VE-cadherin-induced Cdc42 Signaling Regulates Formation of Membrane Protrusions in Endothelial Cells

Abstract

The cytoplasmic domain of cadherins and the associated catenins link the cytoskeleton with signal transduction pathways. To study the signaling function of non-junctional VE-cadherin, which can form during the loss VE-cadherin homotypic adhesion, wild type VE-cadherin or VE-cadherin cytoplasmic domain (ΔEXD) was expressed in sub-confluent endothelial cells. We observed that Cdc42 was activated in transfected cells and that these cells also developed Cdc42-dependent >70-μm-long plasma membrane protrusions. The formation of these structures required actin polymerization, and they developed specifically in endothelial cells as compared with epithelial cells. Expression of the VE-cadherin cytoplasmic domain lacking the β-catenin binding site also induced Cdc42 activation; thus, its activation cannot be ascribed to β-catenin binding. However, these cells were not able to form the protrusions. These results suggest that the cytoplasmic domain of non-junctional VE-cadherin can serve as a scaffold involved in Cdc42 activation at the endothelial plasma membrane. β-Catenin and the associated α-catenin may serve as support sites for actin polymerization, leading to formation of long plasma membrane protrusions. Thus, non-junctional VE-cadherin actively participates in inside-out signaling at the plasma membrane, leading to the development of endothelial membrane protrusions. The cytoplasmic domain of cadherins and the associated catenins link the cytoskeleton with signal transduction pathways. To study the signaling function of non-junctional VE-cadherin, which can form during the loss VE-cadherin homotypic adhesion, wild type VE-cadherin or VE-cadherin cytoplasmic domain (ΔEXD) was expressed in sub-confluent endothelial cells. We observed that Cdc42 was activated in transfected cells and that these cells also developed Cdc42-dependent >70-μm-long plasma membrane protrusions. The formation of these structures required actin polymerization, and they developed specifically in endothelial cells as compared with epithelial cells. Expression of the VE-cadherin cytoplasmic domain lacking the β-catenin binding site also induced Cdc42 activation; thus, its activation cannot be ascribed to β-catenin binding. However, these cells were not able to form the protrusions. These results suggest that the cytoplasmic domain of non-junctional VE-cadherin can serve as a scaffold involved in Cdc42 activation at the endothelial plasma membrane. β-Catenin and the associated α-catenin may serve as support sites for actin polymerization, leading to formation of long plasma membrane protrusions. Thus, non-junctional VE-cadherin actively participates in inside-out signaling at the plasma membrane, leading to the development of endothelial membrane protrusions. human microvascular endothelial cell wild type glutathioneS-transferase Cadherin molecules are membrane receptors involved in cell-cell adhesion (1Tepass U. Truong K. Godt D. Ikura M. Peifer M. Nat. Rev. Mol. Cell Biol. 2000; 1: 91-100Crossref PubMed Scopus (398) Google Scholar, 2Takeichi M. Curr. Opin. Cell Biol. 1995; 7: 619-627Crossref PubMed Scopus (1262) Google Scholar). They form a large family of proteins with tissue specificity that associates in a homophilic manner. They are indispensable in tissue formation during development, and in addition to adhesion, they serve morphogenetic functions (3Riethmacher D. Brinkmann V. Birchmeier C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 855-859Crossref PubMed Scopus (407) Google Scholar, 4Radice G.L. Rayburn H. Matsunami H. Knudsen K.A. Takeichi M. Hynes R.O. Dev. Biol. 1997; 181: 64-78Crossref PubMed Scopus (617) Google Scholar, 5Radice G.L. Ferreira-Cornwell M.C. Robinson S.D. Rayburn H. Chodosh L.A. Takeichi M. Hynes R.O. J. Cell Biol. 1997; 139: 1025-1032Crossref PubMed Scopus (212) Google Scholar, 6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar). Classical cadherins are anchored to actin cytoskeleton by α-catenin, which binds to β-catenin (7Gumbiner B.M. J. Cell Biol. 2000; 148: 399-404Crossref PubMed Scopus (690) Google Scholar). Catenins have multiple functions in signal transduction and transcription regulation (8Ben-Ze'ev A. Ann. N. Y. Acad. Sci. 1999; 886: 37-47Crossref PubMed Scopus (30) Google Scholar) and, thus, they are directly involved in the transduction of proliferation signals (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar, 9Hoschuetzky H. Aberle H. Kemler R. J. Cell Biol. 1994; 127: 1375-1380Crossref PubMed Scopus (673) Google Scholar,10Pece S. Chiariello M. Murga C. Gutkind J.S. J. Biol. Chem. 1999; 274: 19347-19351Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). tk;2Endothelium forms a semi-permeable barrier that regulates the flux of liquid and solutes (11Dudek S.M. Garcia J.G. J. Appl. Physiol. 2001; 91: 1487-1500Crossref PubMed Scopus (843) Google Scholar, 12Dejana E. Lampugnani M.G. Martinez-Estrada O. Bazzoni G. Int. J. Dev. Biol. 2000; 44: 743-748PubMed Google Scholar) as well as leukocyte transmigration from the microvasculature to sites of injury and infection (13Allport J.R. Muller W.A. Luscinskas F.W. J. Cell Biol. 2000; 148: 203-216Crossref PubMed Scopus (165) Google Scholar, 14Del Maschio A. Zanetti A. Corada M. Rival Y. Ruco L. Lampugnani M.G. Dejana E. J. Cell Biol. 1996; 135: 497-510Crossref PubMed Scopus (280) Google Scholar, 15Gotsch U. Borges E. Bosse R. Boggemeyer E. Simon M. Mossmann H. Vestweber D. J. Cell Sci. 1997; 110: 583-588Crossref PubMed Google Scholar). Adherens junctions formed between endothelial cells contain VE-cadherin, which is specifically expressed in the endothelium (16Navarro P. Ruco L. Dejana E. J. Cell Biol. 1998; 140: 1475-1484Crossref PubMed Scopus (246) Google Scholar). Direct involvement of VE-cadherin to endothelial barrier function was demonstrated by VE-cadherin blocking antibodies in cell-culture and mouse models (17Corada M. Liao F. Lindgren M. Lampugnani M.G. Breviario F. Frank R. Muller W.A. Hicklin D.J. Bohlen P. Dejana E. Blood. 2001; 97: 1679-1684Crossref PubMed Scopus (261) Google Scholar). In a different situation, VE-cadherin/catenins reorganize during polymorphonuclear or monocyte transmigration through the endothelial monolayer (18Luscinskas F.W. Ma S. Nusrat A. Parkos C.A. Shaw S.K. Immunol. Rev. 2002; 186: 57-67Crossref PubMed Scopus (63) Google Scholar). VE-cadherin targeting revealed that in addition to its role in cell-cell adhesion, it is required for transduction of the vascular endothelial growth factor proliferation pathway through β-catenin association to phosphatidylinositol 3-kinase, which is downstream of vascular endothelial growth factor receptor 2. Ablation of VE-cadherin interferes with endothelial proliferation and causes apoptosis (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar). However, it is remarkable that the VE-cadherin function was not compensated despite the presence of N-cadherin, which also associates with β-catenin and is expressed in endothelial cells. Thus, it is possible that the cytoplasmic domain of VE-cadherin serves functions that are not completely understood. Although VE-cadherin is classified as a “classical” cadherin in respect to its primary structure, the cytoplasmic tail is unique among the members of this subgroup (19Nollet F. Kools P. van Roy F. J. Mol. Biol. 2000; 299: 551-572Crossref PubMed Scopus (591) Google Scholar). To study the role of VE-cadherin in signaling mechanisms in endothelial cells, wild type VE-cadherin or the cytoplasmic domain of VE-cadherin mutant was expressed in sub-confluent endothelial cells. The cytoplasmic domain of cadherins has been characterized in a variety of studies as the “dominant negative mutant” for cell-cell adhesion, since its expression blocked cell adhesion in cells of epithelial, neuronal, muscle, and endothelial origin (20Kintner C. Cell. 1992; 69: 225-236Abstract Full Text PDF PubMed Scopus (332) Google Scholar, 21Dufour S. Saint-Jeannet J.P. Broders F. Wedlich D. Thiery J.P. J. Cell Biol. 1994; 127: 521-535Crossref PubMed Scopus (61) Google Scholar, 22Fujimori T. Takeichi M. Mol. Biol. Cell. 1993; 4: 37-47Crossref PubMed Scopus (181) Google Scholar, 23Zhu A.J. Watt F.M. J. Cell Sci. 1996; 109: 3013-3023Crossref PubMed Google Scholar, 24Nieman M.T. Kim J.B. Johnson K.R. Wheelock M.J. J. Cell Sci. 1999; 112: 1621-1632Crossref PubMed Google Scholar). 1P. Kouklis and A. B. Malik, unpublished data. In endothelial cells a chimera between interleukin 2 receptor extracellular domain and VE-cadherin cytoplasmic domain interfered with proliferation by titrating-out β-catenin from its downstream effectors, and its stable expression in tissue culture cells led to down-regulation of endogenous VE-cadherin and defects in proliferation (25Venkiteswaran K. Xiao K. Summers S. Calkins C.C. Vincent P.A. Pumiglia K. Kowalczyk A.P. Am. J. Physiol. Cell Physiol. 2002; 283: 811-821Crossref PubMed Scopus (105) Google Scholar). In the present study, we observed that non-junctional VE-cadherin induced through its cytoplasmic domain the activation of Cdc42 and the formation of >70-μm-long plasma membrane protrusions. Cdc42 activation was shown to be necessary for the formation of these protrusions. We further demonstrated that Cdc42 activation was not dependent upon β-catenin association to VE-cadherin. Two critical factors were required for the formation of the protrusions, (a) membrane localization of VE-cadherin and (b) association of β-catenin with its cytoplasmic domain. Furthermore, the formation of membrane protrusions was endothelial-specific since it did not occur in epithelial cells. These results suggest a novel role of VE-cadherin cytoplasmic domain in the formation of membrane protrusions, which may be involved in the restoration of endothelial junctional barrier function after the loss of homotypic VE-cadherin adhesion. Human microvascular endothelial cells (HMECs)2 were gifts from Dr. E. W. Ades (26Ades E.W. Candal F.J. Swerlick R.A. George V.G. Summers S. Bosse D.C. Lawley T.J. J. Invest. Dermatol. 1992; 99: 683-690Abstract Full Text PDF PubMed Google Scholar) (NIAID, National Institutes of Health, Atlanta, GA). HMECs were cultured in MCDB 131 (Invitrogen) supplemented with 5% fetal bovine serum (Hyclone Laboratories, Logan, UT). Primary human pulmonary arterial endothelial cells were cultured in EBM 2 (endothelial basal medium) complete medium (BioWhittaker, Walkerville, MD). Bovine lung microvascular endothelial cells, purchased were from VEC Technologies (Renssalaer, NY), were grown in MCDB 131 medium supplemented with 5% fetal bovine serum and endothelial cell growth supplement (Sigma-Aldrich). Alveolar epithelial cells A549 were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum. A monoclonal antibody against VE-cadherin was from Chemicon (Temecula, CA), and a goat polyclonal antibody was from Research Diagnostics (Flanders, NJ). Rabbit polyclonal anti-FLAG and anti-Myc-tag monoclonal were from Zymed Laboratories Inc. (San Franscisco, CA). Mouse monoclonal anti-FLAG (M2) was from Sigma-Aldrich. Monoclonal antibodies for β-catenin, p120, and Rac were from Transduction Laboratories (Lexington, KY). Rabbit anti-Cdc42 was from Santa Cruz (Santa Cruz, CA). Horseradish peroxidase-conjugated secondary antibodies were from Jackson Laboratories (West Grove, PA). For immunofluorescence experiments, we used either fluorescein isothiocyanate and Texas Red (Jackson Laboratories) or Alexa 488 and Alexa 568 (Molecular Probes, Eugene, OR)-conjugated antibodies. Actin was visualized with Alexa 488-conjugated phalloidin (Molecular Probes). Latrunculin A was purchased from Molecular Probes. VE-cadherin-ΔEXD mutants with and without FLAG tag (DYKDDDDK) were constructed by PCR (plasmid pcDNA3-VEC-ΔEXD). The octapeptide sequence encoding for the FLAG-tag sequence replaced the VE-cadherin extracellular domain by PCR. The human wt VE-cadherin cDNA inserted in the EcoRI site of the pcDNA3 vector was used (plasmid pcDNA3-VEC) as the template. We used either primer d-FL containing the FLAG encoding sequence as sense primers (GAGTCGCAAGAATGCCGACTACAAGGACGACGATGACAAGACCTTCTGCGAGGATATGG) or primer D that lacks the FLAG encoding sequence primer was used in PCR were with and these were inserted in the site of The mutant with FLAG was used without To the was and and was inserted in site of pcDNA3 (plasmid To the were by PCR. We used as the sense primer To the we with by PCR as sense primer For PCR we used as the primer PCR containing the or were in the vector (Invitrogen) and with to the wild type sequence from the VE-cadherin-ΔEXD PCR were by cells were transfected by or CA). For cells were in a the cells were and in of with of was and cells were in The were at and To of transfected cells were directly a and for to was and cells were after We observed with and with were grown They were and as E. E. J. Cell Biol. 1994; 127: PubMed Scopus Google The cells were visualized either with or of cell were the from cells were with and in cell were containing and supplemented with Molecular were for in in a and in for to The was used for and were with 2 of mouse (Jackson Laboratories) and with of the antibody for 2 in the addition of of for in were to and were blocked with containing for with primary with and for with peroxidase-conjugated secondary antibodies. For anti-Cdc42 were blocked with containing 5% and at for The signal was developed with expression from Dr. G. were induced with 2 for with and in with Molecular The was for at with of The were with and with 5% and were with of in of at The were with and in of for Human VE-cadherin cDNA of Dr. E. was used to the VE-cadherin extracellular domain mutant (ΔEXD) encoding the signal and the domain were not that the mutant be inserted in membrane. We also constructed mutants to with the that the involved in the binding of β-catenin or and were In were a in cadherin molecules involved in association of β-catenin with cadherins H. A. Kemler R. J. J. Biol. Chem. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar) of to in and of in at the domain the binding site J.M. Wheelock M.J. Johnson K.R. J. Cell Biol. 2000; 148: PubMed Scopus Google Scholar) To expression and of the were transfected with or and from transfected cells were by with anti-FLAG monoclonal antibody specifically with in the and cells and a in cells was in cells were transfected with wt VE-cadherin, or were after and were for Cdc42 activation the cell were with to were and by for Cdc42 binding. We observed that Cdc42 was to in from HMECs transfected with wt VE-cadherin, or Cdc42 activation at the basal in cells In experiments, did not with Cdc42 the of the expressed proteins at the plasma membrane and the in We observed that of transfected endothelial cells developed long with a cell These cells from of were to with were as were in of cells transfected with and of cells transfected with wild type VE-cadherin we transfected with the cytoplasmic domain of endothelial to with E. E. J. Cell Biol. 1994; 127: PubMed Scopus Google of these cells protrusions. of protrusions not To the that cell were the of a we the that the protrusions were in to were observed as as at a expression of transfected was molecules at the plasma membrane, and protrusions in We also expressed in infection with results not the development of the was not secondary to the membrane localization of cadherin cytoplasmic domain not association is required for membrane were transfected with or and were and the mutants were with monoclonal were to that and did not with were transfected with and with anti-FLAG and antibodies. HMECs transfected with and with anti-FLAG and antibodies. induced protrusions to and localization at the membrane. HMECs transfected with after and with anti-FLAG and antibodies. in the with cell in the transfected cells. of the were at To these to endothelial cells, we the in primary endothelial cells, human pulmonary arterial endothelial cells, and in membrane formed after of wt VE-cadherin and cells transfected with mutant were with the actin A Y. A. PubMed Scopus Google and cells were Latrunculin A in the formation of membrane protrusions the of actin in the We also transfected epithelial cells a type epithelial cell with to study formation in cells. cell or membrane were observed in these cells the of in the of the In with mutant and mutant we observed that of the formation of protrusions We also HMECs with mutants of or and the in and protrusions in to the with Cdc42 negative mutant the formation To the of by of negative mutants of and Cdc42 with we in a large of cells Expression of blocked formation in of cells, of cells developed protrusions, a to transfected cells. blocked formation to a not of cells formed protrusions of In a of cells formed protrusions in these cells. Expression of wt VE-cadherin and VE-cadherin cytoplasmic domain endothelial cell as shown the cadherin cytoplasmic domain associates with and we the possible of these in cell We VE-cadherin cytoplasmic domain mutants lacking the binding site for β-catenin and and lacking the binding site for wt VE-cadherin, or were transfected in and association with β-catenin was by and We that β-catenin associated with VE-cadherin and and did not with the mutant from transfected with or were with anti-FLAG monoclonal and association with VE-cadherin mutants was by associated specifically with and not with either or mutants immunofluorescence that with endogenous β-catenin at the plasma membrane and cytoplasmic structures in transfected cells cells also different from the cells. The formed the cell membrane to that were the membrane protrusions induced by the mutant the mutant did not formation Cdc42 was activated in endothelial cells we compared cell induced by expression of and the activated mutant of of with the Cdc42 mutant induced a large of Expression of and induced structures secondary to the activation of cell were observed was with that Cdc42 is involved in formation induced by was also shown to with at plasma membrane sites as shown by did not with To study the localization of with endogenous p120, cells were at mutant expression was and by The mutant at membrane from and cytoplasmic structures to and at this cells also developed long protrusions to after expression of thus, formation of these protrusions is of binding to the VE-cadherin cytoplasmic domain. of the of expression in formation that of cells developed protrusions not We mutant of VE-cadherin cytoplasmic domain lacking the domain for binding J.M. Wheelock M.J. Johnson K.R. J. Cell Biol. 2000; 148: PubMed Scopus Google Scholar). We observed that in the and that membrane protrusions did not in these cells the of membrane localization in the of We expressed wt VE-cadherin or VE-cadherin cytoplasmic domain mutant in endothelial cells. We that expression of either of these induced Cdc42 activation and that the expressed cadherins at the plasma membrane. These suggest that the non-junctional VE-cadherin and its cytoplasmic domain was involved in Cdc42 have been in formation of membrane A. Cell. 1995; Full Text PDF PubMed Scopus Google Scholar). Cdc42 in is as signaling the formation of J. Biol. Chem. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar, B.M. K. J. Biol. Chem. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar). We that expression of wt VE-cadherin and VE-cadherin cytoplasmic domain induced the formation of membrane protrusions. negative mutants of or Cdc42 with mutant demonstrated that formation of these protrusions was the of Cdc42 is not the cytoplasmic domain of VE-cadherin The factor is at the cell-cell junctions of epithelial cells and of cells the epithelial barrier J.P. van R.A. F. J.G. 1997; PubMed Scopus Google Scholar). is possible that a factor may be at the VE-cadherin cytoplasmic domain that activation of Cdc42 in to the plasma membrane. To the that formation of membrane protrusions induced by the VE-cadherin cytoplasmic domain is not to a endothelial cell we also primary endothelial cells with of long membrane protrusions was after of the that at a mutant expression was Thus, it is that the protrusions were the of of the transfected In a the expression of a binding J. Cell Biol. 1993; PubMed Scopus Google did not endothelial cell In expression of VE-cadherin cytoplasmic domain in type epithelial cells also to membrane protrusions, that the is endothelial The is with in cultured epithelial cells that expression of or mutant to a cell A.J. Watt F.M. J. Cell Sci. 1996; 109: 3013-3023Crossref PubMed Google Scholar, M. S. J. Cell Sci. 1996; 109: PubMed Google Scholar). is well that cadherin and associated catenins signaling (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Abstract Full Text Full Text PDF PubMed Scopus (1061) Google Scholar, 9Hoschuetzky H. Aberle H. Kemler R. J. Cell Biol. 1994; 127: 1375-1380Crossref PubMed Scopus (673) Google Scholar,10Pece S. Chiariello M. Murga C. Gutkind J.S. J. Biol. Chem. 1999; 274: 19347-19351Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). In the present study, we that non-junctional VE-cadherin signaling endothelial cells, which in a cell formation of membrane that may junctional after the loss of homotypic VE-cadherin adhesion. and directly with cadherins at well cytoplasmic M.G. Corada M. L. Breviario F. O. B. Dejana E. J. Cell Biol. 1995; PubMed Scopus Google Scholar, M. H. Kemler R. J. PubMed Scopus Google Scholar). association with VE-cadherin may be in the formation of membrane protrusions, we role by the VE-cadherin cytoplasmic domain mutants lacking either β-catenin or binding domain of in cadherin cytoplasmic domain was in association with β-catenin Cell. 2001; Full Text Full Text PDF PubMed Scopus Google a is required for this association H. A. Kemler R. J. J. Biol. Chem. 2000; Full Text Full Text PDF PubMed Scopus Google Scholar, Cell. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar). Expression of a in which this was the binding of this mutant to β-catenin without the thus, it is that mutant was inserted in the membrane in its We that the expression of induced the activation of Cdc42 in endothelial cells, this mutant in the formation of structures to induced by expression of the Cdc42 VE-cadherin lacking the β-catenin binding site is to formation of the membrane protrusions with the expression of cytoplasmic domain of VE-cadherin. is that β-catenin the association of actin cytoskeleton with cadherin through the actin binding proteins α-catenin M. H. Kemler R. J. PubMed Scopus Google and M. B.M. M. J. Cell Biol. 1998; PubMed Scopus Google thus, β-catenin a role as a of cadherin with The in cell induced by can be by the of association in the actin may to to in to form the long membrane protrusions. it is possible that may also to the formation of membrane protrusions, we expressed a VE-cadherin mutant that was to with of to binding to VE-cadherin with studies J.M. Wheelock M.J. Johnson K.R. J. Cell Biol. 2000; 148: PubMed Scopus Google Scholar). the expression of mutant in a as that the association is not for In studies we compared the results of the mutant with lacking at the binding domain. mutant did not at the membrane, and it also to the cell Thus, these results suggest that of VE-cadherin at the membrane is required for the formation of membrane protrusions. In expression of was shown to membrane protrusions in and epithelial cells or D.J. Y. Nat. Cell Biol. 2000; PubMed Scopus Google Scholar, K. B. J. Cell Biol. 2000; PubMed Scopus Google Scholar). The expression of in K. B. J. Cell Biol. 2000; PubMed Scopus Google Scholar) that expression in and Cdc42 activation and that with the factor a role of in and Cdc42 D.J. Y. Nat. Cell Biol. 2000; PubMed Scopus Google Scholar) that the be the of and the loss of and of family proteins in the studies suggest that signaling was in the results in endothelial cells that VE-cadherin is involved in Cdc42 activation at the plasma membrane, they not a regulation of in the induced by In the present study, we for the role of VE-cadherin in the formation of long protrusions in endothelial cells. that membrane protrusions form as a of actin through Cdc42 activation and the of the actin to the VE-cadherin cytoplasmic domain. proteins associated with are necessary for the of actin cytoskeleton after Cdc42 The role of VE-cadherin cytoplasmic domain in Cdc42 activation and formation of actin cytoskeleton may be in the of junctions and restoration of endothelial barrier function upon the loss of junctional We to P. for E. Dejana for the human VE-cadherin T. and T. for and Cdc42 negative and G. for