Developmental Phenotype of a Membrane Only Estrogen Receptor α (MOER) Mouse

Abstract

Estrogen receptors (ERs) α and β exist as nuclear, cytoplasmic, and membrane cellular pools in a wide variety of organs. The relative contributions of each ERα pool to in vivo phenotypes resulting from estrogen signaling have not been determined. To address this, we generated a transgenic mouse expressing only a functional E domain of ERα at the plasma membrane (MOER). Cells isolated from many organs showed membrane only localized E domain of ERα and no other receptor pools. Liver cells from MOER and wild type mice responded to 17-β-estradiol (E2) with comparable activation of ERK and phosphatidylinositol 3-kinase, not seen in cells from ERαKO mice. Mating the MOER female mice with proven male wild type breeders produced no pregnancies because the uterus and vagina of the MOER female mice were extremely atrophic. Ovaries of MOER and homozygous Strasbourg ERαKO mice showed multiple hemorrhagic cysts and no corpus luteum, and the mammary gland development in both MOER and ERαKO mice was rudimentary. Despite elevated serum E2 levels, serum LH was not suppressed, and prolactin levels were low in MOER mice. MOER and Strasbourg female mice showed plentiful abdominal visceral and other depots of fat and increased body weight compared to wild type mice despite comparable food consumption. These results provide strong evidence that the normal development and adult functions of important organs in female mice requires nuclear ERα and is not rescued by membrane ERα domain expression alone. Estrogen receptors (ERs) α and β exist as nuclear, cytoplasmic, and membrane cellular pools in a wide variety of organs. The relative contributions of each ERα pool to in vivo phenotypes resulting from estrogen signaling have not been determined. To address this, we generated a transgenic mouse expressing only a functional E domain of ERα at the plasma membrane (MOER). Cells isolated from many organs showed membrane only localized E domain of ERα and no other receptor pools. Liver cells from MOER and wild type mice responded to 17-β-estradiol (E2) with comparable activation of ERK and phosphatidylinositol 3-kinase, not seen in cells from ERαKO mice. Mating the MOER female mice with proven male wild type breeders produced no pregnancies because the uterus and vagina of the MOER female mice were extremely atrophic. Ovaries of MOER and homozygous Strasbourg ERαKO mice showed multiple hemorrhagic cysts and no corpus luteum, and the mammary gland development in both MOER and ERαKO mice was rudimentary. Despite elevated serum E2 levels, serum LH was not suppressed, and prolactin levels were low in MOER mice. MOER and Strasbourg female mice showed plentiful abdominal visceral and other depots of fat and increased body weight compared to wild type mice despite comparable food consumption. These results provide strong evidence that the normal development and adult functions of important organs in female mice requires nuclear ERα and is not rescued by membrane ERα domain expression alone. Estrogen receptor (ER) 3The abbreviations used are: ER, estrogen receptor; WT, wild type; ERK, extracellular signal-regulated kinase; PI3K, phosphatidylinositol 3-kinase; KO, knock-out; FITC, fluorescein isothiocyanate; LH, leuteinizing hormone; FSH, follicle-stimulating hormone; RT, reverse transcription; ERE, estrogen response element. α exists in many cellular locations, each potentially contributing to sex steroid action (1Levin E.R. Mol. Endocrinol.. 2005; 19: 1951-1959Google Scholar). Genetic deletion of ERα in mice established important roles of this receptor for normal adult female mammary gland and reproductive tract development and function (2Lubahn D.B. Moyer J.S. Golding T.S. Couse J.F. Korach K.S. Smithies O. Proc. Natl. Acad. Sci. U. S. A.. 1993; 90: 11162-11166Google Scholar, 3Bocchinfuso W.P. Lindzey J.K. Hewitt S.C. Clark J.A. Myers P.H. Cooper R. Korach K.S. Endocrinology.. 2000; 141: 2982-2994Google Scholar, 4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google Scholar). In these regards, adult female ERα knock-out (KO) mice show atrophy of the uterus and vagina, abnormal ovarian histology, and rudimentary mammary gland development. As a result, the normal adult functions of these organs were markedly compromised, and many of these abnormalities were phenocopied by aromatase knock-out mice (5Simpson E.R. Semin. Reprod. Med.. 2004; 22: 25-30Google Scholar). Thus, estrogen or its metabolites acting at ERα is necessary for these normal developmental functions. Since the original descriptions of both the Chapel Hill (2Lubahn D.B. Moyer J.S. Golding T.S. Couse J.F. Korach K.S. Smithies O. Proc. Natl. Acad. Sci. U. S. A.. 1993; 90: 11162-11166Google Scholar) and Strasbourg (4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google Scholar) ERαKO mice, it has become appreciated that these mice represent depletion of all ERα cellular pools. For instance, endothelial cells derived from homozygous ERα/ERβ combined deletion mice show no evidence of any cellular ER (6Pedram A. Razandi M. Levin E.R. Mol. Endocrinol.. 2006; 20: 1996-2009Google Scholar). Furthermore, E2 cannot rapidly signal nor stimulate proliferation and survival in these cells. Thus, in ERαKO mice, it cannot be determined where estrogen acts in the cell to effect normal development and function. This limits understanding of what specific actions occur through discrete ERα pools, contributing to the overall effects of this receptor in vivo. To begin to address this issue we generated a mouse that expresses a functional E domain of ERα only at the plasma membrane of cells from multiple organs. No cytoplasmic or nuclear ERα were found in any cells from this membrane only E domain of ERα (MOER) mouse. This allowed us to investigate possible roles of membrane ERα in normal female reproductive tract and mammary gland development and function in this model in mice lacking nuclear ERα. Materials—All of the antibodies were from Santa Cruz except FITC-conjugated antibodies (Vector Laboratories) and the C-terminal ERα antibody (Abcam). Enzyme-linked immunosorbent assay kits for leuteinizing hormone (LH), follicle-stimulating hormone (FSH), prolactin, growth hormone, insulin-like growth factor 1, and E2 were from Diagnostic Systems Laboratories, Inc. and R & D Systems. Generation of MOER Mice—The E domain of ERα was amplified by PCR from a full-length human ERα-containing plasmid (pcDNA3-hERα) and cloned into the multiple cloning site of the pECFP-mem plasmid (Clontech), with slight changes from previously described methods (7Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell.. 2001; 104: 719-730Google Scholar). This plasmid has extensively been expressed in cells, and the E domain of ERα localizes only to the plasma membrane because of multiple palmitoylation sites from the neuromodulin protein cloned into the parent plasmid (7Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell.. 2001; 104: 719-730Google Scholar, 14Quyyumi A.A. J. Am. Coll Cardiol.. 2006; 47: S66-S71Google Scholar). The construct was injected into fertilized CB6F1 mouse oocytes and implanted into pseudopregnant female mice. Founder transgenic mice were first identified by PCR of tail snip DNA, confirmed by PCR of DNA extracted from multiple organs, using the primers 5′-CGTGTACGGTGGGAGGTCTA-3′ (forward) and 5′-ATGTGAACCAGCTCCCTGTC-3′ (reverse). The PCR amplification conditions were 94 °C for 5 min, 30 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min, followed by 72 °C for 5 min. This produced a 226-bp product composed of both plasmid and E domain sequences and was confirmed by sequencing. The transgenic mice were then bred to Strasbourg ERαKO heterozygous mice (kindly obtained from Dr. Pierre Chambon, INSERM, France, and through Dr. Michael Mendelsohn, Tufts University), and the resulting compound mice were bred to each other, creating MOER mice (see Fig. 1A). Deletion of full-length ERα was confirmed by PCR of tail DNA, as described (4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google Scholar). Briefly, two primer sets were used to yield different product patterns, identifying either homozygous or heterozygous deletion of ERα. Homozygous deletion (ERα–/–) is indicated by the absence of a PCR product with primers P1 and P2 (5′-TTGCCCGATAACAATAACAT-3′ and 5′-ATTGTCTCTTTCTGACAC-3′, respectively) and a 255-bp product with primers P3 and P4 (5′-GGCATTACCACTTCTCCTGGGAGTCT-3′ and 5′-TCGCTTTCCTGAAGACCTTTCATAT-3′, respectively). Tail DNA samples from heterozygous ERα (ERα+/–) mice produce a 387-bp band with P1 and P2 and a 255-bp band with P3 and P4. Wild type mice (ERα+/+) DNA yield a 387-bp band with P1 and P2, and an 815-bp band with P3 and P4 as primers. Establishing transgene expression in the organs of MOER mice was done by RT-PCR. Total RNA was isolated from various organs and used for cDNA synthesis, followed by PCR with the primers described for genotyping. To quantify the transgene expression, RNA was extracted from the various organs, and cDNA synthesis was performed. Real time PCR was carried out using the cDNA with SYBR® GreenER™ qPCR SuperMix for the iCycler (Invitrogen) according to the manufacturer's manual. The melting curve analysis was performed following real time PCR to ensure specificity of the reaction and identify the presence of primer dimers. The forward and reverse primer sequence to detect the E domain were: 5′-AGCACCCTGAAGTCTCTGGA-3′ and 5-GATGTGGGAGAGGATGAGGA-3′, respectively. The change in gene expression was calculated using the ΔΔCt method with glyceraldehyde-3-phosphate dehydrogenase as the internal control. Cell Culture—Mouse hepatocytes were isolated from 6–12-week-old female C57 Black/J6 (WT), MOER, and ERαKO mice by enzymatic and mechanical methods and established as primary cultures for experiments. In addition, thin tissue sections of mammary gland, uterus, vagina, and ovary were prepared for immunohistochemistry. Microscopy—Tissues from the various mice or hepatocytes cultured on glass slides were incubated with antibodies to the E/F or A/B domains of ERα (Santa Cruz Biotechnology) overnight at 4 °C. This was followed by second antibody conjugated to FITC (Vector Laboratories) for imaging by immunofluorescent confocal microscopy. Cytokeratin 8 antibody (epithelial cell marker) was from Santa Cruz Biotechnology. Kinase and pS2 Gene Expression Assays—ERK and PI3K assays in primary cultures of liver cells from all mice were carried out as previously described (6Pedram A. Razandi M. Levin E.R. Mol. Endocrinol.. 2006; 20: 1996-2009Google Scholar, 8Razandi M. Pedram A. Parks S. Levin E.R. J. Biol. Chem.. 2003; 278: 2701-2712Google Scholar). Immunoblots for total ERK or AKT serve as loading controls. RT-PCR for pS2 gene expression was carried out from the DNA of cells not exposed (control) or exposed to10 nm E2 for 24 h. Primers used were pS2, 5′-ATACCATCGACGTCCCTCCA and AAGCGTGTCTGAGGTGTCCG and for control glyceraldehyde-3-phosphate dehydrogenase expression, 5′-AGCCACATCGCTCAGAACAC and GAGGCATTGCTGATGATCTTG. Tissue and Blood Collection and Histology—Prior to ovariectomy, mice underwent daily vaginal lavage for cell cytology, sequentially over several weeks. Organs and fat were obtained under anesthesia and just before euthanasia of the mice, in compliance with studies approved by the and and at the mammary and were in before tissue and the sections were with and or antibodies for immunofluorescent microscopy. The samples for hormone assay were obtained by (WT), followed by euthanasia of the mice. to female mice were for 1 and then of E2 in or (control) by daily for the E2 the vagina and uterus from each mouse was and The tissue sections were for and or For slides were in (Vector Laboratories) and for min. The sections were incubated overnight at 4 °C with the primary in or a control and in The sections were then with antibody for at and under microscopy. was using Cytokeratin is a of in vaginal was mice from each and were then by using a and Systems The of sets of for each combined to imaging with a fat and were of each and each was For the were a to the that the of fat This was for each for was of the was by the fat and to for the in relative the fat and The were over the for each to a total of fat and These two were then by the of the two to a fat and the is the fat fat in and depots were for fat was out and for the mice of food in and weight change over a was in mice from each and the for each of mice were compared by analysis of where was and of the MOER E domain of human ERα was cloned into a plasma membrane plasmid that a 1A). the plasmid in ER cells in plasma membrane of the E domain of ERα and signaling and cell effects (7Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell.. 2001; 104: 719-730Google Scholar, 8Razandi M. Pedram A. Parks S. Levin E.R. J. Biol. Chem.. 2003; 278: 2701-2712Google Scholar). signaling in these cells was comparable with the effects of E2 full-length ERα in cells M. Pedram A. Parks S. Levin E.R. J. Biol. Chem.. 2003; 278: 2701-2712Google Scholar). The construct was injected into fertilized CB6F1 mouse oocytes and implanted into pseudopregnant female mice. Expression of the E domain of ERα transgene in transgenic mice was confirmed in many organs by PCR of extracted DNA Fig. Founder transgenic mice were then bred to Strasbourg ERαKO heterozygous mice (4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google and the resulting compound mice were bred to each This a mouse that expresses the E domain of ERα at the plasma membrane on the of homozygous ERα deletion (MOER) 1A). Deletion of full-length ERα and expression of the E domain of ERα transgene in MOER mice was confirmed by PCR using tail DNA, as previously described 4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google and Fig. To the mouse the liver was hepatocytes were isolated from MOER, Strasbourg or female mice, and primary cultures were This was possible because this was in all mice. of MOER mice only E domain of ERα and no ERα protein expression In Strasbourg ERαKO mice hepatocytes produced no ERα in the liver cells showed ERα in the localized at the plasma expression was comparable in all mouse cells not we found that ERK and activation in response to E2 in MOER or mouse liver cells not in Strasbourg ERαKO mouse cells These the first in vivo to that ERα the E activation by The pS2 gene is through an estrogen response in the the cells responded to E2 with increased expression nuclear ERα is for pS2 these results that MOER and ERαKO mice this receptor pool many organs for E domain of ERα transgene expression in the MOER mice. was transgene expression was in all organs This mammary gland, uterus, and various fat expression was by real time PCR expression was seen in mammary gland, and be that the transgene expression in liver was this was to produce functional protein expression and and female MOER mice were with C57 Black/J6 male proven Despite multiple no pregnancies The for the reproductive of the MOER female mice were The and of all of the female MOER mice were extremely and were comparable with these organs from homozygous Strasbourg ERαKO female mice Homozygous female Strasbourg ERαKO mice to be in because of the extremely uterus and vagina (4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google Scholar). in MOER mice was seen despite expression of the E domain of ERα at the membrane of cells from these organs In female mice the normal reproductive tract development then the of the mice. The E domain not of ERα was only identified at the membrane of cells in MOER ovarian showed nuclear and Strasbourg ERαKO mice no cellular ERα determined the transgene was expressed in cells of these organs that important for E2 As seen in Fig. ERα was found in the of ovarian and cells from female mice, identified by of these cells with the 8 In E domain of ERα protein expression in MOER mice was found at the membrane in cells with expression in the was female MOER and Strasbourg ERαKO mice showed multiple hemorrhagic cysts in the ovary Furthermore, was no evidence for corpus development. This that the mice not and not and we confirmed this by vaginal from MOER mice Fig. ovariectomy, the MOER nor the Strasbourg mice showed a vaginal response to estrogen In female mice responded to E2 with cell proliferation and and Fig. of E2 on LH and female mice showed of LH and by E2 levels in or by from the ovary The in serum from MOER and ERαKO mice produced markedly elevated serum that to This that for LH, the effects of E2 on the in the absence of nuclear ERα. ovariectomy, LH not change in MOER or in ERαKO mice markedly with a of and its on female mouse serum hormone growth factor for LH ERαKO or for prolactin for LH ERαKO or for E2 ERαKO or MOER by analysis of for LH ERαKO or for E2 ERαKO or MOER by analysis of for LH ERαKO or for prolactin for E2 ERαKO or MOER by analysis of in a growth factor 1 and growth hormone levels were not different the of mice and were by In E2 is to stimulate prolactin in and this through ERα Lindzey J. D.B. Korach K.S. Mol. Endocrinol.. Scholar). In mice, in a in serum prolactin was in both ERαKO or MOER mice, no effect of was This that nuclear ERα is important to the of prolactin by E2 in female mice. Furthermore, of the mammary in the two mice the of E2 action at the and prolactin levels, a hormone that with E2 in this in MOER mice have been to show mammary gland development in the adult W.P. Lindzey J.K. Hewitt S.C. Clark J.A. Myers P.H. Cooper R. Korach K.S. Endocrinology.. 2000; 141: 2982-2994Google Scholar). To membrane of the E domain of ERα this of the mammary of female MOER mice were compared with from Strasbourg or female mice. The membrane only of the E domain of ERα was in MOER mice mammary cells seen in tissue sections that showed with 8 expression Fig. nuclear ERα expression in cells was seen in tissue sections from mice Fig. ERαKO mice showed no ERα in any cell type the tissue sections not mice showed comparable rudimentary mammary gland development was in both MOER and Strasbourg mice, and were with development. ERα in mammary is for and in female mice, and deletion of this receptor normal mammary gland development and function and Proc. Natl. Acad. Sci. U. S. A.. 104: Scholar). results that the presence of nuclear ERα is for the normal development and of the mammary MOER the abdominal that is by estrogen K. Mol. Endocrinol.. 2001; and both ERα and aromatase female mice J.A. D.B. Proc. Natl. Acad. Sci. U. S. A.. 2000; Scholar, Hewitt J. S. E.R. Proc. Natl. Acad. Sci. U. S. A.. 2000; Scholar). first compared the abdominal fat of MOER, Strasbourg and female mice. In both visceral fat was seen and was mice Furthermore, body weight was increased by in MOER and Strasbourg mice, compared with mice. fat Fig. and fat were in both MOER and ERαKO mice compared with mice, and the two mice were studies were determined by imaging MOER and ERαKO mice overall body fat and compared with female mice. compared food in the mice over a 4 mice MOER, and mice 4 55 and 5 of respectively. Despite these the MOER and ERαKO mice each and 1 of body compared with by the mice for MOER or ERαKO by analysis of and These results that nuclear ERα is important to fat the and the absence of this receptor pool to weight abdominal visceral fat in to increased from and A.A. J. Am. Coll Cardiol.. 2006; 47: S66-S71Google body studies of fat and in female for MOER for ERαKO for MOER for MOER for ERαKO mouse. in a Strasbourg and Hill ERαKO female mice (2Lubahn D.B. Moyer J.S. Golding T.S. Couse J.F. Korach K.S. Smithies O. Proc. Natl. Acad. Sci. U. S. A.. 1993; 90: 11162-11166Google Scholar, 4Dupont S. Krust A. Gansmuller A. Dierich A. Chambon P. Mark M. Development.. 2000; 127: 4277-4291Google Scholar) and aromatase mice (5Simpson E.R. Semin. Reprod. Med.. 2004; 22: 25-30Google Scholar) have abnormalities of reproductive tract and mammary gland development and function. ERαKO mice show the of of LH, and body fat these represent total ERα Thus, the specific contributions from discrete cellular pools of ERα at the membrane or to normal development results provide the evidence to that nuclear ERα is for the normal female and that ERα is in this confirmed that the transgene was expressed in the organs of female MOER mice For transgene expression by real time PCR was strong in mammary gland, and where both MOER and ERαKO mice showed comparable Furthermore, transgenic protein expression was in that showed transgene Thus, membrane ERα E domain expression to the ERαKO in these and other organs. that of membrane and nuclear ER function is important and that of either pool results in an abnormal The of the E domain localized at the membrane in model the signaling by ERα. cell of E domain of cells that or cells to the full-length ERα at the membrane to E2 with signal (7Kousteni S. Bellido T. Plotkin L.I. O'Brien C.A. Bodenner D.L. Han L. Han K. DiGregorio G.B. Katzenellenbogen J.A. Katzenellenbogen B.S. Roberson P.K. Weinstein R.S. Jilka R.L. Manolagas S.C. Cell.. 2001; 104: 719-730Google Scholar, 8Razandi M. Pedram A. Parks S. Levin E.R. J. Biol. Chem.. 2003; 278: 2701-2712Google Scholar). we previously that expression of ERα lacking either or D domains localized to the membrane and ERK to full-length ERα In deletion of just the E domain this M. Pedram A. S. Levin E.R. Mol. 2003; Scholar). we that important rapidly and by E2 in cells derived from MOER and wild type mice. In no signal was in cells from ERαKO mice. These results address the important issue of ER pool is for signal signaling from steroid hormone action at the membrane (1Levin E.R. Mol. Endocrinol.. 2005; 19: 1951-1959Google of signal nuclear ERα of the for and in vivo and model the that ERα and the E domain is and for signal by described transgenic mouse model to address the of nuclear ERα action in mammary gland and reproductive tract development. in a in the domain of the mouse ERα in a that for M. M. T. Mol. Endocrinol.. Scholar). female mice have different from the of ERαKO or MOER mice. This that a receptor pools and the various of gene that to normal development of this female mice show of in the compared with mice, and cysts and corpus is not a of results in a that heterozygous ERαKO mice and have normal mammary gland development. In proliferation in response to E2 is in or combined female mice Hewitt S.C. Korach K.S. J. J. Biol. Chem.. 2006; Scholar). These that to E2 occur of possible is that signaling from membrane ER in the mouse is important for these to steroid steroid it has been that membrane ERα with nuclear ERα to Proc. Natl. Acad. Sci. U. S. A.. 2001; Scholar). Thus, the of nuclear ERα function at a and action membrane ERα. This membrane ERα signaling to the and of or of nuclear its at L. M. Mol. Endocrinol.. 2005; 19: Scholar). membrane ERα signaling to resulting from nuclear ERα expressed the ERα plasmid into ER cells and found that ERK and PI3K activation by E2 was comparable with E2 action in cells not Furthermore, S. M. Han L. Bellido T. Jilka R.L. Manolagas S.C. Mol. Scholar) that ERK was in the of combined female mice. Thus, activation by membrane ERα to be from the and it is that membrane ERα to membrane signaling of response to model to this out in that signaling by E2 is is not by for the normal development of E2 to ERα for normal reproductive tract and mammary gland development and function in female mice has been established K. Hewitt S.C. K. Korach K.S. Endocrinology.. Scholar). In expressing a functional E domain of ERα at the plasma membrane not the abnormal reproductive mammary gland, hormone or increased body fat phenotypes of the total cell ERαKO female mouse. No in vivo model of nuclear ERα deletion has previously been we that nuclear ERα is for the normal and function of these organs. with