Concepedia

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach

Nicholas Delihas, Janet Andersen, H. Mae Sprouse, B. Dudock

Nucleic Acids Research · 1981 · 30 citations · 12 references

Open access

Concepts

BiologyPlant Molecular BiologyDna SequencingNucleic Acid ChemistryPhylogeneticsRibosomal RnaPuauu Cugguguccuaggcguagaggaaccacaccaauccaucccgaacuuggugguuaaacucuacugcggugacgauacuguaggggagguccugcggaaaaauagcucgacgccaggaug OhNatural SciencesGeneticsRna Structure PredictionMolecular BiologyMolecular GeneticsGenomicsNucleotide SequenceMedicineChloroplast 5S

Abstract

Spinacia oleracia chloroplast 5S ribosomal RNA was end-labeled with [ 32 P] and the complete nucleotide sequence was determined. The sequence is: pUAUU CUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAUACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUG OH .

References

12

Mapping adenines, guanines, and pyrimidines in RNA

Helen Donis-Keller, Allan M. Maxam, Walter Gilbert · Nucleic Acids Research · 1977 · 1.4K citations · Full text

Chromatin, Nucleic Acid Chemistry, Biochemistry +12

5S RNA secondary structure

George E. Fox, Carl R. Woese · Nature · 1975 · 487 citations

Natural Sciences, Rna Structure Prediction, Rna Biology +4

Use of DNA Polymerase I Primed by a Synthetic Oligonucleotide to Determine a Nucleotide Sequence in Phage f1 DNA

Frederick Sanger, J E Donelson, Alan Coulson et al. · Proceedings of the National Academy of Sciences · 1973 · 245 citations · Full text

Studies on the Sequence of the 3′‐Terminal Region of Turnip‐Yellow‐Mosaic‐Virus RNA

Melvin Silberklang, Alain Prochiantz, Anne‐Lise Haenni et al. · European Journal of Biochemistry · 1977 · 200 citations

A different approach to RNA sequencing

John Stanley, Stanislav Vassilenko · Nature · 1978 · 186 citations

Bioinformatics, Different Approach, Sequencing +8