Rev Binds Specifically to a Purine Loop in the SL1 Region of the HIV-1 Leader RNA

Abstract

The leader RNA sequence of human immunodeficiency virus type 1 (HIV-1) consists of a complex series of stem loop structures that are critical for viral replication. Three-dimensional structural analysis by NMR of one of these structures, the SL1 stem loop of the packaging signal region, revealed a highly conserved purine rich loop with a structure nearly identical to the Rev-binding loop of the Rev response element. Using band-shift assays, surface plasmon resonance, and further NMR analysis, we demonstrate that this loop binds Rev. HIV-1 appears to have a second Rev-binding site close to the major splice donor site that may have an additional role in the viral life cycle. The leader RNA sequence of human immunodeficiency virus type 1 (HIV-1) consists of a complex series of stem loop structures that are critical for viral replication. Three-dimensional structural analysis by NMR of one of these structures, the SL1 stem loop of the packaging signal region, revealed a highly conserved purine rich loop with a structure nearly identical to the Rev-binding loop of the Rev response element. Using band-shift assays, surface plasmon resonance, and further NMR analysis, we demonstrate that this loop binds Rev. HIV-1 appears to have a second Rev-binding site close to the major splice donor site that may have an additional role in the viral life cycle. Human immunodeficiency virus type 1 (HIV-1), 1The abbreviations used are: HIV, human immunodeficiency virus; RRE, Rev response element; NOE, nuclear Overhauser effect; NOESY, nuclear Overhauser effect spectroscopy; ROESY, rotating Overhauser effect spectroscopy; TOCSY, total correlation spectroscopy.1The abbreviations used are: HIV, human immunodeficiency virus; RRE, Rev response element; NOE, nuclear Overhauser effect; NOESY, nuclear Overhauser effect spectroscopy; ROESY, rotating Overhauser effect spectroscopy; TOCSY, total correlation spectroscopy. the causative agent of AIDS, is classified as a complex retrovirus that uses a group of regulatory and accessory proteins to control its life cycle and to influence cellular function. The unspliced genomic RNA of the virus has been shown to contain a large number of cis-acting sequences that influence transcription, splicing, intracellular transport, genome dimerization, and packaging. The leader region in particular is highly structured and has been extensively studied by a number of different groups to attempt to analyze both the structures and their functional significance. One function that has been consistently ascribed to the leader is the presence of a sequence that is used to identify the RNA genome for encapsidation into the viral particle. This is termed the packaging signal, abbreviated as the Greek letter ψ. The encapsidation signal must distinguish the genomic RNA from viral as well as cellular messages. In HIV-1, using deletion mutagenesis, we identified a region involved in packaging (1Lever A. Gottlinger H. Haseltine W. Sodroski J. J. Virol. 1989; 63: 4085-4087Crossref PubMed Google Scholar) that was confirmed by other groups (2Aldovini A. Young R.A. J. Virol. 1990; 64: 1920-1926Crossref PubMed Google Scholar, 3Clavel F. Orenstein J.M. J. Virol. 1990; 64: 5230-5234Crossref PubMed Google Scholar). Since that time, a number of other regions inside and outside of the leader region have been implicated in packaging although largely in an enhancing role (4Russell R.S. Hu J. Beriault V. Mouland A.J. Kleiman L. Wainberg M.A. Liang C. J. Virol. 2003; 77: 84-96Crossref PubMed Scopus (61) Google Scholar, 5Clever J.L. Eckstein D.A. Parslow T.G. J. Virol. 1999; 73: 101-109Crossref PubMed Google Scholar, 6McBride M.S. Panganiban A.T. J. Virol. 1996; 70: 2963-2973Crossref PubMed Google Scholar, 7McBride M.S. Schwartz M.D. Panganiban A.T. J. Virol. 1997; 71: 4544-4554Crossref PubMed Google Scholar, 8Kim H.J. Lee K. O'Rear J.J. Virology. 1994; 198: 336-340Crossref PubMed Scopus (65) Google Scholar). Secondary structure analysis of the ψ region identified a series of conserved stem loops, and disruptive and compensatory mutation confirmed the importance of these structures in retaining packaging function (Fig. 1) (9Harrison G.P. Lever A.M.L. J. Virol. 1992; 66: 4144-4153Crossref PubMed Google Scholar). NMR-derived three-dimensional structures of the SL3 region have been published with and without complexed viral nucleocapsid protein (10Zeffman A. Hassard S. Varani G. Lever A.M.L. J. Mol. Biol. 2000; 297: 877-893Crossref PubMed Scopus (71) Google Scholar, 11De Guzman R.N. Wu Z.R. Stalling C.C. Pappalardo L. Borer P.N. Summers M.F. Science. 1998; 279: 384-388Crossref PubMed Scopus (609) Google Scholar). In addition, NMR analysis of the major splice donor loop (SL2) and a fourth loop of uncertain functional significance (SL4) have been published (12Amarasinghe G.K. De Guzman R.N. Turner R.B. Chancellor K.J. Wu Z.R. Summers M.F. J. Mol. Biol. 2000; 301: 491-511Crossref PubMed Scopus (310) Google Scholar, 13Amarasinghe G.K. De Guzman R.N. Turner R.B. Summers M.F. J. Mol. Biol. 2000; 299: 145-156Crossref PubMed Scopus (93) Google Scholar, 14Amarasinghe G.K. Zhou J. Miskimon M. Chancellor K.J. McDonald J.A. Matthews A.G. Miller R.R. Rouse M.D. Summers M.F. J. Mol. Biol. 2001; 314: 961-970Crossref PubMed Scopus (77) Google Scholar). The first stem loop in the packaging region (SL1) has been the subject of intense analysis because of its involvement in the dimerization process of the genomic RNA facilitated through the “kissing” interaction of the palindromic sequences at the tip (15Clever J.L. Parslow T.G. J. Virol. 1997; 71: 3407-3414Crossref PubMed Google Scholar). Proximal to the terminal loop of SL1, there is a second loop structure consisting of an AGG triplet opposite a single bulged G residue. This region is 100% conserved in all HIV-1 sequences so far identified and is thought to be important in the viral life cycle and, in particular, is thought to be critical for the occurrence of dimer linkage (15Clever J.L. Parslow T.G. J. Virol. 1997; 71: 3407-3414Crossref PubMed Google Scholar). Proximal to this loop, the predicted structures differ between different groups. We demonstrated previously that a further loop (loop A) could be identified by biochemical analysis, phylogenetic comparison, and free energy minimization, and that sequential truncation of SL1 showed a progressive decline in virus viability, culminating in complete loss when loop A was removed (16Harrison G.P. Miele G. Hunter E. Lever A.M.L. J. Virol. 1998; 72: 5886-5896Crossref PubMed Google Scholar). We recently published NMR evidence supporting this secondary structure (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar). Loop A consists of an AGGA facing a GG and is, again, 99% conserved in all known HIV-1 sequences and 100% conserved in known viable isolates. Intriguingly, the three-dimensional structure of this loop was found to be superimposable on another loop, that of the high affinity nucleation site of Rev on the Rev response element (RRE) found within the envelope gene sequence (18Battiste J.L. Mao H. Rao N.S. Tan R. Muhandiram D.R. Kay L.E. Frankel A.D. Williamson J.R. Science. 1996; 273: 1547-1551Crossref PubMed Scopus (540) Google Scholar, 19Dale T. Smith R. Serra M.J. RNA (N. Y.). 2000; 6: 608-615Crossref PubMed Scopus (44) Google Scholar). The Rev-RRE interaction is a vital part of the virus life cycle involved in the switch from early to late gene expression. Rev-RRE binding permits nuclear export of the unspliced and singly spliced viral messages (20Cullen B.R. Microbiol. Rev. 1992; 56: 375-394Crossref PubMed Google Scholar). Rev also has been suggested to have additional effects such as enhancement of translation and packaging (21Kaye J.F. Richardson J.H. Lever A.M. J. Virol. 1995; 69: 6588-6592Crossref PubMed Google Scholar). It was, therefore, of great interest to determine whether the novel RNA structure we had identified in the leader region had the capability of binding Rev and whether that binding could be shown to be specific and to involve analogous nucleotide-amino acid interactions to those identified previously in the Rev·RRE complex. Proteins and Peptides—Recombinant Rev protein was obtained either from Bachem AG or through the European Union Program Centralized Facility for AIDS Reagents, National Institute for Biological Standards and Control, UK (Grants QLKZ-CT-1999-00689 and CP8228102). Both comprised His-tagged bacterially produced proteins, which on gel analysis were monocomponent. It was used at a final concentration of 100 ng/μl. Recombinant Gag protein was generated in vitro in Escherichia coli as described previously (10Zeffman A. Hassard S. Varani G. Lever A.M.L. J. Mol. Biol. 2000; 297: 877-893Crossref PubMed Scopus (71) Google Scholar). It was used at a final concentration of 200 ng/μl. The HIV-1 Rev peptide TRQARRNRRRRWRERQR, corresponding to the arginine-rich 34-50 amino acid region of the Rev protein, was purchased from Bachem AG and microdialyzed against an aqueous solution containing 20 mm NaCl, 10 mm sodium phosphate (pH 6), and 0.1 mm EDTA. Short peptides corresponding to the arginine-rich RNA-binding domain of Rev have been shown previously to have good solubility properties and to bind specifically to stem-loop IIB of the RRE with similar affinity (18Battiste J.L. Mao H. Rao N.S. Tan R. Muhandiram D.R. Kay L.E. Frankel A.D. Williamson J.R. Science. 1996; 273: 1547-1551Crossref PubMed Scopus (540) Google Scholar, 22Kjems J. Calnan B.J. Frankel A.D. Sharp P.A. EMBO J. 1992; 11: 1119-1129Crossref PubMed Scopus (186) Google Scholar, 23Gosser Y. Hermann T. Majumdar A. Hu W. Frederick R. Jiang F. Xu W. Patel D.J. Nat. Struct. Biol. 2001; 8: 146-150Crossref PubMed Scopus (57) Google Scholar) Monoclonal Antibodies—Monoclonal antibodies directed against HIV-1 Rev or HIV-1 Gag protein (p24 region) were obtained from the Centralized Facility for AIDS Reagents at National Institute for Biological Standards and Control as described above. DNA Preparation—DNA for in vitro transcription was prepared by polymerase chain reaction (PCR) amplification from the leader sequence of wild-type HXBc2 DNA and from a series of deletion mutants A1, A2, and A3 that sequentially truncate the SL1 sequence and that have been published previously (Fig. 5) (16Harrison G.P. Miele G. Hunter E. Lever A.M.L. J. Virol. 1998; 72: 5886-5896Crossref PubMed Google Scholar). The primers used for amplification were: forward, TAATACGACTCACTATAGGAAACCAGAGGAGC; reverse, CTCTCTCCTTCTAGCCTCCGC (Sigma Genosys). These generated the packaging signal region downstream of a T7 promoter sequence. The GGGG mutant of loop A was generated by PCR mutagenesis of the leader region in a DNA subclone and recloning of this region into the provirus. Dideoxy sequencing confirmed the integrity of the mutation in the provirus. The GGA mutant of loop B was used as a control for loop A in NMR studies and was generated in a similar fashion. DNA templates used for run-off transcription in preparation of NMR constructs were as described previously (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar). In Vitro Transcription—RNA for in vitro experiments was prepared, according to the manufacturer's instructions, from PCR-derived DNA templates of the intact and mutated HIV leader region or from the HIV-1 RRE region using T7 RNA polymerase and the Ribomax reagents (Ambion). [α-32P]UTP (ICN) was incorporated into the RNA, and the labeled RNA was purified on a G25 column (Roche Diagnostics). For NMR, the first two nucleotides at the 5′ end of each DNA template had 2′-O-methyl modifications to increase the yield and purity of the transcripts (24Kao C. Zheng M. Rudisser S. RNA (N. Y.). 1999; 5: 1268-1272Crossref PubMed Scopus (240) Google Scholar). The RNAs were purified by denaturing polyacrylamide gel electrophoresis as described (25Price S.R. Evans P.R. Nagai K. Nature. 1998; 394: 645-650Crossref PubMed Scopus (307) Google Scholar). All samples were microdialyzed against aqueous solutions with 20 mm NaCl, 10 mm phosphate buffer (pH 6), and 0.1 mm EDTA. The final RNA concentration in the samples was 0.7 mm in 300 μl of D2O or H2O with 10% D2O. RNA Protein Band Shifts—Purified RNA and Rev protein were incubated together for 15 min at room temperature in the presence of tRNA to prevent nonspecific binding in binding buffer (50 mm Tris, pH 8, 50 mm NaCl, 100 μm ZnCl2,5mm dithiothreitol) and then loaded onto 12.5% polyacrylamide gels and run at 100 mA. Where supershift assays were used, the monoclonal antibody was incubated after the initial Rev-RNA interaction for 30 min on ice prior to loading on the gel. Gels were removed and dried and exposed initially for 30 min and then subsequently for 12-72 h on x-ray film. NMR and Rev peptide solutions were microdialyzed against the solution above. the by the were by Rev peptide to the RNA samples and the effect on the RNA by NMR spectroscopy. the of the final complex samples were microdialyzed against the solution NMR were on and and using or were to an after of the with and and (50 with were obtained at different and were also in D2O. plasmon experiments were on a HIV Rev was to the on the surface of amino groups using the as directed (20Cullen B.R. Microbiol. Rev. 1992; 56: 375-394Crossref PubMed Google Scholar) with the the purified HIV Rev was at in 10 mm sodium (pH for response of HIV Rev were by the of the from to 15 all experiments were at a of 20 at using obtained as the buffer mm pH mm and with mm The binding were of of loop A RNA by 1 of and the using Rev to the SL1 Rev be to a RNA that is when the deletion which SL1, is SL1 RNA in is to this RNA RRE RNA also the binding when in (Fig. Rev binds to the intact sequence when the SL1 region is and be by another RNA with the Rev response element the A complex. RRE presence of RRE of the complex with monoclonal antibody to Rev a supershift of the complex (Fig. nonspecific protein binding a control antibody that binds to HIV-1 Gag was used, and this a supershift of the complex. The RNA that is in the presence of Rev is a complex and an effect of Rev on RNA structure in a nonspecific fashion. of SL1 to of Rev series of RNAs was produced corresponding to those used in previously published packaging studies (16Harrison G.P. Miele G. Hunter E. Lever A.M.L. J. Virol. 1998; 72: 5886-5896Crossref PubMed Google Scholar). A3 the terminal further SL1 to the first loop (loop A and All a sequence at the tip of the the effects of the on binding of Rev and Gag Gag bind to the SL3 region, which is in all the The gel that A3 and bind although the is the wild-type The as shown Rev binding although retaining to bind The the loop A region as the influence on binding Rev. A of Loop A Rev mutation of SL1, which be predicted to have effect on the structure of the region, was This two A for two G in loop A such that the structure GGGG of AGGA GG (Fig. Using with RNA to the affinity of the mutant sequence with that of wild-type band-shift analysis that this mutant has a affinity for and or and (Fig. NMR Rev to Loop of the 34-50 Rev in the of an RNA containing loop A are for by with the corresponding in the RNA previously by NMR (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar) (Fig. is also for all RNA in the and These Rev peptide binding to similar in the RNA were also for the interaction J.L. Tan R. Frankel A.D. Williamson J.R. 1994; PubMed Scopus Google Scholar, J. 1994; PubMed Scopus Google Scholar). The a be and together with the and of this complex. A number of and could be obtained for RNA nucleotides stem and and peptide and The RNA to the when to similar and for the and stem nucleotides are as well as a between and within loop A previously in the (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar). between RNA and peptide and are in the These interactions Rev binding to the the of the we also studied the interaction of Rev peptide with another SL1 RNA containing mutant loop B of loop A. with loop loop B is and the was also by NMR in (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar). are at the of the these are for loop affinity of the Rev peptide for this purine rich of peptide to the loop complex further or These the of Rev binding to loop A loop B in the SL1 of Rev for Loop on the NMR of free and in complex with Rev the RNA and the complex are in on the of (Fig. that are by to the of free of the are by 0.1 (50 at the loop A is 100 a this that the be The for and RNA of Rev also a in the μm of Rev loop B showed interaction between these two that the loop A interaction was specific and a nonspecific purine interaction with an arginine-rich peptide as The affinity of Rev for loop A has also been using surface plasmon of the obtained that the interaction is by on and analysis of binding to for the of 1 and μm from on with of HIV Rev (Fig. The affinity of Rev peptide against purified loop A RNA was also using band-shift assays and RNA with known of This was using and a of μm the we previously that loop A of the HIV-1 leader RNA a Rev-binding (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar). We have shown by band-shift assays that Rev binds specifically to this the and interactions by NMR are all with binding of the Rev peptide to an SL1 containing loop A. A of the Rev peptide interaction with a similar RNA containing a different that the A interaction is the band-shift and an NMR at there is good between and those of J.L. Tan R. Frankel A.D. Williamson J.R. 1994; PubMed Scopus Google Scholar) and J. 1994; PubMed Scopus Google also and in the of nucleotides to the Rev-binding of the for a NMR of the interaction between loop A and the 34-50 Rev peptide or is in The SL1 loop is in the with the novel purine which the RRE after interaction with Rev (17Greatorex J. Gallego J. Varani G. Lever A. J. Mol. Biol. 2002; 322: 543-557Crossref PubMed Scopus (50) Google Scholar). It was therefore, that the affinity for binding of Rev to loop A be different from that of the RRE because the interaction be to have a different the Rev-RRE we evidence for a single binding of although the to increase Rev concentration to evidence of or binding The of SL1 may further Rev the The affinity for loop A with the RRE of because both the band-shift and the NMR of loop A to loop B binding of Rev demonstrate binding to this region in the of both and a in vitro the binding of Rev to loop A and loop B are as The Rev-RRE is a studied and highly for RNA from to has had a number of other properties ascribed to was to two that of RNA as well as nuclear may that the export function to by of the RNA from the Rev has also been to RNA loading on for translation Mol. Biol. 1992; PubMed Scopus Google Scholar). In the we have shown that the RRE region RNA packaging and a previously RNA for encapsidation (21Kaye J.F. Richardson J.H. Lever A.M. J. Virol. 1995; 69: 6588-6592Crossref PubMed Google Scholar). a role for Rev in packaging has been implicated in studies in which nuclear export from different such as the virus element and the response have been incorporated into constructs and each shown to nuclear export of RNA as as Rev-RRE A. H. M. J. C. Mol. 2000; PubMed Scopus Google Scholar). The Rev-RRE to packaging in to This has to the of a for RNA as a the of a RNA with Gag protein and other viral and cellular to The of a Rev-binding structure in the HIV-1 leader This of the RNA has been by a number of and the nucleotides on be into a number of different (9Harrison G.P. Lever A.M.L. J. Virol. 1992; 66: 4144-4153Crossref PubMed Google Scholar, J. C. Parslow T.G. J. Virol. 1995; 69: PubMed Google Scholar). is evidence that the leader of HIV-1 and may through the structures, which or dimerization and packaging H. RNA (N. Y.). 2001; PubMed Scopus Google Scholar, H. 2002; PubMed Scopus Google Scholar, A.M. H. J. 2002; PubMed Scopus (44) Google Scholar). We have demonstrated that the leader its when the Gag protein binds to the RNA, the regions and Gag protein to bind the RNA, which then as a element in viral (10Zeffman A. Hassard S. Varani G. Lever A.M.L. J. Mol. Biol. 2000; 297: 877-893Crossref PubMed Scopus (71) Google Scholar). on the leader have to different structural and M. H. E. K. J. Biol. 2002; PubMed Scopus Google Scholar) have used their to a structure in which the of the stem the site is and to using that we to be involved in SL1 J.L. Parslow T.G. J. Virol. 2002; PubMed Scopus Google Scholar) have also studied this region with mutagenesis and have that there is evidence for this site that the we identify as in loop A are critical for RNA packaging. has suggested that the loop A we described and using NMR is on phylogenetic J. Biol. 2003; PubMed Scopus Google Scholar). the regions on either of loop A are conserved in HIV-1 and the are 100% conserved in 99% of all and because the are is to the for this We that the structure from a of phylogenetic analysis, free energy minimization, and biochemical which we initially this region) has been by an structural solution and by Rev This a that the we (9Harrison G.P. Lever A.M.L. J. Virol. 1992; 66: 4144-4153Crossref PubMed Google Scholar, G.P. Miele G. Hunter E. Lever A.M.L. J. Virol. 1998; 72: 5886-5896Crossref PubMed Google Scholar) as a functional and, in particular, that loop A and that Rev binds specifically to It is also that a NMR analysis of the loop B region additional for published previously Y. D.J. M.F. Borer P.N. 2003; PubMed Scopus Google Scholar). The function for Rev binding to SL1 is as although to one other group has also found evidence for Rev binding in this A is that Rev to export of both spliced and unspliced viral through its loop A interaction in the early of the viral life cycle that the affinity interaction with the RRE when Rev has in the to bind in a to the This a switch from early to late gene on affinity and of Rev proteins and is a that be This also an with other RNA export in other in which all of the messages have an export signal on such as the virus element M. S. Hunter E. S. A. 1994; PubMed Scopus Google Scholar). The of loop A to the major splice donor the effect of Rev on a packaging function may also be Rev binding to SL1 has important for on the specific role may have in the life cycle of the be in the of Rev that may be critical for this in the of wild-type virus there may be an important role for Rev in the leader that a further for is to this and to analogous structures in other with