Serine/Threonine Kinases 3pK and MAPK-activated Protein Kinase 2 Interact with the Basic Helix-Loop-Helix Transcription Factor E47 and Repress Its Transcriptional Activity

Abstract

In the search for physiological substrates of MAPK-activated protein (MAPKAP) kinases, we identified the basic helix-loop-helix (bHLH) transcription factor E47 as an interaction partner of chromosome 3p kinase (3pK) and MAPKAP-K2 (MK2). The E2A protein E47 is known to be involved in the regulation of tissue-specific gene expression and cell differentiation. E47 is a phosphoprotein, and we identified 3pK and MK2 as E47 kinases in vitro. Furthermore, the expression of either kinase results in a repression of the transcriptional activity of E47 on an E-box containing promoter. In summary, the MAPK-activated protein kinases 3pK and MK2 were identified to form an assembly with the bHLH protein E47 suggesting that these kinases are regulators of E47 activity and E47-dependent gene expression. In the search for physiological substrates of MAPK-activated protein (MAPKAP) kinases, we identified the basic helix-loop-helix (bHLH) transcription factor E47 as an interaction partner of chromosome 3p kinase (3pK) and MAPKAP-K2 (MK2). The E2A protein E47 is known to be involved in the regulation of tissue-specific gene expression and cell differentiation. E47 is a phosphoprotein, and we identified 3pK and MK2 as E47 kinases in vitro. Furthermore, the expression of either kinase results in a repression of the transcriptional activity of E47 on an E-box containing promoter. In summary, the MAPK-activated protein kinases 3pK and MK2 were identified to form an assembly with the bHLH protein E47 suggesting that these kinases are regulators of E47 activity and E47-dependent gene expression. chromosome 3p kinase mitogen-activated protein kinase MAPK-activated protein kinase 2 extracellular signal-regulated kinase MAPK/ERK kinase c-Jun NH2-terminal kinase/stress-activated protein kinase helix-loop-helix basic HLH protein small heat shock protein cAMP-responsive element binding factor serum response factor myocyte enhancer factor protein kinase A casein kinase II glutathione S-transferase green fluorescence protein fetal calf serum Triton-lysis buffer radioimmune precipitation buffer 2-(N-morpholino)ethanesulfonic acid 12-O-tetradecanoylphorbol-13-acetate β-galactosidase polyacrylamide gel electrophoresis four E-boxes Chromosome 3p kinase(3pK)1 (21.Sithanandam G. Latif F. Duh F.M. Bernal R. Smola U. Li H. Kuzmin I. Wixler V. Geil L. Shrestha S. Mol. Cell. Biol. 1996; 16: 868-876Crossref PubMed Scopus (86) Google Scholar) and MK2 belong to a family of serine/threonine kinases that are activated by members of the mitogen-activated protein kinase (MAPK) family. 3pK, also known as MAPKAP kinase 3 (1.McLaughlin M.M. Kumar S. McDonnell P.C. Van Horn S. Lee J.C. Livi G.P. Young P.R. J. Biol. Chem. 1996; 271: 8488-8492Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar) is unique in that it was shown to be activated by mitogenic inducers such as serum/TPA through the Raf/MEK/ERK cascade as well as by stress-inducing agents that are activators of stress-induced MAPK cascades, thereby leading to the phosphorylation of 3pK by either JNK/SAPK or p38 (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). Thus, the kinase is targeted by the corresponding cascade depending on the extracellular stimulus (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). Although the upstream activation pathways of 3pK are well documented, little is known about its downstream effectors. A close homologue of 3pK, MK2, is involved in stress response mediated through p38. Among the substrates of MK2 are the small heat shock proteins (Hsp27/25) (3.Rouse J. Cohen P. Trigon S. Morange M. Alonso-Llamazares A. Zamanillo D. Hunt T. Nebreda A.R. Cell. 1994; 78: 1027-1037Abstract Full Text PDF PubMed Scopus (1498) Google Scholar, 4.Engel K. Ahlers A. Brach M.A. Herrmann F. Gaestel M. J. Cell. Biochem. 1995; 57: 321-330Crossref PubMed Scopus (54) Google Scholar) and transcription factors such as CREB (5.Tan Y. Rouse J. Zhang A. Cariati S. Cohen P. Comb M.J. EMBO J. 1996; 15: 4629-4642Crossref PubMed Scopus (565) Google Scholar) and SRF (6.Heidenreich O. Neininger A. Schratt G. Zinck R. Cahill M.A. Engel K. Kotlyarov A. Kraft R. Kostka S. Gaestel M. Nordheim A. J. Biol. Chem. 1999; 274: 14434-14443Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). The basic helix-loop-helix (bHLH) transcription factors E12 and E47 are encoded by the E2A gene and are generated by differential splicing of E12- and E47-specific bHLH-encoding exons (7.Murre C. McCaw P.S. Baltimore D. Cell. 1989; 56: 777-783Abstract Full Text PDF PubMed Scopus (1846) Google Scholar, 8.Sun X.H. Baltimore D. Cell. 1991; 64: 459-470Abstract Full Text PDF PubMed Scopus (317) Google Scholar). These E-proteins are characterized by their ability to bind to the consensus DNA sequence CANNTG, referred to as E-box, either as homodimers in B-cells or as heterodimers with tissue-specific Class II HLH proteins in other cell types (9.Murre C. McCaw P.S. Vaessin H. Caudy M. Jan L.Y. Jan Y.N. Cabrera C.V. Buskin J.N. Hauschka S.D. Lassar A.B. et al.Cell. 1989; 58: 537-544Abstract Full Text PDF PubMed Scopus (1298) Google Scholar, 10.Lassar A.B. Davis R.L. Wright W.E. Kadesch T. Murre C. Voronova A. Baltimore D. Weintraub H. Cell. 1991; 66: 305-315Abstract Full Text PDF PubMed Scopus (686) Google Scholar). Initially identified in B-cells as immunoglobulin enhancer-binding proteins, the E2A gene products classified as Class I HLH proteins are also involved in cell differentiation, lineage commitment, and the expression of many tissue-specific genes (11.Murre C. Bain G. van Dijk M.A. Engel I. Furnari B.A. Massari M.E. Matthews J.R. Quong M.W. Rivera R.R. Stuiver M.H. Biochim. Biophys. Acta. 1994; 1218: 129-135Crossref PubMed Scopus (407) Google Scholar). Through phosphorylation, DNA binding and transactivation of a variety of transcription factors are regulated (12.Karin M. Curr. Opin. Cell Biol. 1994; 6: 415-424Crossref PubMed Scopus (359) Google Scholar). For example, the dimerization of myogenin with E2A products was shown to enhance phosphorylation of myogenin, thereby reducing the transcriptional activity of myogenin, suggesting that phosphorylation of this myocyte enhancer factor (MEF) negatively interferes with muscle-specific gene expression (13.Zhou J. Olson E.N. Mol. Cell. Biol. 1994; 14: 6232-6243Crossref PubMed Scopus (30) Google Scholar). The DNA-binding activity of MyoD homodimers but not MyoD-E12 heterodimers was inhibited by phosphorylation (14.Mitsui K. Shirakata M. Paterson B.M. J. Biol. Chem. 1993; 268: 24415-24420Abstract Full Text PDF PubMed Google Scholar). Johnson et al. (16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar) demonstrated that overexpression of casein kinase II (CKII) increased the transcriptional activities of MRF4 and MyoD in vivo via a mechanism involving phosphorylation of its binding partner, E47. A direct effect of E47 phosphorylation was reported by Sloan et al. (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar), providing evidence that phosphorylation hinders binding of E47 homodimers but allows E47 heterodimer binding. This suggests a differential regulation of the E-protein in B-cellversus non-B-cell-specific gene regulation. E47 contains more than 100 potential phosphorylation sites and is known to be phosphorylated in many cell types. However, there is only limited information with regard to E47 kinases. So far, CKII and PKA have been described to phosphorylate E47 in vitro (16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar, 17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar, 18.Shen C.P. Kadesch T. Mol. Cell. Biol. 1995; 15: 4518-4524Crossref PubMed Scopus (160) Google Scholar). In the present study, we show that 3pK and MK2 interact with E47in vivo and are able to phosphorylate E47 in vitro. Furthermore, the expression of 3pK or MK2 results in repression of E47-induced transcriptional activity, suggesting a role for these kinases in the regulation of this transcription factor. Plasmids expressing 3pK wild type, the ATP-binding site mutant 3pK K73M (3pK KM), and the constitutively active mutant 3pK TT201/313EE (3pK TTEE) in bacteria and eukaryotic cells as a GST fusion protein were cloned as described recently (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). A GFP-tagged version of 3pK was cloned in the pRSPA vector background. A GFP-tagged version of MK2 was kindly provided by M. Gaestel (Halle, Germany). pcDNA3HA-3pK was generated by inserting theNheI-SpeI fragment of pPC97-3pK into pcDNA3HA. The BamHI insert of pGEX KG-3pK was ligated in the yeast two-hybrid vector pAS2.1 (CLONTECH) to produce pAS2.1-3pK KM. pGAD10-E47 (amino acids 1–494) was constructed by ligating the 5′ 1492-base pair NotI fragment of pGAD10-E47 into pGAD10. The 3′ 912-base pair XhoI fragment was inserted in pGAD10 to create pGAD10-E47 (amino acids 372–651). For pGAD10-E47 (amino acids 18–229), the original pGAD10-E47 was cut with SacI and religated. 5′-cgcgtacacctgctgcctcccaacacctgctgcctcccaacacctgctgcctcccaacacctgcc-3′ and 5′-tcgaggcaggtgttgggaggcagcaggtgttgggaggcagcaggtgttgggaggca gcaggtgat-3′ primers (E-boxes are underlined) containing four E-box sequences were annealed and cloned into the MluI andXhoI sites of the pGL3 promoter vector (Promega). The yeast two-hybrid screen was performed using a human heart MATCHMAKER cDNA library cloned into pGAD10 (CLONTECH). Yeast strain Y190 was manipulated according the MATCHMAKER Library User Manual (CLONTECH). A sequential transformation protocol was used with pAS2.1-3pK KM as bait. Positive clones were identified by growth on SD/−TRP/−LEU/−HIS/+25 mm3-amino-1,2,4-triazole (Sigma) plates and activity of thelacZ reporter gene in filter assays. DNA sequence analysis showed that 1 colony of 128 β-Gal-positive colonies contained a human full-length E47 cDNA. Direct two-hybrid tests with the interaction partner and pAS2.1-3pK KM were performed according to standard protocols. The human embryonic kidney cell line HEK293 and COS7 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal calf serum (FCS) at 37 °C in humidified air with 6% CO2. Production of rabbit anti-glutathioneS-transferase (GST) antiserum was described earlier (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). An anti-GST monoclonal antibody was kindly provided by S. Feller (Würzburg, Germany). Polyclonal rabbit anti-E47 IgG (sc-763 X) was purchased from Santa Cruz Biotechnology. HA-tagged proteins were detected with a monoclonal anti-HA antibody (12CA5). Cells were transfected by a calcium phosphate coprecipitation method according to a modified Stratagene protocol (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). HEK293 cells were starved in Dulbecco's modified Eagle's medium with 0.3% (v/v) FCS for 48 h after transfection. For activation of 3pK or MK2, HEK293 cells were stimulated with 0.5 mm sodiummeta-arsenite (Sigma) for 30 min prior to harvesting. Transfected HEK293 cells were lysed in Triton lysis buffer (TLB) (20 mm Tris, pH 7.4, 50 mm sodium β-glycerophosphate, 20 mm sodium pyrophosphate, 137 mm NaCl, 10% (v/v) glycerol, 1% (v/v) Triton X-100, 2 mm EDTA, and an inhibitor mix containing 1 mm Pefabloc, 1 mmsodium orthovanadate, 5 mm benzamidine, 5 μg/ml aprotinin, 5 μg/ml leupeptin) on ice for 10 min. Cell debris was removed by centrifugation, and supernatants were incubated with different antisera for 2 h at 4 °C. The immune complexes were precipitated with 25 μl of protein A-agarose and washed extensively with TLB. For in vitro coprecipitation experiments, 15 μg of recombinant GST-E47 were synthesized according to the manufacturer's manual (Amersham Pharmacia Biotech) and bound to glutathione-Sepharose 4B. These complexes were added to precleared TLB lysates (500 μg of total protein) of transfected or untransfected HEK293 cells, incubated for 6–12 h, and washed twice either with high salt TLB (0.5m NaCl) or with RIPA (25 mm Tris, pH 8, 137 mm NaCl, 10% (v/v) glycerol, 0.1% SDS, 0.5% sodium deoxycholate, 1% Nonidet P-40, 2 mm EDTA, pH 8, supplemented with inhibitors). After resuspension in Laemmli buffer and SDS-PAGE, proteins were detected by immunoblot. COS7 cells were fixed with 3.7% paraformaldehyde (in phosphate-buffered saline) for 20 min at room temperature, washed, and then incubated with ice cold acetone for 7 min at −20 °C. After being blocked with 10% FCS for 20 min at 37 °C, cells were incubated with either a mouse monoclonal antibody to GST or with the anti-E47 antiserum at 1 μg/ml for 30 min at 37 °C. Cells were washed and blocked again with FCS for 20 min at 37 °C. Cells were incubated with a Texas Red-labeled anti-rabbit IgG or a fluorescein isothiocyanate-labeled anti-mouse IgG antiserum in a 1:200 dilution (Dako) for 30 min at 37 °C, washed, and mounted with Moviol (Aldrich) in Glycerol/H20 supplemented with 2.5% diazabicyclo[2.2.2]octane (Merck). In vitro kinase assays with bacterially expressed 3pK and GST-E47 were performed with equal amounts (1.6 μg) of active 3pK or inactive 3pK and 10 μg Sepharose-bound GST-E47 as a substrate added to the kinase buffer (10 mm MgCl2, 25 mmβ-glycerophosphate, 25 mm HEPES, pH 7.5, 5 mmbenzamidine, 0.5 mm dithiothreitol, 1 mm sodium vanadate). Immunoprecipitated versions of tagged HA-3pK, HA-MK2, or E47 were combined and washed twice in RIPA buffer supplemented with 0.5m NaCl before being subjected to the kinase buffer. The kinase assays (30 min) were performed at 30 °C with 5 μCi of [γ32P]ATP (Amersham Pharmacia Biotech) and 0.1 mm ATP. 24 h after transfection, COS7 cells were harvested in 100 μl of lysis buffer (50 mm Na-MES, pH 7.8, 50 mm Tris-HCl, pH 7.8, 10 mmdithiothreitol, and 2% Triton X-100). 50 μl of precleared cell extracts were added to 50 μl of luciferase assay buffer (125 mm Na-MES, pH 7.8, 125 mm Tris-HCl, pH 7.8, 25 mm magnesium acetate, and 2 mg/ml ATP). Immediately after the injection of 50 μl of 1 mm D-luciferin (AppliChem), luminescence was measured for 5 s in a luminometer (Berthold). The luciferase activities were normalized on the β-galactosidase activity of cotransfected β-Gal vector. The β-galactosidase assay was performed with 20 μl of precleared cell lysate according to a standard protocol (19.Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Mean values and standard deviations from three independent experiments are shown. To unravel the unknown physiological function of 3pK, we searched for binding partners in a yeast two-hybrid screen. The only in vitro and in vivo substrate for 3pK identified to date is the small heat shock protein Hsp27. Hsp27 phosphorylation to be mediated by 3pK and MK2 J. F. S. J. J. Cell Biol. PubMed Scopus Google Scholar). kinases are in the of cells and K. Kotlyarov A. Gaestel M. EMBO J. PubMed Scopus Google Scholar), 3pK and MK2 also have MK2 was shown to phosphorylate the transcription factors CREB as well as SRF (5.Tan Y. Rouse J. Zhang A. Cariati S. Cohen P. Comb M.J. EMBO J. 1996; 15: 4629-4642Crossref PubMed Scopus (565) Google Scholar, O. Neininger A. Schratt G. Zinck R. Cahill M.A. Engel K. Kotlyarov A. Kraft R. Kostka S. Gaestel M. Nordheim A. J. Biol. Chem. 1999; 274: 14434-14443Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar) and to their transcriptional 3pK is also able to phosphorylate vitro and to interact with proteins in S. and U. R. used a human heart cDNA library and a kinase inactive version of 3pK as a 3pK to the transactivation of the reporter recently been demonstrated that of a by in the ATP-binding site of a kinase allows a more binding with its leading to a transcriptional activation of the two-hybrid reporter gene G. J. Biol. Chem. 1995; Full Text Full Text PDF PubMed Scopus Google Scholar). In the two-hybrid we the full-length human basic helix-loop-helix transcription factor E47 to be a 3pK interaction partner To the of E47 that 3pK, we cloned of E47 for direct two-hybrid tests of acids of the the and the basic helix-loop-helix the suggesting that this is for the binding of E47 to The of acids containing the activation not the a of E47 to acid binding. This that in to the transactivation and the in the an is also for binding to To the two-hybrid we performed experiments as well as Transfected E47 with proteins were in the 2 2 and 2 that and GFP-tagged versions of 3pK and MK2 are in the of transfected COS7 cells and GFP-tagged kinases with E47. is that GST fusion kinase activity of 3pK S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google and not These experiments that 3pK and E47 interact in yeast as well as in MK2 also with E47. E47 or GST was bound to glutathione-Sepharose and added to precleared HEK293 lysates containing either HA-3pK, HA-MK2, or After the the were washed twice either salt or high and then subjected to 3pK and MK2 were with GST-E47 2 and but not GST was bound to the or lysates of untransfected cells were used Thus, 3pK and MK2 in their ability to bind to E47 a high binding of the kinases to E47. E47 is vivo at different sites in many cell types (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google C.P. Kadesch T. Mol. Cell. Biol. 1995; 15: 4518-4524Crossref PubMed Scopus (160) Google there is only limited information about the of these E47 kinases. bHLH proteins, potential PKA and CKII phosphorylation have been in in vitro kinase phosphorylation (14.Mitsui K. Shirakata M. Paterson B.M. J. Biol. Chem. 1993; 268: 24415-24420Abstract Full Text PDF PubMed Google S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar, S. Y. Konieczny S.F. Mol. Cell. Biol. 1993; PubMed Scopus Google Scholar). of the PKA substrates such as the transcription factor CREB are also phosphorylated by MAPKAP kinases at the that these kinases have sequence performed in vitro kinase assays to 3pK and MK2 are able to phosphorylate E47. HA-3pK, HA-MK2, or E47 were transfected in HEK293 cells, washed, and prior to the kinase 4 a of activated 3pK and MK2, cells were stimulated with in a activation of kinases, as shown by In the of active kinases, E47 was phosphorylated 4 3 and the 3pK kinases for this phosphorylation, we also used bacterially expressed and proteins for the experiments shown in 4 B. A GST fusion protein of E47 was incubated with active or inactive recombinant 3pK 4 In the of the active GST-E47 is the inactive version to phosphorylate E47. The that the GST is not a These results the ability of the MAPKAP kinases 3pK and MK2 to phosphorylate E47 in vitro. The E47 acid sequence four potential consensus for phosphorylation by MAPKAP kinases, three in the and at phosphorylated not in B-cells but in cells (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar). of in with in close to the basic DNA-binding was to DNA binding of E47 E47 allows DNA binding of homodimers as it in B-cells (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar). results were for phosphorylation regulated DNA binding of homodimers 6: PubMed Scopus Google Scholar), suggesting that phosphate is an in the regulation of bHLH transcription been that the in close to the basic DNA-binding the of homodimers with DNA (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar). The and interaction of the MAPKAP kinases with E47 that the kinases are involved in the regulation of the transcriptional activity of the bHLH activity of E47 was using a four E-box promoter gene that is activated in the of the transcription factor that of 3pK and MK2 the transcriptional activity of E47 on the promoter and in a to in the of E47. of the kinases effect on the activity of the promoter in the of E47 not that the effect we is to a the kinases and the transcription factor. of the promoter was not amounts of were with E47 that this is for 3pK and used of the 3pK in this 3pK KM is in the of the cell and E47 from the The phosphorylation of different bHLH proteins was to be with a transcriptional activation of tissue-specific involved in cell (13.Zhou J. Olson E.N. Mol. Cell. Biol. 1994; 14: 6232-6243Crossref PubMed Scopus (30) Google Scholar, B. T. J. Biol. Chem. 1993; 268: Full Text PDF PubMed Google Scholar, S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar). This transcriptional repression is with a that overexpression of CKII results in a of E47 suggesting that CKII as a of by E-protein homodimers from binding to gene (16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar). Thus, by binding MAPKAP kinases also E47 thereby reducing In summary, we that 3pK and MK2 are E47 kinases and that bind to the bHLH transcription factor with high and its transcriptional These the E47 function to the MAPK and that the MAPK-activated protein kinases are regulators of gene expression and differentiation.