Proteins Homologous to p47 and p67 Support Superoxide Production by NAD(P)H Oxidase 1 in Colon Epithelial Cells

Abstract

Superoxide production by phagocytes involves activation of a multi-component NADPH oxidase. Recently, several homologues of the catalytic component of the phagocyte oxidase, gp91phox, were identified in various tissues. Here we describe two proteins, p41 and p51, with significant homology to two cytosolic components of the phagocytic oxidase, p47phox and p67phox. Like p47phox, p41 contains an amino-terminal Phox homology domain, two SH3 domains, and a conserved carboxyl-terminal, proline-rich motif. Similarly, p51 is homologous to p67phox, containing four amino-terminal tetratrico-peptide repeats, a conserved “activation domain” motif, a PB1 domain, and a carboxyl-terminal SH3 domain. The highest levels of p41 transcript are detected in the colon and in other gastrointestinal tissues that express Nox1, the predominant gp91phox homologue in these tissues. In contrast, the p51 transcript showed a more widespread expression pattern, suggesting that it may support other tissue-specific oxidases. Mouse colon in situ hybridization detected both transcripts in the epithelial cells of colon crypts. Heterologous co-expression of p41 and p51 significantly enhances the superoxide-generating activity of Nox1-expressing cells; thus, p41 and p51 appear to be novel regulators of Nox1. These proteins also support the activity of gp91phox, albeit at much lower levels than the cytosolic phox counterparts. Our results suggest colon epithelial cells contain a multi-component NAD(P)H oxidase with a molecular architecture similar to the phagocytic oxidase. Superoxide production by phagocytes involves activation of a multi-component NADPH oxidase. Recently, several homologues of the catalytic component of the phagocyte oxidase, gp91phox, were identified in various tissues. Here we describe two proteins, p41 and p51, with significant homology to two cytosolic components of the phagocytic oxidase, p47phox and p67phox. Like p47phox, p41 contains an amino-terminal Phox homology domain, two SH3 domains, and a conserved carboxyl-terminal, proline-rich motif. Similarly, p51 is homologous to p67phox, containing four amino-terminal tetratrico-peptide repeats, a conserved “activation domain” motif, a PB1 domain, and a carboxyl-terminal SH3 domain. The highest levels of p41 transcript are detected in the colon and in other gastrointestinal tissues that express Nox1, the predominant gp91phox homologue in these tissues. In contrast, the p51 transcript showed a more widespread expression pattern, suggesting that it may support other tissue-specific oxidases. Mouse colon in situ hybridization detected both transcripts in the epithelial cells of colon crypts. Heterologous co-expression of p41 and p51 significantly enhances the superoxide-generating activity of Nox1-expressing cells; thus, p41 and p51 appear to be novel regulators of Nox1. These proteins also support the activity of gp91phox, albeit at much lower levels than the cytosolic phox counterparts. Our results suggest colon epithelial cells contain a multi-component NAD(P)H oxidase with a molecular architecture similar to the phagocytic oxidase. Neutrophils and other circulating phagocytic cells are recognized for their unique capacity for robust reactive oxidant generation. This activity is attributed to a phagocyte-specific NADPH oxidase (phox), which serves as an effective microbicidal system (1Leto T.L. Gallin J.I. Snyderman R. Inflammation Basic Principles and Clinical Correlates. Lippincott Williams & Wilkins, Philadelphia1999: 769-787Google Scholar). Patients with deficient phox activity suffer from chronic granulomatous disease, an inherited disease characterized by enhanced susceptibility to microbial infections due to the absence of or defects in any one of several essential phagocyte oxidase components (1Leto T.L. Gallin J.I. Snyderman R. Inflammation Basic Principles and Clinical Correlates. Lippincott Williams & Wilkins, Philadelphia1999: 769-787Google Scholar, 2Segal B.H. Leto T.L. Gallin J.I. Malech H.L. Holland S.M. Medicine. 2000; 79: 170-200Crossref PubMed Scopus (744) Google Scholar). The phox system is subject to tight regulation, as it is dormant in resting cells and becomes activated in response to infectious or inflammatory stimuli. This involves the coordinated translocation of several phosphorylated cytosolic phox factors, as well as the activation of the small GTPase Rac2, which assemble in a membrane-bound complex with flavocytochrome b558 (1Leto T.L. Gallin J.I. Snyderman R. Inflammation Basic Principles and Clinical Correlates. Lippincott Williams & Wilkins, Philadelphia1999: 769-787Google Scholar). Recently, several oxidases have been identified in other tissues, based on their homology to the catalytic core component of the flavocytochrome, gp91phox (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar, 4Geiszt M. Kopp J.B. Varnai P. Leto T.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8010-8014Crossref PubMed Scopus (730) Google Scholar, 5Dupuy C. Ohayon R. Valent A. Noel-Hudson M.S. Deme D. Virion A. J. Biol. Chem. 1999; 274: 37265-37269Abstract Full Text Full Text PDF PubMed Scopus (385) Google Scholar, 6De Deken X. Wang D. Many M.C. Costagliola S. Libert F. Vassart G. Dumont J.E. Miot F. J. Biol. Chem. 2000; 275: 23227-23233Abstract Full Text Full Text PDF PubMed Scopus (517) Google Scholar, 7Shiose A. Kuroda J. Tsuruya K. Hirai M. Hirakata H. Naito S. Hattori M. Sakaki Y. Sumimoto H. J. Biol. Chem. 2001; 276: 1417-1423Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar, 8Banfi B. Molnar G. Maturana A. Steger K. Hegedus B. Demaurex N. Krause K.H. J. Biol. Chem. 2001; 276: 37594-37601Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar). These novel enzymes are proposed to serve a variety of functions, including oxygen sensing, hormone biosynthesis, and signal transduction affecting vasoregulation, cellular proliferation, senescence, and apoptosis; however, little is known about the factors that influence the oxidative output of these related Nox family oxidases. The thyroid and lymphoid oxidases contain multiple calcium-binding EF-hands, consistent with their apparent activation by calcium signals (5Dupuy C. Ohayon R. Valent A. Noel-Hudson M.S. Deme D. Virion A. J. Biol. Chem. 1999; 274: 37265-37269Abstract Full Text Full Text PDF PubMed Scopus (385) Google Scholar, 6De Deken X. Wang D. Many M.C. Costagliola S. Libert F. Vassart G. Dumont J.E. Miot F. J. Biol. Chem. 2000; 275: 23227-23233Abstract Full Text Full Text PDF PubMed Scopus (517) Google Scholar, 8Banfi B. Molnar G. Maturana A. Steger K. Hegedus B. Demaurex N. Krause K.H. J. Biol. Chem. 2001; 276: 37594-37601Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar). The renal oxidase, Nox4 or Renox, produces measurable amounts of superoxide and induces cellular senescence when heterologously expressed in transfected NIH-3T3 cells, suggesting that this enzyme may be constitutively active, consistent with its proposed role in oxygen sensing (4Geiszt M. Kopp J.B. Varnai P. Leto T.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8010-8014Crossref PubMed Scopus (730) Google Scholar, 7Shiose A. Kuroda J. Tsuruya K. Hirai M. Hirakata H. Naito S. Hattori M. Sakaki Y. Sumimoto H. J. Biol. Chem. 2001; 276: 1417-1423Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar). In contrast, the colon-specific oxidase, Nox1, appears to be a low-activity enzyme when ectopically expressed (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar). Nox1 exhibits functional similarities to the phagocyte oxidase, as it restores differentiation- and activation-dependent superoxide production when transduced into gp91phox-deficient myeloid cell models, indicative of a capacity to cross talk with other phox components. 1Geiszt, M., Lekstrom, K., Brenner, S., Hewitt, S. M., Dana, R., Malech, H. L. and Leto, T. L. (2003) J. Immunol., in press. Furthermore, co-expression of two cytosolic phox components, p47phox and p67phox, augments Nox1 activity in an activation-dependent manner. These observations demonstrate a significant level of functional homology (cofactor-dependence and regulated superoxide production) between Nox1 and its closest relative, gp91phox, raising the interesting possibility that Nox1 may function as a multi-component, phox-like oxidase in differentiated colon cells. Based on these findings, we searched for candidate phox-like proteins as potential functional partners of Nox1. Here we identify two novel proteins that have significant structural homology to p47phox and p67phox and that are capable of supporting Nox1 activity. Sequence Analysis—We performed initial data base searches in the non-redundant peptide sequence data base of GenBankTM using the protein sequences of p47phox and p67phox as query sequences. The following IMAGE clones were identified and obtained from Research Genetics: the human p41 cDNA (4661469), the mouse p41 cDNA (6399072), the mouse p51 cDNA (4988389), and the human p51 cDNA (5197877). The full coding sequence for human p51 cDNA was amplified from human kidney cDNA using Advantage 2 polymerase (Clontech) and primers designed from IMAGE clone 5197877 (5′ primer: ATGGCCTCTCTGGGGGACCT; 3′ primer: GCATCATTAGGGCTGATCTCCCTG). We conducted additional nucleotide BLAST searches in the data base of expressed sequence tags (dbEST) to identify other homologous EST entries, verifying the results of direct sequence analysis. Northern Blot and in Situ Hybridization—For the human p41 mRNA detection, human multiple-tissue (2 of and gastrointestinal of Northern (Clontech) were at with a p41 cDNA following hybridization of the mouse p51 mouse multiple Northern containing 2 of (Clontech) were with a p51 cDNA the of was from cells on a and to were at with a human Nox1 cDNA by hybridization in situ hybridization on mouse colon mouse p41 and p51 were as transcripts or were by or using The of mouse colon was performed to the at from were with and were using a to with of the and and expression the coding sequence of human Nox1, and p51 were into NIH-3T3 and cells were in containing and of Nox1-expressing NIH-3T3 cell were transfected at with or the using the and of were with (2 and were In expression cells and were transfected with or the of the two using the cells gp91phox were using as F. S. N. Gallin J.I. Malech H.L. PubMed Google and were transfected with the human and by T.L. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). Superoxide production by transfected cells was In using or significant on oxidant by these cells. of Superoxide production by and cells was by using a cells were and in with and were performed in at a of using a The from these to for the in were to be to superoxide the BLAST we identified a novel protein sequence in the non-redundant protein data base of GenBankTM by the that showed significant homology to p47phox Based on its we this protein p41 molecular of BLAST of the using the p41 nucleotide sequence as a that the is on The IMAGE clone was obtained and the a protein with sequence and sequence to human p47phox full coding sequence homologous to the human cDNA was identified by a in the data base of expressed sequence tags the mouse protein with the human the homology between p47phox and p41 is p41 structural similarities with its phagocytic contains an amino-terminal by two The protein also a carboxyl-terminal proline-rich sequence that serve as a SH3 The homologous proline-rich the of p47phox was to with the carboxyl-terminal SH3 of p67phox T.L. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar, H. Y. H. H. T. Y. M. S. K. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). from these are several between these p47phox contains several a carboxyl-terminal that were identified as that of the phagocytic NAD(P)H oxidase complex J. B. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). of these and their sequences are in The of p47phox contains a at that is conserved in several other sequences and was proposed to in an with the carboxyl-terminal SH3 of p47phox H. T. T. Sumimoto H. D. Biol. 2001; Scopus Google Scholar). The sequence is in the p41 domain. In Northern p41 mRNA was detected as a signal in the colon and the small In other that a human gastrointestinal mRNA the p41 transcript was detected in the the and the and this was with a a similar expression was in that Nox1 is expressed in the epithelial cells of the mouse situ hybridization with mouse colon that p41 mRNA is also epithelial cells of the colon the between Nox1 and we expressed p41 in a cell that was transduced for Nox1 The co-expression of p41 and Nox1 in any in superoxide production in these cells. In other we p67phox, and Nox1 in cells and a small in superoxide output The of p41 on the activity of Nox1 to for proteins homologous to p67phox that with the p67phox protein sequence as a query sequence to the non-redundant peptide sequence data base in we identified a sequence homologous to the carboxyl-terminal of p67phox that was as a human colon recognized by in colon B. J.D. U. M. J. PubMed Scopus Google Scholar). homology searches with the sequence identified mouse IMAGE and human EST clones IMAGE with more homology with p67phox. The mouse EST clone was obtained and The into a protein with and to p67phox The human EST appears to contain an sequence that was in any other sequence in The of the human sequence was amplified from kidney cDNA using primers from IMAGE clone This cDNA other EST sequences and into a protein with sequence and sequence to human p67phox. The mouse and human p51 protein sequences are We this protein p51, based on the molecular of the human p67phox These proteins the structural with in p67phox to be in with other phox components this four amino-terminal tetratrico-peptide tetratrico-peptide that with a carboxyl-terminal SH3 that with p47phox, and a sequence homologous to the activation of p67phox that in activation of the phox system T. Lambeth J.D. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). the human and proteins sequences homologous to the SH3 of p67phox. p51 additional sequences of human its PB1 also appears to be its homology to the PB1 of p67phox was detected in BLAST The expression of p51 was by Northern of several mouse tissues. with the expression of the p51 mRNA was more detected in various tissues. The p51 transcript was detected in mouse small and tissues Nox1 expression been (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar, S. H. T. K. K. J. 2000; PubMed Google also in and In situ hybridization on mouse colon an expression that is from that of suggesting that the two proteins with Nox1 in colon epithelial cells We also detected the p51 mRNA in the human colon by Northern and kidney and were also for the human p51 mRNA the human colon levels of Nox1 and p41 the expression level of p51 was suggesting that this may be a in activation of the colon oxidase. their with Nox1, we transfected p41 and p51 in colon epithelial cells, which express the Nox1 mRNA (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google in p41 p51 significant superoxide production when expressed however, we a significant in superoxide production when both proteins were in these Nox1-expressing cells. The of superoxide in these cells was on In other we p41 and p51 into NIH-3T3 that were transfected with the human Nox1 cDNA The co-expression of p41 and p51 in significantly enhanced superoxide similar to that in cells, the activity in NIH-3T3 cells was on These that p41 and p51 with Nox1 to a functional NAD(P)H oxidase We also p41 and p51 in with their phagocytic p47phox and p67phox, to these homologous proteins also support Nox1 activity. lower levels of oxidase activity were when the colon were in with the phox proteins, or when both cytosolic phox proteins were expressed in of p41 and p51 These with the expression that p41 and p51 are functional partners of Nox1 in colon epithelial cells that an colon oxidase. were also conducted to p41 and p51 support the activity of this p41 and p51 or their phagocytic were in cells that were transduced for gp91phox that co-expression of p47phox and p67phox levels of oxidase activity in these cells. In contrast, the by p41 and p51 or as with the phox were significantly lower than the phox indicative of a functional between the human colon and phagocytic oxidase In the activity of gp91phox in these cells was on oxygen production by phagocytic cells a well role in the of of the The multi-component of the phox system several for the tight of oxidant production by which is essential for the of In the two several homologues of gp91phox, the catalytic core of the phagocytic oxidase, have been due in to the of sequence (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar, 4Geiszt M. Kopp J.B. Varnai P. Leto T.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8010-8014Crossref PubMed Scopus (730) Google Scholar, 5Dupuy C. Ohayon R. Valent A. Noel-Hudson M.S. Deme D. Virion A. J. Biol. Chem. 1999; 274: 37265-37269Abstract Full Text Full Text PDF PubMed Scopus (385) Google Scholar, 6De Deken X. Wang D. Many M.C. Costagliola S. Libert F. Vassart G. Dumont J.E. Miot F. J. Biol. Chem. 2000; 275: 23227-23233Abstract Full Text Full Text PDF PubMed Scopus (517) Google Scholar, 7Shiose A. Kuroda J. Tsuruya K. Hirai M. Hirakata H. Naito S. Hattori M. Sakaki Y. Sumimoto H. J. Biol. Chem. 2001; 276: 1417-1423Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar, 8Banfi B. Molnar G. Maturana A. Steger K. Hegedus B. Demaurex N. Krause K.H. J. Biol. Chem. 2001; 276: 37594-37601Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar). These known as of the family of NAD(P)H contain conserved structural for the of from the the to molecular These carboxyl-terminal sequence in of and NAD(P)H and four conserved that two M.C. J. Biol. Chem. 2001; 276: Full Text Full Text PDF PubMed Scopus Google Scholar). These phox homologues are proposed to serve as hormone biosynthesis, oxygen sensing, and (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar, 4Geiszt M. Kopp J.B. Varnai P. Leto T.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8010-8014Crossref PubMed Scopus (730) Google Scholar, 5Dupuy C. Ohayon R. Valent A. Noel-Hudson M.S. Deme D. Virion A. J. Biol. Chem. 1999; 274: 37265-37269Abstract Full Text Full Text PDF PubMed Scopus (385) Google Scholar, 6De Deken X. Wang D. Many M.C. Costagliola S. Libert F. Vassart G. Dumont J.E. Miot F. J. Biol. Chem. 2000; 275: 23227-23233Abstract Full Text Full Text PDF PubMed Scopus (517) Google Scholar, 7Shiose A. Kuroda J. Tsuruya K. Hirai M. Hirakata H. Naito S. Hattori M. Sakaki Y. Sumimoto H. J. Biol. Chem. 2001; 276: 1417-1423Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar, 8Banfi B. Molnar G. Maturana A. Steger K. Hegedus B. Demaurex N. Krause K.H. J. Biol. Chem. 2001; 276: 37594-37601Abstract Full Text Full Text PDF PubMed Scopus (509) Google Scholar). The homologue to be Nox1, is a colon-specific oxidase that was in the of cell (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar, T. Lambeth J.D. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, R.S. Shi J. R. S. Lambeth J.D. Proc. Natl. Acad. Sci. U. S. A. 2001; PubMed Scopus Google Scholar). The of a novel of reactive oxygen in the colon is an as reactive oxygen production in this have in the of inflammatory disease and colon Nox1 cell when ectopically expressed in NIH-3T3 and these cells in (3Suh Y.A. Arnold R.S. Lassegue B. Shi J. Xu X. Sorescu D. Chung A.B. Griendling K.K. Lambeth J.D. Nature (Lond.). 1999; 401: 79-82Crossref PubMed Scopus (1299) Google Scholar, R.S. Shi J. R. S. Lambeth J.D. Proc. Natl. Acad. Sci. U. S. A. 2001; PubMed Scopus Google Scholar). The that Nox1 is a constitutively enzyme with superoxide In contrast, we obtained that Nox1 with cytosolic components of the phagocytic oxidase when expressed in gp91phox-deficient cells and cells. the Nox1 function as a regulated and activated oxidase The functional between Nox1, p47phox, and p67phox suggest similarities between the phagocyte and colon This to for colon-specific homologues of p47phox and p67phox. In this we identified and characterized two proteins, p41 and p51, that have homology to the p47phox and p67phox cytosolic components of the phagocytic oxidase and that appear to support the activity of Nox1. this was in B. Steger K. Krause K.H. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google also the homologues of these proteins, which were as and for Nox and Nox p41 exhibits significant structural to p47phox in of and conserved we several between the two proteins that have functional The absence of conserved in the of p41 that protein of this protein a role in the of p41 suggest that p47phox in an resting T.L. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar, H. Y. H. H. T. Y. M. S. K. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar, H. T. T. Sumimoto H. D. Biol. 2001; Scopus Google Scholar, A. Sumimoto H. J. Biol. Chem. 2000; 275: Full Text Full Text PDF PubMed Scopus Google and that this is between the SH3 and the amino-terminal and the carboxyl-terminal domain. been proposed that on the carboxyl-terminal phagocyte these p47phox and SH3 with the proline-rich of T.L. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar, H. Y. H. H. T. Y. M. S. K. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar). structural between p47phox and p41 suggest that an SH3 is by the in the of several proteins is in and of the phosphorylated in the carboxyl-terminal as well as sequences the of p47phox are sequence homologous to p47phox to be in with p67phox and the flavocytochrome J. Biol. Chem. Full Text Full Text PDF Scopus Google Scholar, J.B. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google is in the carboxyl-terminal of human p41 These observations suggest that p41 an resting and that of p41 is by other expressed with p67phox in cells, we a of p41 on superoxide This with proteins from the two oxidase to the for colon-specific homologues of p67phox. the sequence about a we were to identify both mouse and human homologues of p67phox. to p67phox, p51 contains four amino-terminal and a carboxyl-terminal SH3 by a PB1 domain. p67phox homologues also contain a of conserved following the repeats, which is homologous to the activation in p67phox T. Lambeth J.D. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar, Y. S. Lambeth J.D. J. Biol. Chem. 1999; 274: Full Text Full Text PDF PubMed Scopus Google to with the flavocytochrome b558 p67phox contains SH3 between and which is in human or T.L. Proc. Natl. Acad. Sci. U. S. A. PubMed Scopus Google Scholar, P. Y. J. C. P. S. J. Biol. Chem. Full Text PDF PubMed Google Scholar, K. D. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google on protein of p67phox about the protein partners of the carboxyl-terminal SH3 been to with the carboxyl-terminal proline-rich of the structural for this are well conserved in p51 and it is that a similar between these proteins and that the two in a Furthermore, the of amino-terminal in p51 that this protein with as in p67phox H. H. H. K. F. Sumimoto H. J. Biol. Chem. 1999; 274: Full Text Full Text PDF PubMed Scopus Google Scholar, K. K. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar). The of PB1 in human and mouse p51 that proteins containing the be partners of The mouse p51 sequence PB1 domain, however, is conserved and human p51 sequences homologous to the p67phox that was to be for its with the of suggesting that is a of the colon oxidase. we significant structural in the sequences of human and mouse p51 and p67phox. p51 sequence is an of these sequences with the as B. Steger K. Krause K.H. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google the expression and with the human p41 and p51 suggest that these proteins are to function in with Nox1 in colon epithelial cells. These proteins levels of activity in colon epithelial cells, as was when the were heterologously expressed in cells B. Steger K. Krause K.H. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). In to the proteins, however, we in Nox1-expressing NIH-3T3 cells or that the activity by the human proteins is significantly enhanced by these in in these proteins and the of differentiated colon epithelial cells this oxidase constitutively Our the of co-expression of colon and phagocytic components that the human proteins are capable of as than the proteins B. Steger K. Krause K.H. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). the proteins were characterized in a it is that in cell factors may in for this is to that the significant structural in these proteins for this apparent functional between the phox and Nox1 in both p41 and p51 are expressed in mouse and human we also detected p51 mRNA in several other tissues and that it support the activity of other oxidases. In this it is that p51 is expressed in the thyroid the and the are (5Dupuy C. Ohayon R. Valent A. Noel-Hudson M.S. Deme D. Virion A. J. Biol. Chem. 1999; 274: 37265-37269Abstract Full Text Full Text PDF PubMed Scopus (385) Google Scholar, 6De Deken X. Wang D. Many M.C. Costagliola S. Libert F. Vassart G. Dumont J.E. Miot F. J. Biol. Chem. 2000; 275: 23227-23233Abstract Full Text Full Text PDF PubMed Scopus (517) Google Scholar, L. G. R. T. X. C. Lambeth J.D. J. Biol. 2001; PubMed Scopus Google M., Lekstrom, K., and Leto, T. L. (2003) in press. and in the human which is the of Nox4 expression (4Geiszt M. Kopp J.B. Varnai P. Leto T.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8010-8014Crossref PubMed Scopus (730) Google Scholar, 7Shiose A. Kuroda J. Tsuruya K. Hirai M. Hirakata H. Naito S. Hattori M. Sakaki Y. Sumimoto H. J. Biol. Chem. 2001; 276: 1417-1423Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar). The as well as the functional similarities in the of Nox1 and gp91phox by homologous components, the possibility that the colon oxidase similar as the phagocytic is well known that the colon is by a of and an effective epithelial of the This proposed role of the colon oxidase in these is an possibility that