Regulation of RNA Polymerase II-dependent Transcription by Poly(ADP-ribosyl)ation of Transcription Factors

Abstract

Poly(ADP-ribosyl) transferase (ADPRT) is a nuclear protein that modifies proteins by forming and attaching to them poly(ADP-ribose) chains. Poly(ADP-ribosyl)ation represents an event of major importance in perturbed cell nuclei and participates in the regulation of fundamental processes including DNA repair and transcription. Although ADPRT serves as a positive cofactor of transcription, initiation of its catalytic activity may cause repression of RNA polymerase II-dependent transcription. It is demonstrated here that ADPRT-dependent silencing of transcription involves ADP-ribosylation of the TATA-binding protein. This modification occurs only if poly(ADP-ribosyl)ation is initiated before TATA-binding protein has bound to DNA and thereby prevents formation of active transcription complexes. Specific DNA binding of other transcription factors including Yin Yang 1, p53, NFκB, Sp1, and CREB but not c-Jun or AP-2 is similarly affected. After assembly of transcription complexes initiation of poly(ADP-ribosyl)ation does not influence DNA binding of transcription factors. Accordingly, if bound to DNA, transcription factors are inaccessible to poly(ADP-ribosyl)ation. Thus, poly(ADP-ribosyl)ation prevents binding of transcription factors to DNA, whereas binding to DNA prevents their modification. Considering its ability to detect DNA strand breaks and stimulate DNA repair, it is proposed that ADPRT serves as a molecular switch between transcription and repair of DNA to avoid expression of damaged genes. Poly(ADP-ribosyl) transferase (ADPRT) is a nuclear protein that modifies proteins by forming and attaching to them poly(ADP-ribose) chains. Poly(ADP-ribosyl)ation represents an event of major importance in perturbed cell nuclei and participates in the regulation of fundamental processes including DNA repair and transcription. Although ADPRT serves as a positive cofactor of transcription, initiation of its catalytic activity may cause repression of RNA polymerase II-dependent transcription. It is demonstrated here that ADPRT-dependent silencing of transcription involves ADP-ribosylation of the TATA-binding protein. This modification occurs only if poly(ADP-ribosyl)ation is initiated before TATA-binding protein has bound to DNA and thereby prevents formation of active transcription complexes. Specific DNA binding of other transcription factors including Yin Yang 1, p53, NFκB, Sp1, and CREB but not c-Jun or AP-2 is similarly affected. After assembly of transcription complexes initiation of poly(ADP-ribosyl)ation does not influence DNA binding of transcription factors. Accordingly, if bound to DNA, transcription factors are inaccessible to poly(ADP-ribosyl)ation. Thus, poly(ADP-ribosyl)ation prevents binding of transcription factors to DNA, whereas binding to DNA prevents their modification. Considering its ability to detect DNA strand breaks and stimulate DNA repair, it is proposed that ADPRT serves as a molecular switch between transcription and repair of DNA to avoid expression of damaged genes. poly(ADP-ribosyl) transferase electromobility shift assay polyacrylamide gel electrophoresis TATA-binding protein Yin Yang 1 transcription factor IIB. Participation in DNA repair is regarded as a major function of ADPRT (reviewed in Ref.1de Murcia G. Ménissier-de Murcia J. Trends Biochem. Sci. 1994; 19: 172-176Abstract Full Text PDF PubMed Scopus (763) Google Scholar, 2Lindahl T. Satoh M.S. Poirier G.G. Klungland A. Trends Biochem. Sci. 1995; 20: 405-411Abstract Full Text PDF PubMed Scopus (576) Google Scholar, 3Oei S.L. Griesenbeck J. Schweiger M. Rev. Physiol. Biochem. Pharmacol. 1997; 131: 127-174PubMed Google Scholar).1 Occurrence of DNA strand breaks induces the enzymatic activity of ADPRT, transfer of ADP-ribose moieties from NAD+ to proteins. Therefore, after genotoxic treatment of mammalian cells, the greatly enhanced activity of ADPRT may cause depletion of the intracellular NAD+ pool (4Durkacz B.W. Omidiji O. Gray D.A. Shall S. Nature. 1980; 283: 593-596Crossref PubMed Scopus (922) Google Scholar). It was concluded that this effect is part of a defense mechanism, because DNA repair after γ-irradiation is stimulated by ADPRT activity (5Satoh M.S. Lindahl T. Nature. 1992; 356: 356-358Crossref PubMed Scopus (975) Google Scholar, 6Molinete M. Vermeulen W. Bürkle A. Ménissier-de Murcia J. Küpper H. Hoeijmakers J.H. de Murcia G. EMBO J. 1993; 12: 2109-2117Crossref PubMed Scopus (226) Google Scholar). The target proteins of poly(ADP-ribosyl)ation include the enzyme itself as well as a limited number of nuclear proteins (reviewed in Ref. 3Oei S.L. Griesenbeck J. Schweiger M. Rev. Physiol. Biochem. Pharmacol. 1997; 131: 127-174PubMed Google Scholar). ADPRT has also been shown to participate in the regulation of transcription and appears to exert a dual function. On the one hand, the active component of transcription factor IIC was identified as the enzyme ADPRT (7Matsui T. Segall J. Weil P.A. Roeder R.G. J. Biol. Chem. 1980; 255: 11992-11996Abstract Full Text PDF PubMed Google Scholar, 8Slattery E. Dignam J.D. Matsui M. Roeder R.G. J. Biol. Chem. 1983; 258: 5955-5959Abstract Full Text PDF PubMed Google Scholar). In the absence of its substrate, NAD+, ADPRT has been demonstrated to be an enhancer of activator-dependent transcription (9Meisterernst M. Stelzer G. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2261-2265Crossref PubMed Scopus (145) Google Scholar). On the other hand, it was reported recently that protein modification with poly(ADP-ribose) was an efficient means of reversibly silencing general polymerase II-dependent transcription (9Meisterernst M. Stelzer G. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2261-2265Crossref PubMed Scopus (145) Google Scholar, 10Oei S.L. Griesenbeck J. Ziegler M. Schweiger M. Biochemistry. 1998; 37: 1465-1469Crossref PubMed Scopus (57) Google Scholar). Consequently, the activating or repressing influence of ADPRT on transcription depends on the catalytic activity of this enzyme and appears to be mediated by direct interactions with basal and gene-specific transcription factors. Transcription factors TFIIF (11Rawling J.M. Alvarez-Gonzalez R. Biochem. J. 1997; 324: 249-253Crossref PubMed Scopus (58) Google Scholar) and p53 (12Wesierska-Gadek J. Schmid G. Cerni C. Biochem. Biophys. Res. Commun. 1996; 224: 96-102Crossref PubMed Scopus (81) Google Scholar) have been reported to be acceptors of poly(ADP-ribose) chains. Transcription factors YY1 and Oct-1 were found to tightly associate with ADPRT (13Oei S.L. Griesenbeck J. Schweiger M. Babich V. Kropotov A. Tomilin N. Biochem. Biophys. Res. Commun. 1997; 240: 108-111Crossref PubMed Scopus (92) Google Scholar, 14Nie J. Sakamoto S. Song D. Qu Z. Ota K. Taniguchi T. FEBS Lett. 1998; 424: 27-32Crossref PubMed Scopus (84) Google Scholar). Because silencing of transcription by poly(ADP-ribosyl)ation (9Meisterernst M. Stelzer G. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2261-2265Crossref PubMed Scopus (145) Google Scholar, 10Oei S.L. Griesenbeck J. Ziegler M. Schweiger M. Biochemistry. 1998; 37: 1465-1469Crossref PubMed Scopus (57) Google Scholar) was observed in a system requiring only the basal transcriptional complex, the influence of ADPRT on gene expression may be more general rather than restricted to a small number of genes. In the present study the molecular mechanism of the ADPRT-dependent silencing of transcription was investigated. It was found that the poly(ADP-ribosyl)ation reaction prevented specific transcription factors from binding to DNA, thus excluding the formation of an active transcription complex. The specific DNA binding of some transcription factors (YY1, TBP, and p53) was prevented by covalent modification with poly(ADP-ribose). No ADP-ribosylation of transcription factors was detected if they had bound to DNA before the modification reaction was initiated. The results suggest that when activated, ADPRT may modify certain general and other transcription factors and thereby prevent their binding to DNA. After overexpression in Escherichia coli cells the human His-tagged ADPRT was purified as described previously (15Griesenbeck J. Oei S.L. Mayer-Kuckuk P. Ziegler M. Buchlow G. Schweiger M. Biochemistry. 1997; 36: 7297-7394Crossref PubMed Scopus (42) Google Scholar). Recombinant human His-tagged YY1 (plasmid pHisYY1) produced in E. coli cells was purified as described by Seto et al. (16Seto E. Shi Y. Shenk T. Nature. 1991; 354: 241-245Crossref PubMed Scopus (342) Google Scholar). Recombinant human p53 was obtained from E. coli cells transformed with the plasmid pET-8c-p53H-47 (17Foord O. Navot N. Rotter V. Mol. Cell. Biol. 1993; 13: 1378-1384Crossref PubMed Scopus (34) Google Scholar). Recombinant TBP and TFIIB were purchased from Promega. 32P labeling of the oligonucleotides (YY1 (18Yant S.R. Zhu W. Millinoff D. Slightom J.L. Goodman M. Gumucio D.L. Nucleic Acids Res. 1995; 23: 4353-4362Crossref PubMed Scopus (132) Google Scholar), GGCTCCGCGGCCATCTTGGCGGCT; Sp1(19), ATTCGATCGGGGCGGGGCGAGC; AP-1 (20Lee W. Mitchell P. Tjian R. Cell. 1987; 49: 741-752Abstract Full Text PDF PubMed Scopus (1365) Google Scholar), CGCTTGATGAGTCAGCCGGAA; and TATA (21Locker J. Buzard G. J. DNA Seq. 1990; 1: 3-11Crossref PubMed Scopus (111) Google Scholar), GCAGAGCATATAAGGTGAGGTAGGA) and EMSAs with HeLa nuclear extracts (Promega) were performed as described previously (13Oei S.L. Griesenbeck J. Schweiger M. Babich V. Kropotov A. Tomilin N. Biochem. Biophys. Res. Commun. 1997; 240: 108-111Crossref PubMed Scopus (92) Google Scholar). In brief, in a binding reaction nuclear HeLa extracts (4 μg of protein) or recombinant proteins were incubated with 5 ng of32P-labeled duplex oligonucleotide for 20 min at room temperature in 20 mm Tris-HCl, pH 8, 60 mm KCl, 5 mm MgCl2, 1 mm dithiothreitol, 0.05% Nonidet P-40, 10% glycerol, 50 μg/ml bovine serum albumin, and 500 ng of poly (dI-dC) in a final volume of 10 μl. If EMSAs were carried out with nuclear extracts, the binding reaction contained in addition 400 ng of an unrelated oligonucleotide as unspecific competitor DNA to inhibit unspecific oligonucleotide binding activities present in the extracts (13Oei S.L. Griesenbeck J. Schweiger M. Babich V. Kropotov A. Tomilin N. Biochem. Biophys. Res. Commun. 1997; 240: 108-111Crossref PubMed Scopus (92) Google Scholar). If EMSAs were carried out with recombinant proteins, the binding reaction contained as unspecific inhibitor 200 ng of a promoter-less plasmid p(C2AT)n (22Sawadogo M. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4394-4398Crossref PubMed Scopus (367) Google Scholar). Following the binding reaction protein-DNA complexes were separated in a 4% polyacrylamide gel. EMSA with TATA oligonucleotide was performed according to the protocol of Promega. 20 ng of TBP and 50 ng of TFIIB were incubated with 5 ng of32P-labeled TATA duplex oligonucleotide for 15 min at room temperature in 20 mm Tris-HCl, pH 8, 80 mm KCl, 10 mm MgCl2, 2 mm dithiothreitol, and 10% glycerol in a final volume of 10 μl. Following the binding reaction 10 ng of poly(dI-dC) was added, and samples were subjected to electrophoretic separation on a 6% polyacrylamide gel. After electrophoresis the gels were autoradiographed. Recombinant purified ADPRT was incubated in binding buffer (10 mm Tris-HCl, pH 8.0, 7 mm MgCl2, 50 μmZnCl2, and 1% bovine serum albumin). Reactions were started by the addition of 32P-labeled NAD+ and 10 μg/ml sonicated salmon sperm DNA (Boehringer, Mannheim) at 25 °C. Incubations were stopped by adding trichloroacetic acid to give a final concentration of 20%. After centrifugation trichloroacetic acid precipitates were washed two times with 5% trichloroacetic acid and with ethanol. Incorporation of32P-labeled ADP-ribose units was determined by Cerenkov counting. Purified recombinant ADPRT was incubated with transcription factors in the presence of 32P-labeled NAD+ at 25 °C in a final volume of 10 μl under conditions indicated in the legends to the figures. Incubations were stopped by the addition of SDS-containing sample buffer. Proteins were separated by SDS-PAGE. After electrophoresis gels were dried, and modification of proteins with32P-labeled ADP-ribose was detected by autoradiography. Standard transcription reactions (10Oei S.L. Griesenbeck J. Ziegler M. Schweiger M. Biochemistry. 1998; 37: 1465-1469Crossref PubMed Scopus (57) Google Scholar) contained HeLa nuclear extracts (18 μg of protein/reaction mixture) and 200 ng of the supercoiled plasmid pML(C2AT)n (22Sawadogo M. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4394-4398Crossref PubMed Scopus (367) Google Scholar). Following preincubation for 20 min at ambient temperature in transcription buffer (10 mmHEPES, pH 7.9, 50 mm KCl, 0.1 mm EDTA, 0.25 mm dithiothreitol, 10% glycerol, and 7 mmMgCl2) the reaction was started by adding NTPs (0.6 mm ATP, 0.6 mm UTP, 25 μm[α-32P]CTP, 10,000 cpm/pmol, and 0.1 mm3′-O-methyl-GTP) in a final reaction volume of 15 μl. All data presented are representative of at least three independent experiments. Because it was the goal of the present study to understand how activation of ADPRT may cause repression of transcription, the effect of poly(ADP-ribosyl)ation on transcription factors was analyzed. The ability of transcription factors to bind to their cognate sequences was tested in EMSAs following incubation with catalytically inactive (in the absence of NAD+) or active (in the presence of NAD+) ADPRT. The experiments were first carried out with YY1, which is known to be a partner protein of ADPRT and to be sensitive to ADPRT in EMSAs (13Oei S.L. Griesenbeck J. Schweiger M. Babich V. Kropotov A. Tomilin N. Biochem. Biophys. Res. Commun. 1997; 240: 108-111Crossref PubMed Scopus (92) Google Scholar). EMSAs were carried out with a YY1 consensus oligonucleotide (18Yant S.R. Zhu W. Millinoff D. Slightom J.L. Goodman M. Gumucio D.L. Nucleic Acids Res. 1995; 23: 4353-4362Crossref PubMed Scopus (132) Google Scholar) and purified recombinant proteins. The addition of unmodified ADPRT did not affect specific DNA binding of YY1 (Fig. 1 A, lane 2), whereas in the presence of ADPRT and NAD+ DNA binding of YY1 was strongly suppressed (Fig. 1 A, lane 3). The possibility that the repression of DNA binding was mediated solely by the produced poly(ADP-ribose) polymers was ruled out by experiments using isolated ADP-ribose polymers instead of NAD+. Addition of deproteinized ADP-ribose polymers (detached from automodified ADPRT) did not influence the retention of the specific oligonucleotide by YY1 (Fig. 1 A, lane 4). Similar results were obtained (Fig. 1 B) in EMSA with YY1 consensus oligonucleotide using cell-free HeLa nuclear extracts (23Dignam J.D. Lebowitz R.M. Roeder R.G. Nucl. Ac. Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar). Specific YY1 DNA binding was abolished in the presence of NAD+ (Fig. 1 B, lane 2). This repression of DNA binding was prevented (Fig. 1 B, lane 3) by adding a potent inhibitor of poly(ADP-ribosyl)ation, 3-aminobenzamide (24Purnell M.R. Whish W.J.D. Biochem. J. 1980; 185: 775-777Crossref PubMed Scopus (419) Google Scholar). The presence of an amount of ADP-ribose polymers (4 nmol of ADP-ribose units), which by far exceeded the maximum that was produced in the HeLa extracts by the endogenous ADPRT in the presence of 1 mmNAD+ (not shown), did not exert any influence on DNA binding of YY1 (Fig. 1 B, lane 4). Therefore, NAD+-dependent prevention of DNA binding of YY1 was mediated by the enzymatic activity of ADPRT present in the HeLa nuclear extract. However, if YY1 was allowed to bind to its specific oligonucleotide prior to the addition of NAD+, DNA binding remained unaffected (Fig. 1, A, lane 5, and B, lane 5). A similar sensitivity to ADPRT activity was observed with a Sp1 consensus oligonucleotide (Fig. 1 C, lane 2) as well as with a NFκB consensus oligonucleotide (not shown). Using a CREB consensus oligonucleotide the effect of poly(ADP-ribosyl)ation was detectable but less pronounced (not shown). In contrast, retention of AP-1 (Fig. 1 C, lane 5) or AP-2 (not shown) oligonucleotides in the EMSA was insensitive to ADPRT activity. Addition of deproteinized ADP-ribose polymers did not influence DNA binding of Sp1 or AP-1 (not shown). As has been observed with YY1 (Fig. 1 B, lane 3), repression of Sp1 DNA binding was prevented by the addition of 3-aminobenzamide (not shown). Again, binding of the proteins to their consensus sequences was unaffected if it had taken place prior to the addition of NAD+ (Fig. 1 C, lane 3). Importantly, TBP (in complex with TFIIB) exhibited also a similar response to ADPRT activity, which is of significance with regard to the ADPRT-dependent silencing of transcription (see below). The interference of ADPRT activity with specific DNA binding as described above has also been observed with purified recombinant p53 (12Wesierska-Gadek J. Schmid G. Cerni C. Biochem. Biophys. Res. Commun. 1996; 224: 96-102Crossref PubMed Scopus (81) Google Scholar), a known partner of ADPRT (25Vaziri H. West M.D. Allsopp R.C. Davison T.S. Wu Y.S. Arrowsmith C.H. Poirier G.G. Benchimol S. EMBO J. 1997; 16: 6018-6033Crossref PubMed Scopus (334) Google Scholar) and target protein of modification with poly(ADP-ribose) (12Wesierska-Gadek J. Schmid G. Cerni C. Biochem. Biophys. Res. Commun. 1996; 224: 96-102Crossref PubMed Scopus (81) Google Scholar). As opposed to the observations with YY1 (Fig. 1, A, lane 4 and B, lane 4) or Sp1, specific p53 DNA binding was also repressed in the presence of small amounts of deproteinized ADP-ribose polymers (not shown). This high affinity of p53 to isolated polymers is in accordance with a recent report by Malanga et al. (26Malanga M. Pleschke J.M. Kleczkowska H.E. Althaus F.R. J. Biol. Chem. 1998; 273: 111843-118434Abstract Full Text Full Text PDF Scopus (196) Google Scholar). Thus, it is concluded that the catalytic activity of ADPRT prevents specific DNA binding of some transcription factors. However, it is important to point out that initiation of the poly(ADP-ribosyl)ation reaction does not cause the dissociation of preformed complexes between DNA and transcription factors. The conditions under which the DNA binding of some transcription factors was influenced implicated an interaction of ADPRT with these factors that depended on the functional state of the enzyme. To gain insight into whether transcription factors in turn exert an effect on the catalytic activity of ADPRT, we compared the of poly(ADP-ribosyl)ation with or the addition of transcription factors. Addition of purified recombinant YY1 in a of the poly(ADP-ribosyl)ation reaction (Fig. 2 The observed of was to the stimulated of the enzyme and the of of YY1 with poly(ADP-ribose) (Fig. 2 ADP-ribosylation of YY1 was not detectable if this transcription factor bound to DNA before the addition of NAD+ (Fig. 2 This important for the ability of ADPRT to transcription (see also for to YY1, addition of TBP or p53 also in a of the reaction less these to be because other known partner proteins of ADPRT, M. C. V. S. Ménissier-de Murcia de Murcia G. Mol. Cell. Biol. 1998; PubMed Scopus Google Scholar) or protein T. E. J. S.R. J. Biol. Chem. 1998; 273: Full Text Full Text PDF PubMed Scopus Google Scholar), the poly(ADP-ribosyl)ation The protein c-Jun specific DNA binding was insensitive to poly(ADP-ribosyl)ation 1 C, lane 5) had effect on the of poly(ADP-ribose) The effect of the basal transcription factor TFIIB on ADPRT activity was rather in addition to TBP, TFIIB was poly(ADP-ribosyl)ation was enhanced of ADPRT activity by transcription factor activity of μg/ml ADPRT, 1 of 32P-labeled NAD+, and 10 μg/ml of sonicated DNA were incubated with the transcription factors indicated at the following 10 μg/ml YY1, 5 μg/ml TBP, 5 μg/ml TBP, 10 μg/ml 10 μg/ml p53, and 10 μg/ml Incubations were for 5 min and stopped by trichloroacetic acid was to the obtained for ADPRT in the absence of other transcription factors of ADP-ribose of in a 2 μg/ml ADPRT, 1 of 32P-labeled NAD+, and 10 μg/ml of sonicated DNA were incubated with the transcription factors indicated at the following 10 μg/ml YY1, 5 μg/ml TBP, 5 μg/ml TBP, 10 μg/ml 10 μg/ml p53, and 10 μg/ml Incubations were for 5 min and stopped by trichloroacetic acid was to the obtained for ADPRT in the absence of other transcription factors of ADP-ribose of As TBP (in complex with TFIIB) exhibited a that of YY1 in the presented above 1 and 2), a specific interaction between these transcription factors and ADPRT. This is of because TBP and known to tightly associate for initiation of transcription S. S. Nature. 1995; PubMed Scopus Google Scholar), are of the basal transcriptional The results are presented in and EMSAs were performed using TATA oligonucleotides and recombinant TBP and As shown in A, complex formation of with the TATA oligonucleotide was sensitive to ADPRT activity (Fig. A, lane 2). However, the poly(ADP-ribosyl)ation reaction did not influence preformed complexes of with DNA (Fig. A, lane 3). Thus, DNA binding and formation of transcription complexes are only prevented if the poly(ADP-ribosyl)ation reaction is before the basal transcription factors have bound to DNA. of protein modification with poly(ADP-ribose) that only TBP and not TFIIB is a specific target for poly(ADP-ribosyl)ation (Fig. Importantly, modification of TBP only under conditions that greatly specific DNA binding of (Fig. A, lane 2). when the transcription factors had bound to DNA prior to the addition of NAD+, was detectable ADP-ribosylation of TBP (Fig. B, lane 3), and complex formation as in EMSA remained unaffected (Fig. A, lane 3). for the that TBP may be prevented from binding to its cognate by modification with poly(ADP-ribose). It is that the mechanism ADPRT-dependent silencing of transcription (10Oei S.L. Griesenbeck J. Ziegler M. Schweiger M. Biochemistry. 1998; 37: 1465-1469Crossref PubMed Scopus (57) Google Scholar) modification of TBP the of this factor to bind to the TATA the conditions to ADPRT-dependent silencing of II-dependent transcription (Fig. C, lane 2) found to be for modification of TBP (Fig. B, 2 and 4) and prevention of its DNA binding (Fig. A, lane 2). In a recent report (11Rawling J.M. Alvarez-Gonzalez R. Biochem. J. 1997; 324: 249-253Crossref PubMed Scopus (58) Google Scholar) the transcription factor TFIIF was shown to be an of whereas TBP was not It from the data presented here that TBP modification (11Rawling J.M. Alvarez-Gonzalez R. Biochem. J. 1997; 324: 249-253Crossref PubMed Scopus (58) Google Scholar), because it had bound to DNA prior to the initiation of poly(ADP-ribosyl)ation B, lane 3). of the of the poly(ADP-ribosyl)ation for some transcription factors. in HeLa nuclear extracts transcriptional silencing by poly(ADP-ribosyl)ation was by modification of ADPRT itself and a rather limited number of nuclear proteins (10Oei S.L. Griesenbeck J. Ziegler M. Schweiger M. Biochemistry. 1998; 37: 1465-1469Crossref PubMed Scopus (57) Google Scholar). In in the presence of other proteins, or TFIIB 2 A and only ADPRT and the specific proteins, YY1 or TBP, were detected to be TBP and YY1 were 2 A and modification of which to AP-1 was detectable only after incubation (not shown). The that poly(ADP-ribosyl)ation did not affect AP-1 binding in the EMSA (Fig. 1 C, lane 5) that the of modification by ADPRT be for prevention of DNA This was by EMSA using that only of the poly(ADP-ribosyl)ation reaction S.L. Griesenbeck J. Buchlow G. D. Mayer-Kuckuk P. T. Ziegler M. FEBS Lett. 1996; PubMed Scopus Google Scholar). of these influenced the retention of oligonucleotides in experiments similar to presented in shown). In this it is important to that ADPRT-dependent silencing of transcription as shown in is less than 5 min following the addition of NAD+ (10Oei S.L. Griesenbeck J. Ziegler M. Schweiger M. Biochemistry. 1998; 37: 1465-1469Crossref PubMed Scopus (57) Google Scholar). this study for the that poly(ADP-ribosyl)ation of TBP is a in ADPRT-dependent silencing of transcription. It also the important that when poly(ADP-ribosyl)ation prevents formation of transcription complexes transcription. transcription complexes have been the transcription factors are inaccessible for In poly(ADP-ribosyl)ation prevents their binding to DNA, whereas DNA binding of transcription factors prevents their poly(ADP-ribosyl)ation. to the of ADPRT as a factor following genotoxic of this enzyme in the regulation of transcription may be of importance from DNA In poly(ADP-ribosyl)ation of transcription factors represents a means of gene expression by covalent protein modification. T. T. C. W. M. and V. for for overexpression of recombinant YY1 and p53 and G. Buchlow for