Tetranucleotide repeat polymorphism at the human tyrosine hydroxylase gene (TH)

Abstract

The polymorphic (TCAT)n repeat begins at base pair 1170 in intron 1 of the human tyrosine hydroxylase gene on chromosome I lpl5.5-pl5 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 254 bp. Primer Sequences: CAGCTGCCCTAGTCAGCAC (TCAT strand); GCTTCCGAGTGCAGGTCACA (AGTA strand). Frequency: Estimated from 70 chromosomes of unrelated individuals. Heterozygosity index = 78%. PIC = 0.75. Allele (bp) Frequency KI 260 0.21 K2 256 0.26 K3 252 0.13 K4 248 0.14 KS 244 0.26 Mendelian Inheritance: Co-dominant segregation was observed in two informative families.