Cloning and Characterization of Liver-specific Isoform of Chk1 Gene from Rat

Abstract

We have isolated and characterized an isoform of protein kinase Chk1 gene from rat liver and a rat liver cDNA library by 5′-rapid amplification of cDNA ends. The gene (Cil) contains the C-terminal region of the Chk1 gene, but the 5′-end is derived from a sequence in the intron of Chk1preceding the C-terminal domain by differential RNA splicing. The kinase domain of Chk1 gene is absent in this isoform. Tissue RNA and protein blot analyses indicated that Cil was specifically expressed only in rat liver, and its expression increased with liver development. Expression of Cil was found to be reduced in three rat hepatoma cell lines examined. A promoter trap experiment suggested that a promoter was located in the intron preceding the C-terminal domain ofChk1, and transcription from this novel promoter generated the new 5′ noncoding exon of Cil. Thus Cil was generated by both alternate promoter usage and differential RNA splicing. UV irradiation induced caffeine-sensitive phosphorylation of both Chk1 and Cil at Ser-345 in Chk1 and its equivalent site in Cil, implying a role for ATR kinase in the phosphorylation of both proteins. We demonstrated the interaction between the kinase domain of Chk1 and Cil using a yeast two-hybrid assay and pull-down technique. In contrast to the effect of Chk1, Cil was found to decrease the transactivating function of p53, and the S63A mutation of Cil abolished this effect. These results suggest that Cil may serve as a dominant negative competitor of Chk1 as suggested previously. We have isolated and characterized an isoform of protein kinase Chk1 gene from rat liver and a rat liver cDNA library by 5′-rapid amplification of cDNA ends. The gene (Cil) contains the C-terminal region of the Chk1 gene, but the 5′-end is derived from a sequence in the intron of Chk1preceding the C-terminal domain by differential RNA splicing. The kinase domain of Chk1 gene is absent in this isoform. Tissue RNA and protein blot analyses indicated that Cil was specifically expressed only in rat liver, and its expression increased with liver development. Expression of Cil was found to be reduced in three rat hepatoma cell lines examined. A promoter trap experiment suggested that a promoter was located in the intron preceding the C-terminal domain ofChk1, and transcription from this novel promoter generated the new 5′ noncoding exon of Cil. Thus Cil was generated by both alternate promoter usage and differential RNA splicing. UV irradiation induced caffeine-sensitive phosphorylation of both Chk1 and Cil at Ser-345 in Chk1 and its equivalent site in Cil, implying a role for ATR kinase in the phosphorylation of both proteins. We demonstrated the interaction between the kinase domain of Chk1 and Cil using a yeast two-hybrid assay and pull-down technique. In contrast to the effect of Chk1, Cil was found to decrease the transactivating function of p53, and the S63A mutation of Cil abolished this effect. These results suggest that Cil may serve as a dominant negative competitor of Chk1 as suggested previously. rapid amplification of cDNA ends reverse transcription glutathione S-transferase Transitions in cell cycle are under the surveillance of regulatory pathways called checkpoints. One of the checkpoints is to ensure the integrity of the genome before entering mitosis (1Walworth N.C. Curr. Opin. Genet. Dev. 2001; 11: 78-82Crossref PubMed Scopus (53) Google Scholar, 2Canman C.E. Curr. Biol. 2001; 11: R121-R124Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 3Clarke D.J. Gimenez-Abian J.F. Bioessays. 2000; 22: 351-363Crossref PubMed Scopus (87) Google Scholar, 4Kitazono A. Matsumoto T. Bioessays. 1998; 20: 391-399Crossref PubMed Scopus (13) Google Scholar, 5O'Connell M.J. Walworth N.C. Carr A.M. Trends Cell Biol. 2000; 10: 296-303Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar, 6Zhou B.B. Elledge S.J. Nature. 2000; 408: 433-439Crossref PubMed Scopus (2644) Google Scholar). The mitotic cell cycle checkpoints are conserved from yeast to mammals, and the key target of this surveillance is the Cdc2-cyclin B complex that phosphorylates a number of proteins involved in mitotic processes such as proper chromosome segregation and nuclear disassembly (1Walworth N.C. Curr. Opin. Genet. Dev. 2001; 11: 78-82Crossref PubMed Scopus (53) Google Scholar, 7Curman D. Cinel B. Williams D.E. Rundle N. Block W.D. Goodarzi A.A. Hutchins J.R. Clarke P.R. Zhou B.B. Lees-Miller S.P. Andersen R.J. Roberge M. J. Biol. Chem. 2001; 276: 17914-17919Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 8Nigg E.A. Bioessays. 1995; 17: 471-480Crossref PubMed Scopus (796) Google Scholar, 9Lew D.J. Kornbluth S. Curr. Opin. Cell Biol. 1996; 8: 795-804Crossref PubMed Scopus (281) Google Scholar, 10Rhind N. Russell P. J. Cell Sci. 2000; 113: 3889-3896Crossref PubMed Google Scholar). When DNA is damaged or DNA replication is unfinished Cdc2-cyclin B is inactivated through inhibitory phosphorylation of Cdc2 by Wee1 and Myt1 kinases (5O'Connell M.J. Walworth N.C. Carr A.M. Trends Cell Biol. 2000; 10: 296-303Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar, 11Morgan D.O. Annu. Rev. Cell Dev. Biol. 1997; 13: 261-291Crossref PubMed Scopus (1809) Google Scholar, 12Ohi R. Gould K.L. Curr. Opin. Cell Biol. 1999; 11: 267-273Crossref PubMed Scopus (165) Google Scholar). The inhibition is reversed by Cdc25 after completion of DNA replication or repair by removing the inhibitory phosphorylation. One of the effector protein kinases that regulates Cdc25 is Chk1 (13Sanchez Y. Wong C. Thoma R.S. Richman R. Wu Z. Piwnica-Worms H. Elledge S.J. Science. 1997; 277: 1497-1501Crossref PubMed Scopus (1126) Google Scholar, 14Furnari B. Rhind N. Russell P. Science. 1997; 277: 1495-1497Crossref PubMed Scopus (475) Google Scholar, 15Zeng Y. Forbes K.C. Wu Z. Moreno S. Piwnica-Worms H. Enoch T. Nature. 1998; 395: 507-510Crossref PubMed Scopus (306) Google Scholar). Chk1 was first identified in fission yeast involved in cell cycle arrest when DNA was damaged (16Walworth N. Davey S. Beach D. Nature. 1993; 363: 368-371Crossref PubMed Scopus (397) Google Scholar). In mammalian cells a Chk1 homolog was shown to phosphorylate Cdc25A, -B, and -C (13Sanchez Y. Wong C. Thoma R.S. Richman R. Wu Z. Piwnica-Worms H. Elledge S.J. Science. 1997; 277: 1497-1501Crossref PubMed Scopus (1126) Google Scholar, 17Peng C.Y. Graves P.R. Thoma R.S. Wu Z. Shaw A.S. Piwnica-Worms H. Science. 1997; 277: 1501-1505Crossref PubMed Scopus (1190) Google Scholar), and this reaction promoted the binding of Cdc25 to 14-3-3 proteins (the mammalian homolog of fission yeast Rad24 and Rad25) to prevent activation of Cdc2. In addition to Cdc25, Wee1 and p53 have also been found to be phosphorylated by Chk1 when checkpoint is activated (18Lee J. Kumagai A. Dunphy W.G. Mol. Biol. Cell. 2001; 12: 551-563Crossref PubMed Scopus (216) Google Scholar, 19O'Connell M.J. Raleigh J.M. Verkade H.M. Nurse P. EMBO J. 1997; 16: 545-554Crossref PubMed Scopus (327) Google Scholar, 20Shieh S.Y. Ahn J. Tamai K. Taya Y. Prives C. Genes Dev. 2000; 14: 289-300Crossref PubMed Google Scholar). In human cells, Chk1 is expressed from S to M phase at both RNA and protein levels, and the proteins are localized in the nucleus (21Kaneko Y.S. Watanabe N. Morisaki H. Akita H. Fujimoto A. Tominaga K. Terasawa M. Tachibana A. Ikeda K. Nakanishi M. Kaneko Y. Oncogene. 1999; 18: 3673-3681Crossref PubMed Scopus (132) Google Scholar). When DNA is damaged by ionizing radiation, UV, or hydroxyurea, Chk1 is found to be phosphorylated in an ATR-dependent manner (22Zhao H. Piwnica-Worms H. Mol. Cell. Biol. 2001; 21: 4129-4139Crossref PubMed Scopus (870) Google Scholar, 23Liu Q. Guntuku S. Cui X.S. Matsuoka S. Cortez D. Tamai K. Luo G. Carattini-Rivera S. DeMayo F. Bradley A. Donehower L.A. Elledge S.J. Genes Dev. 2000; 14: 1448-1459Crossref PubMed Scopus (199) Google Scholar). However, whether the kinase activity of Chk1 is enhanced in response to DNA damage is still controversial (21Kaneko Y.S. Watanabe N. Morisaki H. Akita H. Fujimoto A. Tominaga K. Terasawa M. Tachibana A. Ikeda K. Nakanishi M. Kaneko Y. Oncogene. 1999; 18: 3673-3681Crossref PubMed Scopus (132) Google Scholar, 22Zhao H. Piwnica-Worms H. Mol. Cell. Biol. 2001; 21: 4129-4139Crossref PubMed Scopus (870) Google Scholar, 24Mailand N. Falck J. Lukas C. Syljuasen R.G. Welcker M. Bartek J. Lukas J. Science. 2000; 288: 1425-1429Crossref PubMed Scopus (655) Google Scholar, 25Yin M.B. Guo B. Vanhoefer U. Azrak R.G. Minderman H. Frank C. Wrzosek C. Slocum H.K. Rustum Y.M. Mol. Pharmacol. 2000; 57: 453-459Crossref PubMed Scopus (22) Google Scholar). Chk1 is a highly conserved gene found from yeast to mammalian cells involved in DNA damage checkpoint. Recent studies indicate that Chk1 is involved in both DNA damage and DNA replication checkpoints in mammalian cells (22Zhao H. Piwnica-Worms H. Mol. Cell. Biol. 2001; 21: 4129-4139Crossref PubMed Scopus (870) Google Scholar, 26Takai H. Tominaga K. Motoyama N. Minamishima Y.A. Nagahama H. Tsukiyama T. Ikeda K. Nakayama K. Nakanishi M. Nakayama K. Genes Dev. 2000; 14: 1439-1447PubMed Google Scholar). Chk1 protein contains a highly conserved N-terminal kinase domain linked to its less conserved C-terminal domain of unknown function through a flexible linker region (27Chen P. Luo C. Deng Y. Ryan K. Register J. Margosiak S. Tempczyk-Russell A. Nguyen B. Myers P. Lundgren K. Kan C.C. O'Connor P.M. Cell. 2000; 100: 681-692Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar). Functional analysis of kinase activity suggests that the C-terminal domain in human Chk1 may serve as a negative regulator of kinase activity (27Chen P. Luo C. Deng Y. Ryan K. Register J. Margosiak S. Tempczyk-Russell A. Nguyen B. Myers P. Lundgren K. Kan C.C. O'Connor P.M. Cell. 2000; 100: 681-692Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar). In the present report we presented evidence for the existence of a rat liver-specific Chk1 isoform (Cil forChk1 isoform in liver). This isoform was found to be transcribed using a novel promoter residing in the intron of the Chk1 gene preceding the C-terminal domain, and mature mRNA was formed by the joining of the new noncoding exon within the intron to the remaining exons of Chk1 through splicing, deleting the kinase domain of Chk1. We showed that Cil associated with the Chk1 kinase domain using yeast two-hybrid and pull-down assays and that it down-regulated p53-mediated gene transcription. Furthermore, we showed that Cil was phosphorylated at a serine residue corresponding to Ser-345 in Chk1 following UV irradiation and that mutation of this phosphorylation site eliminated its effect on p53 activity. The primers used were as follows: 2-6-1, GTGTTTCGGCATAATAATCGT; 2-6-3, GAAGCAAAGCCAGAGGAGCAGAATC; 2-6-15, TTTCTTCACTGGAACCAC; 2-6-31, ATAACTCACAGGGATATTAAACCAG; Cil-2, GTAAACTTGAGAAGGAAGCA; Cil-5, TTGGGGGTTGGGATTTCAGT; Chk1 g-05, GTGTCTGCAGAAGGACCCAA; Chk1 g-06, GAGACTGCAGAAGAGAGAGTTG; Chk1 g-16, GCAGCTGCAGTTGTCCTCTTCAACTGA; Chk1 g-19, CAGTCTGCAGTGGAGTTGC; Chk1 g-20, TCCTTCTGCAGACACTAAAGAGTC; Chk1 g-21, AGGGCCTGCAGTCCAACCAG; Chk1 g-22, AGAACTGCAGAGCTCGTTTGGAGAC; Chk1 g-29, GGGTAAGCTTGCGTAATCATGAGAA; Chk1 g-30, GAGAAAGCTTAAGAGAGAGTTG. Rat hepatoma cell line FAA-HTC1 (JCRB 0249) was grown in Williams' medium E supplemented with 10% fetal bovine serum and 100 μg/ml penicillin and streptomycin. The H-4-II-E cell line obtained from Culture Collection and Research Center (CCRC 60209) was cultured in minimum Eagle's medium supplemented with Earle's balanced salt solution with 0.1 mm nonessential amino acids, 10% fetal bovine serum, and 10% calf serum. The MH1C1 (CCRC 60143) cell line was cultured in Ham's F-10 medium, 15% horse serum, and 2.5% fetal bovine serum. Hep3B cells (p53-negative human hepatoma cells) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Cells were transfected using LipofectAMINETM (Invitrogen) according to the instructions of the manufacturer. Briefly, cells were grown to 50% confluence in 60-mm dishes. Plasmids and LipofectAMINE were separately diluted in serum-free medium to 300 μl, mixed, and incubated at room temperature for 1 h. DNA-lipid complexes were diluted with 2.4 ml of serum-free medium. Cells were washed twice with and with the diluted DNA-lipid We used and cDNA from to the Cil cDNA from rat liver following the instructions of the manufacturer. Briefly, cDNA was using and reverse was using a DNA and the DNA the cDNA was to the cDNA was for with a and a reverse for The were and A with a novel DNA sequence was to the a for the isoform was for the the cDNA of Cil was also isolated from rat liver cDNA library by using Chk1 The mammalian expression and were from and were from were p53 expression was by the rat p53 region Chk1 and Cil expression were by of the region and by DNA Expression of the corresponding proteins was by blot analysis using The of Cil promoter were by from the promoter region and the The primers used for promoter Chk1 g-05, Chk1 g-06, Chk1 g-16, Chk1 g-19, Chk1 g-20, Chk1 g-21, Chk1 g-22, Chk1 g-29, and Chk1 from were in mm 0.1 10% using a by at for and at blot of protein were by for and in a in mm mm the proteins were to a The blot was with in mm mm for 1 and incubated with the C-terminal of Chk1 by an in the C-terminal domain of for 1 and washed twice in The was incubated with the to and using the according to the instructions of the analysis of Chk1 Ser-345 of proteins from cells transfected with Chk1 Cil expression with or UV irradiation were with specifically Chk1 cells in a 60-mm were transfected with of and 1 of as Cells were after washed twice in and with of in a assay Cell were and the activity cell were and at for were the and 100 of were The obtained was activity. assay the of were for activity by of solution of an solution in and of The solution was incubated at for or was The reaction was by of 1 and at was A RNA blot of mRNA from rat was from and with Chk1 according to the of the manufacturer. RNA was from rat liver and from cultured cells using the RNA 1 of RNA was with (Invitrogen) for was inactivated by 1 of mm and at for of was and the cDNA was using of reverse (Invitrogen) for at The reaction was by at for were using primers to Chk1 or Cil. A rat cDNA used as a for to expression of Cil was from The was used for two-hybrid Plasmids and the domain and domain were used to proteins. The yeast was with and using the D. A. PubMed Scopus Google Scholar, H. Y. K. A. J. PubMed Google Scholar). were on and The yeast was and by the were by of with with with or with protein of and p53 In was using the from according to the instructions of the manufacturer. 1 of DNA was used in a reaction amino was to and were in the of pull-down were in 1 mm mm 100 10% and proteins in the were with the of of by for at on a The were by washed with and in 1 of to of proteins or were incubated at in of and of the in The were washed with in of protein and for by The was and protein was by We have and rat Chk1 cDNA analysis of expression of Chk1 gene expression in rat we a RNA specifically only in the liver We this Chk1 RNA from rat liver using and on a derived from the rat Chk1 DNA of the obtained showed that the liver-specific Chk1 or Cil in the exon to region of rat linked to a unknown sequence at its analysis of the intron between exons and of the sequence in rat showed that the novel 5′ sequence was derived from the of this The of the sequence the sequence with of this sequence with exon the existence of this mRNA in rat liver we also used the Chk1 sequence to the isoform cDNA from the rat liver cDNA obtained this a sequence with the A protein with the from the isoform RNA was also in blot analysis in the liver and to a in the fetal liver of an A isoform was also in the but its is still under blot analysis of Chk1 expression in a rat blot was with a rat Chk1 the rat blot was and with are in of cDNA sequence of rat Cil and its corresponding protein of and Cil. A sequence at the 5′-end is located in intron and to exon and Cil protein expression in rat analysis was on rat liver, and fetal The protein blot was with the Chk1 C-terminal are in of liver-specific we Cil expression in rat by When both and primers were were in the liver corresponding to the of Chk1 and Cil, The only corresponding to that of Chk1. This the liver-specific expression we first in the The of the in the as Cil was by DNA We the expression of Cil development. RNA was from rat of fetal liver, liver from 1 and liver, liver, and analysis showed that Cil was expressed at a in the fetal liver, but the of expression increased to after Cil isoform was in the whether the expression of this liver-specific isoform was in cells, we the mRNA of Chk1 and Cil using in rat hepatoma cell shown in three rat hepatoma cell lines were found to this but the was that of liver, of Cil in The sequence of Cil suggests a promoter 5′ to the first in the intron of the Chk1 this we the promoter activity of DNA to the 5′-end of Cil using the gene shown in a of the first exon of Cil was found to promoter activity when for gene analysis indicated that the promoter activity in the of the analysis of the region three transcription for and the liver-specific transcription M. G. R. EMBO J. PubMed Scopus Google Scholar, S. N. F. M. A. M. J. Mol. Biol. PubMed Scopus Google Scholar, R. PubMed Scopus Google Scholar). of the binding sequence reduced the promoter activity by been shown to be activated after DNA damage by the phosphorylation at and located in the C-terminal domain (22Zhao H. Piwnica-Worms H. Mol. Cell. Biol. 2001; 21: 4129-4139Crossref PubMed Scopus (870) Google Scholar), we whether Cil also be phosphorylated at serine to Ser-345 of following UV We used the that specifically the Chk1 phosphorylated at serine to the phosphorylation of Cil in cells before and after UV shown in phosphorylation was found in Chk1 UV but the phosphorylated after UV irradiation as at a Cil, on the showed a of phosphorylation before UV but the phosphorylation was enhanced after UV These results indicate phosphorylation of both Chk1 and Cil at the site corresponding to Ser-345 in Chk1. When Chk1 was with Cil its phosphorylation was found to be enhanced to the of Chk1 This suggests that Cil enhanced phosphorylation of Chk1. ATR kinase been shown to be involved in the phosphorylation of Chk1 at kinase is to the inhibition by N. C. Oncogene. 1999; 18: PubMed Scopus Google Scholar, R.S. P. Taya Y. 1999; Google Scholar), we whether the phosphorylation of Cil after UV irradiation be by of cells after UV irradiation with mm the phosphorylation of both Chk1 and Cil with the that both proteins were phosphorylated by ATR (27Chen P. Luo C. Deng Y. Ryan K. Register J. Margosiak S. Tempczyk-Russell A. Nguyen B. Myers P. Lundgren K. Kan C.C. O'Connor P.M. Cell. 2000; 100: 681-692Abstract Full Text Full Text PDF PubMed Scopus (180) Google have shown that the kinase domain of Chk1 is in kinase activity in the Chk1. suggested that the C-terminal of Chk1 function as a negative regulator of Chk1 kinase activity. Cil only the C-terminal of Chk1 the kinase domain, we that Cil function as a of Chk1. Chk1 been shown to phosphorylate p53 and to the of p53 in a experiment S.Y. Ahn J. Tamai K. Taya Y. Prives C. Genes Dev. 2000; 14: 289-300Crossref PubMed Google Scholar), we whether Cil the activity of We used the p53 assay to this shown in of the Chk1 gene in the p53 assay the p53 activity This is to that obtained S.Y. Ahn J. Tamai K. Taya Y. Prives C. Genes Dev. 2000; 14: 289-300Crossref PubMed Google Scholar). In Cil was found to the activity by Furthermore, the of gene activity by Chk1 was abolished by with Cil, that Cil was dominant Chk1 in this activity Cil serine to Chk1 serine was phosphorylated UV we the effect of Cil serine phosphorylation in the inhibition of p53 activity. shown in mutation of Cil serine to in the of the inhibition of p53 activity. the serine to Chk1 site phosphorylated in to mutation in a less inhibitory effect on p53 activity. These results indicated that serine in Cil an regulatory role in the function of Cil. on analysis and in of Chk1 kinase (27Chen P. Luo C. Deng Y. Ryan K. Register J. Margosiak S. Tempczyk-Russell A. Nguyen B. Myers P. Lundgren K. Kan C.C. O'Connor P.M. Cell. 2000; 100: 681-692Abstract Full Text Full Text PDF PubMed Scopus (180) Google suggested that the C-terminal domain of Chk1 with the kinase the sequence of Cil in the C-terminal domain of Chk1, we to whether Cil with the kinase domain of Chk1. this we the Chk1 kinase domain and the interaction with Cil by the yeast two-hybrid The Chk1 kinase domain was found to with Cil interaction was found between Chk1 and Cil the interaction between Cil and the Chk1 kinase domain we used and the pull-down assay to this shown in the kinase domain and Cil be These results indicated that the with the interaction was between Chk1 and Cil under the In the present we report the of a novel isoform of Chk1 specifically expressed in rat liver The isoform the C-terminal of Chk1 the kinase The and sequence of this isoform suggest that it was generated by both alternate promoter usage and RNA splicing. The promoter was found within the intron preceding the C-terminal domain within an intron of a gene have been P. A. M. 2001; PubMed Scopus Google Scholar, B. D. R. M. J. G. J. J. S. D. Genes Dev. PubMed Scopus Google and are associated with analysis the transcription site of Cil three binding for transcription and liver-specific The of the liver-specific transcription site the liver-specific expression of Cil. of this transcription site reduced the promoter activity in rat this cell line only expressed a of Cil, we that this cell line is the for the of a of Cil serve as the for the of the Cil The Cil region at amino of the rat Chk1 This site is located in the flexible linker between the kinase and the C-terminal (27Chen P. Luo C. Deng Y. Ryan K. Register J. Margosiak S. Tempczyk-Russell A. Nguyen B. Myers P. Lundgren K. Kan C.C. O'Connor P.M. Cell. 2000; 100: 681-692Abstract Full Text Full Text PDF PubMed Scopus (180) Google in the Chk1 Thus Cil is of the kinase domain of Chk1 and contains only the C-terminal the C-terminal of Chk1 been in the negative of Chk1 (27Chen P. Luo C. Deng Y. Ryan K. Register J. Margosiak S. Tempczyk-Russell A. Nguyen B. Myers P. Lundgren K. Kan C.C. O'Connor P.M. Cell. 2000; 100: 681-692Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar), we the interaction of Cil and the kinase domain using the yeast two-hybrid assay as as an in pull-down These analyses showed that Cil with the kinase Chk1 been shown to the p53 when by with or of ionizing S.Y. Ahn J. Tamai K. Taya Y. Prives C. Genes Dev. 2000; 14: 289-300Crossref PubMed Google Scholar). In of Chk1 enhanced p53 but Cil the effect. These suggested that Cil serve as a negative regulator in the The that a negative regulator of Chk1 kinase activity is present only in the liver is from in a of Rat liver is in cells with S. P. D. 1995; PubMed Scopus Google Scholar, J. Biol. PubMed Scopus Google with an to N. C. M. 1996; PubMed Scopus Google Scholar, Cell Biol. 1997; 13: PubMed Scopus Google Scholar, G. S. J. PubMed Scopus Google Scholar). the fetal and liver are of cells S. P. D. 1995; PubMed Scopus Google Scholar, N. C. M. 1996; PubMed Scopus Google Scholar, P. PubMed Scopus Google Scholar). Chk1 is involved in cell cycle liver-specific expression of Cil may be to the This to be in the We are for the effect of Cil on cell cycle and nuclear with or damage to DNA or of DNA We have a human liver cDNA library for the human of Cil with of the human intron sequence corresponding to the in the rat genome promoter showed sequence between the in this of the using from human intron with with the rat sequence and the conserved C-terminal domain sequence as primers in a human cDNA library or in mRNA from human Cil is to rat or whether a isoform in human liver be the of We for and and for and in the p53