Concepedia

Publication | Open Access

The N-terminal Epidermal Growth Factor-like Domain in Factor IX and Factor X Represents an Important Recognition Motif for Binding to Tissue Factor

50

Citations

53

References

2002

Year

Abstract

Factors VII, IX, and X play key roles in blood coagulation. Each protein contains an N-terminal γ-carboxyglutamic acid domain, followed by EGF1 and EGF2 domains, and the C-terminal serine protease domain. Protein C has similar domain structure and functions as an anticoagulant. During physiologic clotting, the factor VIIa-tissue factor (FVIIa·TF) complex activates both factor IX (FIX) and factor X (FX). FVIIa represents the enzyme, and TF represents the membrane-bound cofactor for this reaction. The substrates FIX and FX may utilize multiple domains in binding to the FVIIa·TF complex. To investigate the role of the EGF1 domain in this context, we expressed wild type FIX (FIXWT), FIXQ50P, FIXPCEGF1 (EGF1 domain replaced with that of protein C), FIXΔEGF1 (EGF1 domain deleted), FXWT, and FXPCEGF1. Complexes of FVIIa with TF as well as with soluble TF (sTF) lacking the transmembrane region were prepared, and activations of WT and mutant proteins were monitored by SDS-PAGE and by enzyme assays. FVIIa·TF or FVIIa·sTF activated each mutant significantly more slowly than the FIXWT or FXWT. Importantly, in ligand blot assays, FIXWTand FXWT bound to sTF, whereas mutants did not; however, all mutants and WT proteins bound to FVIIa. Further experiments revealed that the affinity of the mutants for sTF was reduced 3–10-fold and that the synthetic EGF1 domain (of FIX) inhibited FIX binding to sTF with Ki of ∼60 μm. Notably, each FIXa or FXa mutant activated FVII and bound to antithrombin, normally indicating correct folding of each protein. In additional experiments, FIXa with or without FVIIIa activated FXWT and FXPCEGF1 normally, which is interpreted to mean that the EGF1 domain of FX does not play a significant role in its interaction with FVIIIa. Cumulatively, our data reveal that substrates FIX and FX in addition to interacting with FVIIa (enzyme) interact with TF (cofactor) using, in part, the EGF1 domain. Factors VII, IX, and X play key roles in blood coagulation. Each protein contains an N-terminal γ-carboxyglutamic acid domain, followed by EGF1 and EGF2 domains, and the C-terminal serine protease domain. Protein C has similar domain structure and functions as an anticoagulant. During physiologic clotting, the factor VIIa-tissue factor (FVIIa·TF) complex activates both factor IX (FIX) and factor X (FX). FVIIa represents the enzyme, and TF represents the membrane-bound cofactor for this reaction. The substrates FIX and FX may utilize multiple domains in binding to the FVIIa·TF complex. To investigate the role of the EGF1 domain in this context, we expressed wild type FIX (FIXWT), FIXQ50P, FIXPCEGF1 (EGF1 domain replaced with that of protein C), FIXΔEGF1 (EGF1 domain deleted), FXWT, and FXPCEGF1. Complexes of FVIIa with TF as well as with soluble TF (sTF) lacking the transmembrane region were prepared, and activations of WT and mutant proteins were monitored by SDS-PAGE and by enzyme assays. FVIIa·TF or FVIIa·sTF activated each mutant significantly more slowly than the FIXWT or FXWT. Importantly, in ligand blot assays, FIXWTand FXWT bound to sTF, whereas mutants did not; however, all mutants and WT proteins bound to FVIIa. Further experiments revealed that the affinity of the mutants for sTF was reduced 3–10-fold and that the synthetic EGF1 domain (of FIX) inhibited FIX binding to sTF with Ki of ∼60 μm. Notably, each FIXa or FXa mutant activated FVII and bound to antithrombin, normally indicating correct folding of each protein. In additional experiments, FIXa with or without FVIIIa activated FXWT and FXPCEGF1 normally, which is interpreted to mean that the EGF1 domain of FX does not play a significant role in its interaction with FVIIIa. Cumulatively, our data reveal that substrates FIX and FX in addition to interacting with FVIIa (enzyme) interact with TF (cofactor) using, in part, the EGF1 domain. FVII, FX, and FVIII, factor FIX, FVII, FX, and FVIII, respectively FIX in which EGF1 domain has been deleted FIX or FX in which the EGF1 domain has been replaced with that of protein C normal plasma FIX normal plasma FX membrane-inserted tissue factor containing residues 1–243 membrane region deleted soluble tissue factor containing residues 1–219 epidermal growth factor antithrombin phospholipid monoclonal antibody benzoyl-Ile-Glu-Gly-Arg-p-nitroanilide biotinylated Glu-Gly-Arg-chloromethylketone bovine serum albumin Russell's viper venom polyethylene glycol 8000 γ-carboxyglutamic acid high pressure liquid chromatography wild type N-(9-fluorenyl)methoxycarbonyl Human factor IX (FIX)1and factor X (FX) are vitamin K-dependent glycoproteins with Mr of 57,000 and 58,800, respectively (1Yoshitake S. Schach B.G. Foster D.C. Davie E.W. Kurachi K. J. Biol. Chem. 1985; 24: 3736-3750Google Scholar,2Leytus S.P. Foster D.C. Kurachi K. Davie E.W. Biochemistry. 1986; 25: 5098-5102Crossref PubMed Scopus (182) Google Scholar). Factor VIIa-tissue factor (FVIIa·TF) complex activates FIX to FIXa and FX to FXa by cleaving Arg145–Ala146and Arg180–Val181 peptide bonds in FIX (3Bajaj S.P. Birktoft J.J. Methods Enzymol. 1993; 222: 96-128Crossref PubMed Scopus (41) Google Scholar) and the Arg194–Ile195 peptide bond in FX (2Leytus S.P. Foster D.C. Kurachi K. Davie E.W. Biochemistry. 1986; 25: 5098-5102Crossref PubMed Scopus (182) Google Scholar). The resulting FIXa or FXa molecule consists of an N-terminal light chain and a C-terminal heavy chain linked by a disulfide bond. The light chain in each case contains a γ-carboxyglutamic acid (Gla) domain and two epidermal growth factor-like domains (EGF1 and EGF2), whereas the heavy chain contains the serine protease domain. In the blood coagulation cascade, FIXa also activates FX to FXa in a reaction that requires factor VIIIa (FVIIIa), phospholipid (PL), and calcium. FXa formed by either pathway then activates prothrombin to thrombin in a reaction that requires factor Va, PL, and calcium (4Bajaj S.P. Joist J.H. Semin. Thromb. Hemost. 1999; 25: 407-418Crossref PubMed Scopus (88) Google Scholar). In addition, both FIXa and FXa activate FVII to FVIIa (5Masys D.R. Bajaj S.P. Rapaport S.I. Blood. 1982; 60: 1143-1150Crossref PubMed Google Scholar, 6Bajaj S.P. Rapaport S.I. Brown S.F. J. Biol. Chem. 1981; 256: 253-259Abstract Full Text PDF PubMed Google Scholar, 7Butenas S. Mann K.G. Biochemistry. 1996; 35: 1904-1910Crossref PubMed Scopus (94) Google Scholar) and are inhibited by antithrombin (AT) (8Di Scipio R.G. Hermodson M.A. Yates S.G. Davie E.W. Biochemistry. 1977; 16: 698-706Crossref PubMed Scopus (415) Google Scholar, 9Rosenberg R.D. Rosenberg J.S. J. Clin. Invest. 1984; 74: 1-6Crossref PubMed Scopus (190) Google Scholar). The conversion of single chain zymogen FVII to enzyme FVIIa involves the cleavage of a single peptide bond between Arg152 and Ile153. The FVIIa formed consists of a light chain of 152 amino acids and a heavy chain of 254 amino acids held together by a disulfide bond (10Hagen F.S. Gray C.L. O'Hara P. Grant F.J. Saari G.C. Woodbury R.G. Hart C.E. Insley M. Kisiel W. Kurachi K. Davie E.W. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2412-2416Crossref PubMed Scopus (321) Google Scholar). Like FIXa and FXa, the N-terminal light chain of FVIIa contains the Gla domain and two EGF-like domains, whereas the heavy chain contains the serine protease domain (10Hagen F.S. Gray C.L. O'Hara P. Grant F.J. Saari G.C. Woodbury R.G. Hart C.E. Insley M. Kisiel W. Kurachi K. Davie E.W. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2412-2416Crossref PubMed Scopus (321) Google Scholar). TF, the cellular cofactor for FVIIa, is composed of two fibronectin type III β-sandwich domains (11Harlos K. Martin D.M. O'Brien D.P. Jones E.Y. Stuart D.I. Polikarpov I. Miller A. Tuddenham E.G. Boys C.W. Nature. 1994; 370: 662-666Crossref PubMed Scopus (214) Google Scholar, 12Muller Y.A. Ultsch M.H. Kelley R.F. de Vos A.M. Biochemistry. 1994; 36: 10864-10870Crossref Scopus (133) Google Scholar). Recently, high resolution x-ray structure of the complex of soluble tissue factor (sTF) and FVIIa has been reported (13Banner D.W. D'Arcy A. Chene C. Winkler F.K. Guha A. Konigsberg W.H. Nemerson Y. Kirchhofer D. Nature. 1996; 380: 41-46Crossref PubMed Scopus (686) Google Scholar). In this structure, the Gla and EGF1 domains make contact with the C-terminal domain of TF and the EGF2 and the protease domains make contact with the N-terminal domain of TF (13Banner D.W. D'Arcy A. Chene C. Winkler F.K. Guha A. Konigsberg W.H. Nemerson Y. Kirchhofer D. Nature. 1996; 380: 41-46Crossref PubMed Scopus (686) Google Scholar). Thus, FVIIa uses all of its four domains in binding to the N- and C-terminal domains of TF (13Banner D.W. D'Arcy A. Chene C. Winkler F.K. Guha A. Konigsberg W.H. Nemerson Y. Kirchhofer D. Nature. 1996; 380: 41-46Crossref PubMed Scopus (686) Google Scholar). Efforts have been directed to understanding the regions in FVIIa·TF that interact with the substrates FIX and FX. By studying the effect of mutations in the C-terminal domain of TF, it has been proposed that this domain may interact with the Gla domains of FIX and FX (14Kirchhofer D. Lipari M.T. Moran P. Eigenbrot C. Kelley R.F. Biochemistry. 2000; 39: 7380-7387Crossref PubMed Scopus (68) Google Scholar). Similarly, by mutagenesis and docking experiments, it has been proposed that the Gla domain of FVIIa interacts with the Gla domain of FX (15Ruf W. Shobe J. Rao S.M. Dickinson C.D. Olson A. Edgington T.S. Biochemistry. 1999; 38: 1957-1966Crossref PubMed Scopus (49) Google Scholar). Further, we reported earlier that the EGF1 domain of FIX is required for its activation by the FVIIa·TF complex (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar). However, the role of the EGF1 domain of FX in this context has not been investigated. Moreover, it is not known whether FVIIa or TF in the FVIIa·TF complex interacts with the EGF1 domains of FIX and FX. Thus, the precise function of EGF1 domain of FIX or FX in its interaction with the FVIIa·TF complex is not known. Protein C is a serine protease with an anticoagulant function whose domain organization is similar to that of FVIIa, FIXa, or FXa (17Esmon C.T. J. Biol. Chem. 1989; 264: 4743-4746Abstract Full Text PDF PubMed Google Scholar, 18Mather T. Oganessyan V. Hof P. Huber R. Foundling S. Esmon C. Bode W. EMBO J. 1996; 15: 6822-6831Crossref PubMed Scopus (193) Google Scholar). Further, activated protein C is not involved in the TF-induced coagulation, and its EGF1 domain near the N terminus has an eight-residue insertion (18Mather T. Oganessyan V. Hof P. Huber R. Foundling S. Esmon C. Bode W. EMBO J. 1996; 15: 6822-6831Crossref PubMed Scopus (193) Google Scholar). Therefore, substituting the EGF1 domain of FIX (or FX) with the EGF1 domain of protein C should replace the unique determinants present in the EGF1 domain of FIX (or FX) that provides specificity for its interaction with the FVIIa·TF complex. In this report, in addition to the above two replacement mutants (FIXPCEGF1 and FXPCEGF1), we used a point mutant (FIXQ50P) and an EGF1 deletion mutant (FIXΔEGF1) of FIX to understand the function of this domain in TF-induced coagulation. Data are provided, which strongly indicate that TF interacts with the EGF1 domain in FIX and FX. Our findings represent the first report that assigns a specific function to the EGF1 domain in these proteins. Carrier-free Na125I was obtained from ICN Biomedicals, Inc. Benzoyl-Ile-Glu-Gly-Arg-p-nitroanilide (S-2222) was obtained from Diapharma Inc. Biotinylated Glu-Gly-Arg-chloromethylketone (biotin-EGR-CK) was purchased from Hematologic Technologies, Inc. Nitrocellulose membrane, polyethylene glycol 8000 (PEG), p-nitrophenyl phosphate, bovine serum albumin (BSA), bovine brain phosphatidylcholine, and phosphatidylserine were purchased from Sigma. Horseradish peroxidase-goat anti-mouse IgG and enhanced chemiluminescence (ECL) detection reagents were purchased from Amersham Biosciences. FVII-depleted plasma and Neoplastin were obtained from Amersham Biosciences. Normal plasma FIX (FIXNP), plasma FX (FXNP), FXIa, Russell's viper venom (RVV), and AT were obtained from Enzyme Research Laboratory. Low molecular weight heparin was purchased from Rhône-Poulenc Rorer Pharmaceuticals Inc. A monoclonal antibody-purified human FVIII concentrate was obtained from Dr. Leon Hoyer (American Red Cross, Rockville, MD). It was activated with 1 nm thrombin in the presence of 0.1% BSA and 5 mm CaCl2 in Tris/NaCl at 37 °C for 2 min as described earlier (20Mathur A Zhong D Sabharwal A.K. Smith K.J. Bajaj S.P. J. Biol. Chem. 1997; 272: 23418-23426Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). The formed FVIIIa was diluted and used immediately in the activation of FX by FIXa·FVIIIa·PL. For ligand blot experiments, a Ca2+-dependent FIX monoclonal antibody (mAb) cell line was provided by Dr. Shirly Miekka of the American Red Cross, and the IgG was purified as described (21Tharakan J. Strickland D. Burgess W. Drohan W.N. Clark D.B. Vox. Sang. 1990; 58: 21-29Crossref PubMed Scopus (25) Google Scholar). A Ca2+-dependent mAb to the heavy chain of FX used for the ligand blot experiments was purchased from American Diagnostics, Inc. PL vesicles (75% phosphatidylcholine, 25% phosphatidylserine) were prepared by the method of Husten et al. (22Husten E.J. Esmon C.T. Johnson A.E. J. Biol. Chem. 1987; 262: 12953-12961Abstract Full Text PDF PubMed Google Scholar). TF containing the transmembrane region (residues 1–243) was a gift from Genetech, Inc. The relipidation of the TF was performed as described (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar). sTF that lacks the transmembrane region (residues 1–219) was a gift from Tom Gerard of Pharmacia Corp., St. Louis, MO. For studies of AT binding and FVII activation, FIXa and FXa were prepared by activating FIX with FXIa (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar) and activating FX with RVV (23Fujikawa K. Legaz M.E. Davie E.W. Biochemistry. 1972; 11: 4892-4899Crossref PubMed Scopus (138) Google Scholar) in 50 mm Tris, 0.15 m NaCl (Tris/NaCl), pH 7.4, containing 5 mm CaCl2 and 0.1% PEG at 37 °C for 2 h. Complete activation of FIX or FX was confirmed by SDS-PAGE (24Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207233) Google Scholar). SDS-gel electrophoresis was performed using the Laemmli buffer system (24Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207233) Google Scholar). The acrylamide concentration was 12%, and the gels were stained with Coomassie Brilliant Blue dye. All proteins used in the present study were ∼98% pure. Gla and amino acid sequence analysis were performed by Commonwealth Biotechnologies, Inc. (Richmond, VA). Automated degradation of each protein (∼0.5 nmol) was performed using an Applied Biosystems gas phase sequencer. Gla analysis of each protein was performed by alkaline hydrolysis followed by HPLC analysis. The amount of Gla was quantitated based upon Asp and Asn present per mol of each protein. Recombinant FIXWT, FIXΔEGF1, FIXPCEGF1, and FIXQ50P were expressed in human embryonic kidney 293 cells and purified by using the IX A-7 mAb column as described (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). Each FIX protein had ∼12 Gla residues/mol (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar). To express FVIIWT, the restriction sitesAflII and XhoI were introduced at the 5′- and 3′-ends of VII cDNA for ligation into the pMon3360b expression vector (26Hippenmeyer P. Highkin M. Bio/Technology. 1993; 11: 1037-1041PubMed Google Scholar) that was modified to contain AflII andXhoI sites. A stable cell line that expressed FVIIWT was established as described in detail by Hippenmeyer and Highkin (26Hippenmeyer P. Highkin M. Bio/Technology. 1993; 11: 1037-1041PubMed Google Scholar). Medium was collected in the presence of vitamin K as outlined earlier for FIX (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). FVIIWT was purified by using a Ca2+-dependent mAb as described (27Kazama Y. Pastuszyn A. Wildgoose P. Hamamoto T. Kisiel W. J. Biol. Chem. 1993; 268: 16231-16240Abstract Full Text PDF PubMed Google Scholar). It contained 9–10 Gla residues/mol and had ANAFL as the N-terminal sequence. FVIIa was obtained as earlier, except insoluble FXa (Sepharose-FXa) was used instead of the soluble FXa as the activator (6Bajaj S.P. Rapaport S.I. Brown S.F. J. Biol. Chem. 1981; 256: 253-259Abstract Full Text PDF PubMed Google Scholar). The resin was removed by centrifugation, and the supernatant was passed over a small Chelex-100 column to remove Ca2+. Aliquots were kept frozen at −80 °C until used. An expression vector for FXWT was constructed in which the prepro-leader sequence of FXWT was replaced with that of prothrombin as described by Camire et al. (28Camire R.M. Larson P.J. Stafford D.W. High K.A. Biochemistry. 2000; 39: 14322-14329Crossref PubMed Scopus (60) Google Scholar). The prepro-leader sequence of prothrombin was amplified by PCR using primers A and B (TableI) and a human liver cDNA library. The prepro-leader sequence of prothrombin was then linked to the FX cDNA sequence by the overlap extension method using primers A and C (25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). The resulting chimeric DNA, containing the prepro-leader sequence of prothrombin followed by the FX sequence, was digested withAflII and XhoI and ligated into pMon3360b expression vector. A stable cell line that expressed FXWTwas established as described (26Hippenmeyer P. Highkin M. Bio/Technology. 1993; 11: 1037-1041PubMed Google Scholar). Medium was collected in the presence of vitamin K as outlined earlier for FIX (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). FXWT was purified using a Ca2+-dependent mAb to the Gla domain of FX (25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar) followed by FPLC Mono Q column. The conditions for the FPLC Mono Q column were the same as described previously for FIX purification (16Zhong D. Smith K.J. Birktoft J.J. Bajaj S.P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3574-3578Crossref PubMed Scopus (58) Google Scholar, 25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar). Construction of FXPCEGF1 was performed by the overlap extension method as described (25Zhong D. Bajaj S.P. BioTechniques. 1993; 15: 874-878PubMed Google Scholar), and primers D and E (Table I) were used to amplify the protein C EGF1 domain. The establishment of a stable cell line and the purification of FXPCEGF1 were the same as for FXWT.Table ISequence of synthetic oligonucleotide primers for construction of FXWT and FXPCEGF1PrimerSequence1-aPrimer A contains aAflII site, and primer C contains an XhoI site. The restriction site sequences are underlined. The sequence in parenthesis for primers A and B correspond to the prepro-leader sequence of human prothrombin. The sequences in parenthesis is primer C correspond to the C-terminal six amino acid residues of FX as well as the stop codon. Primers D and E were used to construct FXPCEGF1. These are hybrid primers containing FX and protein C DNA sequences. The sequences in parenthesis correspond to the human protein C sequences.A5′-CTAGACTTAAGCTTCCACC(ATGGCCACGTCCGAGGCTTG)B5′-CTTCATCTCTTCAAGAAAGGAATTGGC(TCGCCGGACCCGCTGGAG)C5′-TCTGACTCGAG(TCACTTTAATGGAGAGGA)D5′-AAAGATGGCGACCAGTGT(TTGGTCTTGCCGTTGGAG)E5′-GCTGCAGAGCTTCCGTGT(CTCCCGCTGGCAGAAGCG)1-a Primer A contains aAflII site, and primer C contains an XhoI site. The restriction site sequences are underlined. The sequence in parenthesis for primers A and B correspond to the prepro-leader sequence of human prothrombin. The sequences in parenthesis is primer C correspond to the C-terminal six amino acid residues of FX as well as the stop codon. Primers D and E were used to construct FXPCEGF1. These are hybrid primers containing FX and protein C DNA sequences. The sequences in parenthesis correspond to the human protein C sequences. Open table in a new tab For activation of FIX by FVIIa·TF·PL, 2 μm FIX was activated with 8 nm VIIa and 0.5 nm TF in the presence of 1 mm PL, 5 mm CaCl2, 0.1% PEG in Tris/NaCl buffer. At different times, 20 μl of the reaction mixture was removed and diluted 10-fold with 20 mmEDTA, pH 7.4. Biotin-EGR-CK was added to the diluted mixture to a final concentration of 20 μm, and the sample was incubated at 37 °C for 2 h and then at 4 °C overnight. To measure the amount of biotin-EGR-IXa, a 96-well microtiter plate was coated with 100 μl (10 μg/ml in 0.1 m of NaHCO3) of the Ca2+-dependent FIX mAb at 4 °C overnight. The wells were blocked with 200 μl of 1% BSA and 0.1% Tween 20 in Tris/NaCl for 2 h at 37 °C. At this each sample was diluted in Tris/NaCl containing 1% BSA and 0.1% Tween 100 μl of the diluted sample was added to each and the plate was incubated at 37 °C for 2 h for of the by the FIX The plate was with Tris/NaCl containing 0.1% Tween 20 and 5 Each well then 100 μl of alkaline in Tris/NaCl containing 1% 0.1% Tween and 5 mm The plate was incubated at 37 °C for 1 h. each well 100 μl of p-nitrophenyl in the alkaline buffer mm 5 100 mm Tris, pH The amount was in a microtiter plate at nm FIXa concentration was then from a with known of FIXa and of the using the above For activation of FIX with 4 μm FIX was activated with μm FVIIa·sTF in the of All conditions were the same as for the activation of FIX with outlined For μl of the reaction mixture was removed at different and added to 2 μl of 0.5 m and 5 μl of buffer. were in for 5 min and by SDS-PAGE (24Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207233) Google Scholar). For activation of FX by FVIIa·TF·PL, 2 μm FX was activated with 8 nm FVIIa and 0.5 nm TF in the presence of 1 mm PL, 5 mm CaCl2, 0.1% PEG in These conditions are the same as used for the activation of At different times, 20 μl of the reaction mixture was removed and diluted 10-fold with 20 mm in pH to stop the reaction. The reaction mixture was diluted as and the concentration of FXa was by the hydrolysis of μm The amount of FXa was from a constructed using known of activated For activation of FX with 4 μm FX was activated with μm FVIIa·sTF in the of All conditions were the same as above for the activation of FX with For μl of the reaction mixture was removed at different and added to 2 μl of 0.5 and 5 μl of buffer for analysis by For activation of FXWT and FXPCEGF1 by 50 nm FVIIa was incubated at 37 °C with 1 μm FXWT or FXPCEGF1 in the presence of μm PL and 5 mm CaCl2 in Tris/NaCl containing 0.1% were removed at and min and added to μl of 20 mm in The reaction mixture was diluted as and the concentration of FXa was by the hydrolysis of μm These experiments were performed as described in detail earlier A. Bajaj S.P. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus (68) Google Scholar). The concentration of each used is in the to A 50 nm concentration of each FIXa or FXa was incubated at 37 °C with 1 μm FVII in the presence of μm PL and 5 mm CaCl2 in were removed at different and added to 100 μl of 0.1% BSA in Tris/NaCl containing mm The were diluted in 0.1% BSA in Tris/NaCl without and for in a Bajaj S.P. Rapaport S.I. Blood. 1985; PubMed Google Scholar). For this 50 μl of FVII-depleted plasma was incubated with 50 μl of Neoplastin for min at 37 °C. μl of sample and 50 μl of were added and the was normal human plasma was used as a For SDS-PAGE were removed a For these experiments, the final reaction contained the 2 or FXa, 2 μm 5 mm CaCl2, and molecular weight heparin in pH 7.4. The reaction mixture in each case was and were removed at and min and added to 5 μl of buffer and by The protein were by Coomassie Blue and quantitated by The of complex of heavy chain of FIXa or FXa with AT was then from the in the of to the heavy chain of each enzyme and in of the chain complex. sTF and FVIIa were The proteins were then to a The used was that outlined by et al. J. T. A Scholar), using the The membrane was blocked with Tween 20 in Tris/NaCl at for 1 h. Each membrane was then incubated with FIX or FX proteins at 5 μg/ml in 1% Tween and 5 mm CaCl2 at 4 °C overnight. with Tween 20 in Tris/NaCl and 5 the membrane was incubated with FIX mAb or FX mAb at for 2 h. A antibody peroxidase-goat anti-mouse and the detection were used to the The EGF1 domain of FIX to amino acid residues was an peptide by Inc. The C-terminal amino acid was to resin using acid activation was performed using The of the amino acid was and the chain were by and and and and was performed using in and the peptide was and from the resin using for 2 h. The peptide was purified by phase HPLC a column using conditions J. D.W. 1989; Google Scholar). The purified reduced peptide a molecular of as by analysis using a The synthetic domain peptide was using an system R. R. Protein A Scholar, P. A.K. R. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). The peptide was at a concentration of in a containing pH 50 mm CaCl2, mm and mm The mixture was to for h at at which acid was added to the pH to The peptide was then purified by phase HPLC and and its concentration was using the of at nm for a single or in 0.1 m J. PubMed Scopus Google Scholar). and contained in our peptide were into in its was by using a and a of the synthetic EGF1 domain at μm in 4 of pH 7.4, were performed by a

References

YearCitations

Page 1