D. J. Cell Biol. 2005; 171: 419-423Crossref PubMed Scopus (86) Google Scholar, 6Koehler C.M. Annu. Rev. Cell Dev. Biol. 2004; 20: 309-335Crossref PubMed Scopus (250) Google Scholar).The TIM23 (translocase of the inner mitochondrial membrane) complex handles the import of precursor proteins that contain N-terminal targeting signals, which include proteins destined for the matrix as well as some of the inner membrane and intermembrane space (IMS) 3The abbreviations used are: IMS, intermembrane space; DSS, disuccinimidyl suberate; TEV, tobacco etch virus; mtHsp70, 70-kDa mitochondrial heat shock protein; PK, proteinase K; CBB, Coomassie Brilliant Blue.3The abbreviations used are: IMS, intermembrane space; DSS, disuccinimidyl suberate; TEV, tobacco etch virus; mtHsp70, 70-kDa mitochondrial heat shock protein; PK, proteinase K; CBB, Coomassie Brilliant Blue. proteins. The TIM23 complex can be distinguished into two functionally defined parts: a core complex comprised of integral membrane proteins whose subunits are firmly associated with the membrane and the import motor. The core complex comprises three essential proteins: Tim17, Tim23, and Tim50, which make up the receptors and the translocation channel of the complex. Initial translocation of the N-terminal presequence across the inner membrane requires the membrane potential ΔΨ. Completion of translocation across the inner membrane, however, requires the action of the import motor (2Neupert W. Herrmann J.M. Annu. Rev. Biochem. 2007; 76: 723-749Crossref PubMed Scopus (1081) Google Scholar, 7Voos W. Rottgers K. Biochim. Biophys. Acta. 2002; 1592: 51-62Crossref PubMed Scopus (247) Google Scholar). The import motor consists of an ATP-hydrolyzing chaperone, the 70-kDa mitochondrial heat shock protein (mtHsp70), and Tim44, which recruits the latter to the TIM23 complex (8Kronidou N.G. Oppliger W. Bolliger L. Hannavy K. Glick B.S. Schatz G. Horst M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12818-12822Crossref PubMed Scopus (161) Google Scholar, 9Rassow J. Maarse A.C. Krainer E. Kubrich M. Muller H. Meijer M. Craig E.A. Pfanner N. J. Cell Biol. 1994; 127: 1547-1556Crossref PubMed Scopus (204) Google Scholar, 10Schneider H.C. Berthold J. Bauer M.F. Dietmeier K. Guiard B. Brunner M. Neupert W. Nature. 1994; 371: 768-774Crossref PubMed Scopus (332) Google Scholar). Other key players in the import motor, the co-chaperone complex Tim14/Pam18–Tim16/Pam16 (11Mokranjac D. Sichting M. Neupert W. Hell K. EMBO J. 2003; 22: 4945-4956Crossref PubMed Scopus (167) Google Scholar, 12Kozany C. Mokranjac D. Sichting M. Neupert W. Hell K. Nat. Struct. Mol. Biol. 2004; 11: 234-241Crossref PubMed Scopus (132) Google Scholar, 13D'Silva P.D. Schilke B. Walter W. Andrew A. Craig E.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 13839-13844Crossref PubMed Scopus (142) Google Scholar, 14Truscott K.N. Voos W. Frazier A.E. Lind M. Li Y. Geissler A. Dudek J. Muller H. Sickmann A. Meyer H.E. Meisinger C. Guiard B. Rehling P. Pfanner N. J. Cell Biol. 2003; 163: 707-713Crossref PubMed Scopus (160) Google Scholar, 15Frazier A.E. Dudek J. Guiard B. Voos W. Li Y. Lind M. Meisinger C. Geissler A. Sickmann A. Meyer H.E. Bilanchone V. Cumsky M.G. Truscott K.N. Pfanner N. Rehling P. Nat. Struct. Mol. Biol. 2004; 11: 226-233Crossref PubMed Scopus (160) Google Scholar), and the nucleotide exchange factor Mge1 (16Westermann B. Prip-Buus C. Neupert W. Schwarz E. EMBO J. 1995; 14: 3452-3460Crossref PubMed Scopus (86) Google Scholar, 17Laloraya S. Gambill B.D. Craig E.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6481-6485Crossref PubMed Scopus (136) Google Scholar, 18Bolliger L. Deloche O. Glick B.S. Georgopoulos C. Jeno P. Kronidou N. Horst M. Morishima N. Schatz G. EMBO J. 1994; 13: 1998-2006Crossref PubMed Scopus (141) Google Scholar) modulate the activity of mtHsp70 and thereby regulate the binding of the chaperone to the incoming unfolded precursor proteins. Finally, two nonessential membrane proteins, Pam17 and Tim21, modulate the activity of the TIM23 complex in an antagonistic manner. How exactly these proteins exert their function, however, is currently controversial (19Chacinska A. Lind M. Frazier A.E. Dudek J. Meisinger C. Geissler A. Sickmann A. Meyer H.E. Truscott K.N. Guiard B. Pfanner N. Rehling P. Cell. 2005; 120: 817-829Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 20Popov-Celeketic D.S. Mapa K. Neupert W. Mokranjac D. EMBO J. 2008; 27: 1469-1480PubMed Google Scholar).Tim50 is anchored in the inner membrane with one transmembrane helix and comprises a large C-terminal hydrophilic domain (∼350 amino acid residues) that is exposed to the IMS. Presumably this domain is the first component to interact with the precursor protein emerging from the TOM complex and to direct it to the TIM23 import channel (21Geissler A. Chacinska A. Truscott K.N. Wiedemann N. Brandner K. Sickmann A. Meyer H.E. Meisinger C. Pfanner N. Rehling P. Cell. 2002; 111: 507-518Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 22Yamamoto H. Esaki M. Kanamori T. Tamura Y. Nishikawa S. Endo T. Cell. 2002; 111: 519-528Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar, 23Mokranjac D. Paschen S.A. Kozany C. Prokisch H. Hoppins S.C. Nargang F.E. Neupert W. Hell K. EMBO J. 2003; 22: 816-825Crossref PubMed Scopus (150) Google Scholar). Tim23 consists of an N-terminal region of ∼100 amino acid residues that is hydrophilic and exposed to the IMS and of a C-terminal hydrophobic domain that spans the inner membrane with four transmembrane helices comprising ∼120 residues (2Neupert W. Herrmann J.M. Annu. Rev. Biochem. 2007; 76: 723-749Crossref PubMed Scopus (1081) Google Scholar, 4Pfanner N. Curr. Biol. 2000; 10: R412-R415Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 6Koehler C.M. Annu. Rev. Cell Dev. Biol. 2004; 20: 309-335Crossref PubMed Scopus (250) Google Scholar). The first ∼20 residues of Tim23 are found on the mitochondrial surface (20Popov-Celeketic D.S. Mapa K. Neupert W. Mokranjac D. EMBO J. 2008; 27: 1469-1480PubMed Google Scholar, 22Yamamoto H. Esaki M. Kanamori T. Tamura Y. Nishikawa S. Endo T. Cell. 2002; 111: 519-528Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar, 28Donzeau M. Kaldi K. Adam A. Paschen S. Wanner G. Guiard B. Bauer M.F. Neupert W. Brunner M. Cell. 2000; 101: 401-412Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Tim23 and Tim50 were proposed to interact via their soluble IMS domains (21Geissler A. Chacinska A. Truscott K.N. Wiedemann N. Brandner K. Sickmann A. Meyer H.E. Meisinger C. Pfanner N. Rehling P. Cell. 2002; 111: 507-518Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 22Yamamoto H. Esaki M. Kanamori T. Tamura Y. Nishikawa S. Endo T. Cell. 2002; 111: 519-528Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). Using in vivo chemical cross-linking, two regions on Tim23 were recently identified that mediate interaction with Tim50. The first one lies in the N-terminal domain, and the second one lies in the first transmembrane helix (24Alder N.N. Sutherland J. Buhring A.I. Jensen R.E. Johnson A.E. Mol. Biol. Cell. 2008; 19: 159-170Crossref PubMed Scopus (45) Google Scholar).We set out to reconstitute the interaction between Tim23 and Tim50 in vitro. We prepared recombinant purified intermembrane space domains of two proteins and studied their interaction by cross-linking and surface plasmon resonance measurements. Also, we identified mutations in Tim23 that abolished its interaction with Tim50. Mitochondria harboring Tim23 with these mutations were deprived in their ability to import precursor proteins via the TIM23 complex. This is the first study to reconstitute the Tim23-Tim50 interaction in vitro from recombinant proteins and to identify specific residues on Tim23 that are essential for it.EXPERIMENTAL PROCEDURESMaterials—Proteinase K (P-6556), V8 proteinase (P-2922), and DNase (D-5025) were purchased from Sigma. Disuccinimidyl suberate (DSS; 21555) was from Pierce, and complete EDTA-free protease inhibitor mixture (13625900) was from Roche Applied Science.Construction of NusA-Tim23IMS and NusA-Tim50IMS—The sequences encoding the soluble domains of yeast Tim23 (amino acids 1-96) and Tim50 (amino acids 133-476) were amplified by PCR, with a Saccharomyces cerevisiae genomic DNA as a template and the primers listed in Table 1. The PCR products were cloned into a modified pET-43.1a(+) vector containing octahistidine-tagged NusA protein (25Davis G.D. Elisee C. Newham D.M. Harrison R.G. Biotechnol. Bioeng. 1999; 65: 382-388Crossref PubMed Scopus (327) Google Scholar) (kindly provided by Dr. Joel Hirsch) and a cleavage site for the TEV protease. The construct was engineered in such a way that the histidine tag and NusA were removed upon TEV protease treatment. The Escherichia coli strain BL21(DE3) was used as a host for the expression of NusA-Tim23IMS or NusA-Tim50IMS fusion proteins.TABLE 1Primers used in this studyTim50IMSGGATCCATGAGGGATTGGGAGCCTCAAGGAATTCTTATTTGGATTCAGCAATCTTCTim23IMS (wild type)GGATCCATGTCGTGGCTTTTTGGAGGAATTCCAGTCATCGGTCCACCCACGGTim23IMS (P60A)ACCGCTAGGCTGCATGCGTTGGCTGGTCTAGACGTCTAGACCAGCCAACGCATGCAGCCTAGCGGTTim23IMS (D65A)CATCCTTTGGCTGGTCTAGCAAAGGGTGTGGAGTATTTAGCTAAATACTCCACACCCTTTGCTAGACCAGCCAAAGGATGTim23IMS (K66A)CTTTGGCTGGTCTAGACGCAGGTGTGGAGTATTTAGCTAAATACTCCACACCTGCGTCTAGACCAGCCAAAGTim23IMS (Y70A)GACAAGGGTGTGGAGGCTTTAGATCTGGAAGCTTCCAGATCTAAAGCCTCCACACCCTTGTCTim23IMS (L71A)CAAGGGTGTGGAGTATGCAGATCTGGAAGAAGAACGTTCTTCTTCCAGATCTGCATACTCCACACCCTTGTim23IMS (G83A)CCTCGTTAGAAGCCTCACAGGGTCTGCAACCCTGTGAGGCTTCTAACGAGGTim23IMS (R91A)GGTCTGATCCCTTCCGCTGGGTGGACCGATGACCGGTCATCGGTCCACCCAGCGGAAGGGATCAGACCTim23IMS (D95A)CCTTCCCGTGGGTGGACCGCTGACCTATGTTACGGCCGTAACATAGGTCAGCGGTCCACCCACGGGAAGGTim23IMS (Y70L71AA)GTCTAGACAAGGGTGTGGAGGCAGCAGATCTGGAAGAAGAACAACGTTGTTCTTCTTCCAGATCTGCTGCCTCCACACCCTTGTCTAGAC Open table in a new tab Purification of Tim23IMS and Tim50IMS—Bacteria were grown for ∼3 h at 37°C in 6 L of LB medium containing 100 μg/ml ampicillin. Upon reaching an A600 of 0.6, the temperature was lowered to 16 °C, and protein expression was induced with 1 mm isopropyl β-d-1-thiogalactopyranoside overnight. Bacteria were collected by centrifugation at 5,000 rpm for 10 min and homogenized in 60 ml of lysis buffer containing 50 mm Tris-HCl, pH 7.4, 200 mm NaCl, 1% Triton X-100, 20 mm imidazole, 0.05 mg/ml lysozyme, 45 mg/ml DNase, 2 mm phenylmethylsulfonyl fluoride, and one tablet of complete EDTA-free protease inhibitor mixture. After incubation for 15 min on ice, the bacteria were disrupted using a microfluidizer. Insoluble material was removed by centrifugation at 14,000 rpm for 30 min at 4 °C. The soluble fraction was loaded onto a nickel-nitrilotriacetic acid-agarose column (20 ml) pre-equilibrated with buffer A (50 mm Tris-HCl, pH 7.4, 200 mm NaCl, 20 mm imidazole). The column was washed with three volumes of buffer A until a stable base line was reached. The fractions were eluted with a linear gradient (0–50%, 90 ml) of buffer B (buffer A containing 1 m imidazole). The fractions enriched with the protein were pooled and treated with TEV protease (TEV:protein, 1:40 w/w) overnight at 4 °C in a dialysis bag against 5 liters of buffer A. The protein was then passed over a second nickel-nitrilotriacetic acid-agarose column to remove in one step the TEV protease, which contained an uncleavable octahistidine tag, NusA, which remained after digestion of the fusion protein and also contained the histidine tag, along with the nondigested material and nonspecifically bound proteins. Fractions enriched with the desired protein were concentrated and loaded onto a HiLoad 16/60 Superdex 200 column (total bead volume, 90 ml; Amersham Biosciences) pre-equilibrated with 20 mm NaHEPES, pH 7.4, 200 mm NaCl, and 5% glycerol at a flow rate of 1 ml/min. Fractions with the desired protein were concentrated using Vivaspin protein concentrators (Vivascience; molecular weight cut-off of 5,000 for Tim23IMS and 10,000 for Tim50IMS), divided into aliquots, and flash-frozen in liquid N2. All of the purification procedures were carried out at 4 °C.Mutagenesis—Site-directed mutants were created according to the protocol of Stratagene, using the primers listed in Table 1.Circular Dichroism—All of the CD measurements were carried out with an Aviv CD spectrometer model 202 over the range of 260-190 nm at a scan rate of 1 nm/s, using a cell with a path length of 0.1 mm. Each spectrum is an average of five scans. The raw data were corrected by subtracting the contribution of the buffer to the CD signal. The data were smoothed and converted to molar ellipticity units. The measurements were taken at a constant temperature of 25 °C in buffer containing 20 mm NaHEPES, pH 7.4, 200 mm NaCl, and 5% glycerol, with a protein concentration of 1 mg/ml.Thermal Aggregation Assay for Tim23IMS and Tim50IMS—Aliquots (0.4 mg/ml) of Tim23IMS or Tim50IMS in 20 mm NaHEPES, pH 7.4, 200 mm NaCl, 5% glycerol were incubated at different temperatures for 15 min and then centrifuged at 14,000 rpm for 5 min at room temperature to obtain aggregated (pellet) and soluble (supernatant) fractions. The proteins in each fraction were analyzed by SDS-PAGE and staining with Coomassie Brilliant Blue (CBB).Limited Proteolysis of Tim23IMS and Tim50IMS—V8 Protease (0.01 mg/ml) was used to digest 0.2 mg/ml Tim23IMS or Tim50IMS. PK (0.2 μg/ml) was added to 0.4 mg/ml protein. The reactions were allowed to proceed on ice in 20 mm NaHEPES, pH 7.4, and 200 mm NaCl. Time-dependent proteolysis of proteins was followed by SDS-PAGE and CBB staining.Cross-linking Experiments—Cross-linking reactions were carried out with 1 mm DSS at room temperature for 1 h in 20 mm NaHEPES, pH 7.4, 200 mm NaCl, 5 mm MgCl2, 50 mm KCl, and 5% glycerol at a protein concentration of 10 μm. The reaction was stopped by the addition of SDS-containing sample buffer. The cross-linked products were separated by SDS-PAGE using a gradient of 8–16% acrylamide and stained with CBB.Surface Plasmon Resonance—The experiments were performed with a ProteOn XPR36 instrument (Bio-Rad). This system uses an SPR-based detector to monitor formation of complexes between analytes and ligand molecules. The sensor chip (GLC) was activated for 80 s with a mixture of 0.1 m EDC and 0.025 m sulfo-NHS (TS-Pierce). Immediately after activation, 20 μg of Tim23IMS (wild type or mutant) in 1 volume of buffer C (20 mm NaHEPES, pH 7.4, 200 mm NaCl, 5% glycerol, 0.001% Tween) were diluted with 4 volumes of buffer D (10 mm sodium acetate, pH 3.5) and injected across channel/s (400 s at a flow rate of 30 μl/min). One channel, which was treated with the buffer without protein, served as a reference. Finally, the channels were blocked with 1 m ethanolamine-HCl, pH 8.5, for 200 s. Tim23IMS was coupled at response levels of ∼800 RU in a channel. The chip was rotated at 90°, the channels were washed for 30 min with buffer C, and six different concentrations of Tim50IMS were simultaneously injected at a flow rate of 30 μl/min for an association phase of 200 s, which was followed by a 600-s dissociation phase.Yeast Strains and Media—Wild type yeast strain YPH499 was used (26Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar). To generate the strain containing a chromosomal deletion of TIM23 rescued with Tim23 on URA plasmid, YPH499 cells were transformed with pVT-U plasmid (27Vernet T. Dignard D. Thomas D.Y. Gene (Amst.). 1987; 52: 225-233Crossref PubMed Scopus (461) Google Scholar) carrying the wild type copy of Tim23 under the control of the ADH promoter. The chromosomal copy of TIM23 was subsequently deleted by the KAN cassette using homologous recombination. This strain was designated Δ23 + 23URA. To generate yeast strains carrying mutant versions of Tim23 instead of wild type, Tim23 mutants were cloned into centromeric plasmid pRS315 (26Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar) under control of the endogenous promoter and 3′-untranslated region and transformed into Δ23 + 23URA. An empty pRS315 and the plasmid carrying the wild type copy of Tim23 were transformed as controls. Yeast cells that had lost the URA plasmid were selected on medium containing 5-fluoroorotic acid.Yeast cells were normally grown on lactate medium containing 0.1% (w/v) glucose at 30 °C. To exclude possible secondary effects, for import assays yeast cells were grown at 24 °C. For drop dilution assays, 10-fold serial dilutions of yeast cells were spotted on YPG plates and incubated at 24, 30, and 37 °C for 2 days.Miscellaneous—Coimmunoprecipitation experiments were performed according to published procedures (11Mokranjac D. Sichting M. Neupert W. Hell K. EMBO J. 2003; 22: 4945-4956Crossref PubMed Scopus (167) Google Scholar). Import into isolated mitochondria was done as described previously (11Mokranjac D. Sichting M. Neupert W. Hell K. EMBO J. 2003; 22: 4945-4956Crossref PubMed Scopus (167) Google Scholar) with the modification that mitochondria were preincubated for 10 min at 37 °C the addition of precursor of Tim23IMS and purified the soluble intermembrane space domains of Tim23 and Tim50 after expression in E. secondary was by CD The spectrum of Tim50IMS that it was with a of and Tim23IMS a spectrum of an protein; however, were also of the of some Protease digestion experiments that Tim50IMS is a protein, Tim23IMS is that secondary on the of sequences of the IMS domain of Tim23 to be we the of the purified IMS The of proteins was by their Aggregation of Tim50IMS started at 50 °C and was complete at 60 °C was also followed by the CD spectrum at A of °C was Tim23IMS remained soluble at all temperatures to 80 The CD spectrum of Tim23IMS remained at temperatures as as 80 °C In the isolated Tim50IMS protein was with a well defined secondary In Tim23IMS to be essentially of Tim23-Tim50 Using Tim23IMS and an interaction between the isolated Tim23IMS and Tim50IMS we used two were or with the cross-linking The cross-linked were then analyzed by Tim23IMS cross-linked were In after to DSS, a comprising also and higher of Tim23IMS in the of DSS and concentrations of Tim50IMS to the formation of a cross-linked which in to an of the two proteins. This was by using against proteins The was the concentration of Tim50IMS was constant (10 and the concentration of Tim23IMS was formation of the isolated intermembrane space domains of Tim50 and Tim23 by chemical purified Tim23IMS (10 was incubated for 10 min with concentrations of purified Tim50IMS and then for 1 h with 1 mm DSS at 25 °C. purified Tim50IMS (10 was incubated with of Tim23IMS and treated as in A. products were analyzed by SDS-PAGE and staining with complex formation between Tim23IMS and Tim50IMS was also using surface plasmon resonance of the complex upon with buffer. The of the interaction of Tim23IMS and from the as a of the was 60 In interaction of the purified IMS domains of Tim23 and Tim50 can be in vitro using chemical cross-linking and formation of the isolated intermembrane space domains of Tim50 and Tim23 by surface plasmon Tim23IMS was at a of ∼800 RU in the channel. The chip was rotated at 90°, and six different concentrations of Tim50IMS were injected simultaneously at a flow rate of 30 μl/min for a association followed by a 600-s dissociation of the by of Tim23 with Tim50 identify amino acid residues that in complex formation of Tim50 and Tim23, we amino acids of in of their were to be of The domains of these mutants were prepared as described for wild Upon chemical cross-linking two mutants and interaction with Tim50IMS as with wild type A and and data by complete of interaction of and with Tim50IMS C and The mutant a of its by a factor of three as with wild type of Tim23IMS mutants with Tim50IMS by cross-linking and surface plasmon A and mutants and of Tim23IMS were to chemical cross-linking, as described for C and surface plasmon resonance of interaction of mutants and of Tim23IMS with Tim50IMS. The were as in wild using binding binding Open table in a new tab of Tim23 in of the of interaction by the and we analyzed with to their in yeast We carrying or the into a yeast strain containing a chromosomal deletion of which be rescued by the wild type copy of Tim23 on the URA After the URA out on medium containing yeast strains harboring the mutant of Tim23 were the mutants growth under the the mutant growth and was at 37 °C We to the In mitochondria isolated from this strain grown at the of Tim23 was and the endogenous levels were to be The interaction between Tim23 and Tim50 in wild type and mutant mitochondria was analyzed by The complex between Tim23 and Tim50 in wild type was in the Tim23 mutant The was of to Tim23 or to Tim50 were used for the interaction of Tim23 with subunits of the TIM23 complex such as Tim17, Tim44, and Pam17 was by these This the specific of the residues in the interaction of the IMS domain of Tim23 with of mutations in the intermembrane space domain of Tim23. 10-fold serial dilutions of yeast cells carrying wild type Tim23 or or mutants were spotted onto YPG plates and grown at the temperatures for 2 mitochondria isolated from wild type or cells carrying the in Tim23 were with and to using purified to Tim23 and Tim50. from were used as a and fractions were analyzed by SDS-PAGE followed by with C, mitochondria as were incubated in the or of PK for the and subsequently analyzed by SDS-PAGE followed by with the Tim50, and were used as proteins for the outer membrane, intermembrane and the first ∼20 residues of Tim23, normally to the added protease in were found in a in mitochondria Tim50 H. Esaki M. Kanamori T. Tamura Y. Nishikawa S. Endo T. Cell. 2002; 111: 519-528Abstract Full
24
Mitochondrial Hsp70/MIM44 complex facilitates protein import
Hans-Christoph Schneider, Jutta Berthold, Matthias Bauer et al. · Nature · 1994 · 394 citations
Natural Sciences, Cellular Biochemistry, Molecular Biology +1