Biochemistry · 1987 · 112 citations · 42 references
Molecular BiologyEscherichia ColiSolution StructureProtein FoldingGlycosidic Torsion AnglesBiophysicsBiochemistryBiomolecular AnalysisOligonucleotideDna ReplicationConformational StudyMolecular MicrobiologySolution Nmr SpectroscopyStructural BiologyNatural SciencesTrp OperatorProtein NmrMicrobiologyMedicine
We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli. The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined). Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular. Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined. Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles). The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence. All these parameters were determined for each step along the 20-mer. The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step. Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson [Calladine, C. R., & Dickerson, R. E. (1983) J. Mol. Biol. 166, 419-441]. The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations. Glycosidic torsion angles obtained for purines are larger than those of pyrimidines. Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences.
42
Investigation of exchange processes by two-dimensional NMR spectroscopy
J. Jeener, Beat H. Meier, P. Bachmann et al. · The Journal of Chemical Physics · 1979 · 4.7K citations
C. Altona, M. Sundaralingam · Journal of the American Chemical Society · 1973 · 796 citations
Bioorganic Chemistry, Altmetric Attention Score, Molecular Biology +16