Concepedia

Publication | Open Access

Identification of Murr1 as a Regulator of the Human δ Epithelial Sodium Channel

96

Citations

27

References

2004

Year

Abstract

The human δ epithelial sodium channel (δENaC) subunit is related to the α-, β-, and γENaC subunits that control salt homeostasis. δENaC forms an amiloride-sensitive Na+ channel with the β and γ subunits. However, the in vivo function of δENaC is not known. To gain insight into the function of δENaC, a yeast two-hybrid screen of a human brain cDNA library was carried out using the C- and N-terminal domains of δENaC. A novel δENaC-interacting protein called Murr1 (mouse U2af1-rs1 region) was isolated in the C-terminal domain screen. Murr1 is a 21-kDa protein mutated in Bedlington terriers suffering from copper toxicosis. The interaction of Murr1 and δENaC was confirmed by glutathione S-transferase pulldown assay and coimmunoprecipitation. To test the functional significance of the interaction, Murr1 was coexpressed with δβγENaC in Xenopus oocytes. Murr1 inhibited amiloride-sensitive sodium current in a dose-dependent manner. In addition, deletion of the last 59 amino acids of δENaC abolished the inhibition. Murr1 also bound to the β- and γENaC subunits and inhibited αβγENaC sodium current. Therefore, these results suggest that Murr1 is a novel regulator of ENaC. The human δ epithelial sodium channel (δENaC) subunit is related to the α-, β-, and γENaC subunits that control salt homeostasis. δENaC forms an amiloride-sensitive Na+ channel with the β and γ subunits. However, the in vivo function of δENaC is not known. To gain insight into the function of δENaC, a yeast two-hybrid screen of a human brain cDNA library was carried out using the C- and N-terminal domains of δENaC. A novel δENaC-interacting protein called Murr1 (mouse U2af1-rs1 region) was isolated in the C-terminal domain screen. Murr1 is a 21-kDa protein mutated in Bedlington terriers suffering from copper toxicosis. The interaction of Murr1 and δENaC was confirmed by glutathione S-transferase pulldown assay and coimmunoprecipitation. To test the functional significance of the interaction, Murr1 was coexpressed with δβγENaC in Xenopus oocytes. Murr1 inhibited amiloride-sensitive sodium current in a dose-dependent manner. In addition, deletion of the last 59 amino acids of δENaC abolished the inhibition. Murr1 also bound to the β- and γENaC subunits and inhibited αβγENaC sodium current. Therefore, these results suggest that Murr1 is a novel regulator of ENaC. The amiloride-sensitive epithelial Na+ channel (ENaC) 1The abbreviations used are: ENaCepithelial sodium channelGSTglutathione S-transferaseHAhemagglutininMurr1mouse U2af1-rs1 regionSEAPsecreted extracellular alkaline phosphataseSCsynthetic complete medium. is a key regulator of sodium movement across epithelia and consists of three similar subunits: α-, β-, and γENaC (1McDonald F.J. Price M.P. Snyder P.M. Welsh M.J. Am. J. Physiol. 1995; 268: C1157-C1163Crossref PubMed Google Scholar, 2Canessa C.M. Schild L. Buell G. Thorens B. Gautschi I. Horisberger J.D. Rossier B.C. Nature. 1994; 367: 463-467Crossref PubMed Scopus (1805) Google Scholar). Mutations in these subunits cause loss of blood pressure control and changes in salt balance (3Chang S.S. Grunder S. Hanukoglu A. Rosler A. Mathew P.M. Hanukoglu I. Schild L. Lu Y. Shimkets R.A. Nelson-Williams C. Rossier B.C. Lifton R.P. Nat. Genet. 1996; 12: 248-253Crossref PubMed Scopus (731) Google Scholar, 4Hansson J.H. Nelson-Williams C. Suzuki H. Schild L. Shimkets R. Lu Y. Canessa C. Iwasaki T. Rossier B. Lifton R.P. Nat. Genet. 1995; 11: 76-82Crossref PubMed Scopus (729) Google Scholar, 5Hansson J.H. Schild L. Lu Y. Wilson T.A. Gautschi I. Shimkets R. Nelson-Williams C. Rossier B.C. Lifton R.P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11495-11499Crossref PubMed Scopus (368) Google Scholar, 6Schild L. Canessa C.M. Shimkets R.A. Gautschi I. Lifton R.P. Rossier B.C. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5699-5703Crossref PubMed Scopus (298) Google Scholar, 7Shimkets R.A. Warnock D.G. Bositis C.M. Nelson-Williams C. Hansson J.H. Schambelan M. Gill Jr., J.R. Ulick S. Milora R.V. Findling J.W. Cell. 1994; 79: 407-414Abstract Full Text PDF PubMed Scopus (1216) Google Scholar, 8Snyder P.M. Price M.P. McDonald F.J. Adams C.M. Volk K.A. Zeiher B.G. Stokes J.B. Welsh M.J. Cell. 1995; 83: 969-978Abstract Full Text PDF PubMed Scopus (402) Google Scholar). epithelial sodium channel glutathione S-transferase hemagglutinin mouse U2af1-rs1 region secreted extracellular alkaline phosphatase synthetic complete medium. An additional human sodium channel subunit, δENaC, was reported in 1995 (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). Among ENaC family members δENaC has the highest amino acid identity (∼37%) to αENaC and to a recently described ϵ-subunit from Xenopus laevis (10Babini E. Geisler H.S. Siba M. Grunder S. J. Biol. Chem. 2003; 278: 28418-28426Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). A δENaC gene appears to be present in chimpanzee (GenBank™ accession number O46547) and in rabbit (11Brockway L.M. Zhou Z.H. Bubien J.K. Jovov B. Benos D.J. Keyser K.T. Am. J. Physiol. 2002; 283: C126-C134Crossref PubMed Scopus (78) Google Scholar), but there is no evidence for a rat or mouse δENaC gene. Similar to αENaC, when δENaC is expressed alone in Xenopus oocytes a small, amiloride-sensitive Na+ current is induced (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). This current is increased 50-fold by coexpression with the β- and γENaC subunits, and the properties of the δ and δβγ channels were identical (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). The highest expression levels of δENaC mRNA were detected in brain, testis, ovary, and pancreas, indicating that the primary function of δENaC may not be in epithelia (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). ENaC subunits are members of the degenerin/ENaC gene family. Other family members such as brain Na+ channel 1, acid-sensing ion channel, and dorsal root acid-sensing ion channel are expressed in neurons of the central and peripheral nervous systems (12Bianchi L. Driscoll M. Neuron. 2002; 34: 337-340Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). These channels are stimulated by acidic pH and have been implicated in touch sensation, synaptic plasticity, and pain perception (12Bianchi L. Driscoll M. Neuron. 2002; 34: 337-340Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). A brain channel matching the properties of the δENaC channel has not been reported. δENaC shares a common predicted topology to the α-, β-, and γENaC subunits: a large extracellular loop separated by two membrane-spanning domains leaving the short N- and C-terminal domains located inside the cell (13Snyder P.M. McDonald F.J. Stokes J.B. Welsh M.J. J. Biol. Chem. 1994; 269: 24379-24383Abstract Full Text PDF PubMed Google Scholar). The C-terminal domains of the αβγENaC subunits provide binding sites for the Nedd4 family of ubiquitin ligases. Nedd4 decreases the surface expression of ENaC, probably by mediating ubiquitination and internalization of the channel, thus controlling sodium movement across epithelia (14Goulet C.C. Volk K.A. Adams C.M. Prince L.S. Stokes J.B. Snyder P.M. J. Biol. Chem. 1998; 273: 30012-30017Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 15Abriel H. Loffing J. Rebhun J.F. Pratt J.H. Schild L. Horisberger J.D. Rotin D. Staub O. J. Clin. Investig. 1999; 103: 667-673Crossref PubMed Scopus (330) Google Scholar). Nedd4 binding to the αβγENaC subunits is mediated by WW domains in Nedd4 and a conserved PY motif (PPPXY) in the C-terminal domain of the αβγENaC subunits. However, this motif is not conserved in δENaC (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar), suggesting that the δENaC subunit may be regulated by binding proteins other than Nedd4 family members. Analysis of the amino acid sequence of the C- and N-terminal domains of δENaC shows that the N-terminal domain is particularly proline-rich (Fig. 1A, bottom). Short proline-rich sequences are known to bind interaction domains such as the WW or SH3 domains (16Sudol M. Oncogene. 1998; 17: 1469-1474Crossref PubMed Scopus (198) Google Scholar). The C-terminal domain also contains prolines that might provide a binding site for these domains. Alternatively, δENaC may contain novel binding motifs, and identification of proteins binding to novel motifs might provide information on δENaC function. Therefore, we screened a human brain cDNA library with the N- and C-terminal domains of δENaC to identify interacting proteins. Here we report that Murr1, a protein implicated in copper transport (17van de Sluis B. Rothuizen J. Pearson P.L. van Oost B.A. Wijmenga C. Hum. Mol. Genet. 2002; 11: 165-173Crossref PubMed Scopus (322) Google Scholar), interacts with the C-terminal domain of δENaC. In addition, we found that Murr1 binds to β- and γENaC but not to αENaC. Coexpression of Murr1 with either the δβγ or αβγENaC subunits in Xenopus oocytes resulted in sodium current inhibition, and the inhibition of δβγENaC was abolished by C-terminal truncation of δENaC. DNA Constructs—Full-length and truncated δENaC constructs (all containing the FLAG epitope tag DYKDDDDK) were cloned into pMT3 after PCR using the primers described below (all primers from 5′ to 3′). For full-length δENaC: 5′ primer CCATCGATATGGCTGAGCACCGAAGC and 3′ primer GGAATTCTCACTTGTCATCGTCGTCCTTGTAGTCGGTGTCCAGAGTCTCAAG. The C-terminal truncations were all constructed using the same 5′ primer, ACGCGTCGACGCCACCATGGACTACAAGGACGACGATGACAAGGCTGAGCACCGAAGCATG, and the following 3′ primers, CGGAATTCTCATGGAAGCATCACCCGTGG for δC-23 (last 23 amino acids were deleted), CGGAATTCTCAATCTGACTGGCCTCTGG for δC-47, and CGGAATTCTCATGAGGCAGGGCTGGCTCT for δC-59 (δT). The N-terminal truncations were constructed using the same 3′ primer as for full-length δENaC and the 5′ primers ACGCGTCGACGCCACCATGGAGCCCCCCAGGCCGGGGCCA for δN-27 (first 27 amino acids deleted) and ACGCGTCGACGCCACCATGGAGAAGGAGGGGCACCAGGAG for δN-41. Full-length δENaC was also cloned into the vector pHM6 (Roche Applied Science) in-frame with the HA epitope tag using the 5′ primer GGAATTCGATGGCTGAGCACCGAAGC and the 3′ primer GGAATTCCGGTGTCCAGAGTCTCAAG. Because sequence analysis showed that the isolated Murr1 clones were missing the first 15 base pairs, these missing base pairs were added as part of a PCR primer in a subsequent PCR reaction. Murr1-FLAG was cloned by PCR from a yeast two-hybrid library plasmid using the 5′ primer CCATCGATGCCACCATGGAGGGCGAGCTTGAGGGTGGCAAACCCCTG and the 3′ primer CGGAATTCTCACTTGTCATCGTCGTCCTTGTAGTCGTTAGGCTGGCTGATCAG and ligated into the vector pMT3. For the production of Murr1·GST fusion protein, Murr1 was cloned in-frame with GST into the vector pGEX-KG (AP Biotech) using the 5′ primer CGGGATCCCACGAGGGCGAGCTTGAGGGTGGCAAACCCCTG and the 3′ primer GCTCTAGATCAGTTAGGCTGGCTGATC. Plasmids encoding α-, β-, and γENaC in pMT3 for oocyte expression were previously described (1McDonald F.J. Price M.P. Snyder P.M. Welsh M.J. Am. J. Physiol. 1995; 268: C1157-C1163Crossref PubMed Google Scholar). Plasmids encoding βENaCR566X (βT), γENaCK576X (γT), αENaC-FLAG, βENaC-HA, and γENaC-HA are described elsewhere (18Adams C.M. Snyder P.M. Welsh M.J. J. Biol. Chem. 1997; 272: 27295-27300Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Cell Culture and Transient Transfection—COS7 cells were obtained from the American Type Culture Collection and were grown in low bicarbonate Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 10 units/ml penicillin, and 10 μg/ml streptomycin. Cells were maintained at 37 °C and 5% CO2. The day before transfection, COS7 cells were plated at a density of 3 × 105 cells in 35-mm plates. Cells were transfected with 1.5 μg of each cDNA construct using FuGENE 6 (Roche Applied Science) and the manufacturer's protocol. Yeast used for the screen were from the two-hybrid 3 A human brain cDNA library was screened with the C- and N-terminal of δENaC. The were constructed by the δENaC C-terminal acids and N-terminal acids domains with the binding domain into the sites of of the domains was by DNA for of The of the to the in yeast was confirmed to the library screen. and and cells not the The cDNA library and the were grown and × cells of each were and plated on 10 yeast medium to for 6 The cells were in and plated complete were after and on were on to for expression of a on to for and on to after on but not on were and for by For cDNA were isolated from and and clones by PCR using the 5′ primer and the 3′ primer Plasmids were by K.T. S. C. 1997; PubMed Scopus Google into the vector into and on plates. were by and and the interaction with the and an clones were by PCR and with to the cDNA and to identical clones were by DNA GST containing the cDNA for Murr1 or the vector were into and expression of the Murr1·GST fusion protein or GST alone was induced with for 3 at were using and the GST fusion proteins were on (AP COS7 cells were transfected with cDNA cells were in pH 10 μg/ml μg/ml was by × and the were with GST bound to The were with Murr1·GST fusion protein or GST to for 3 at in and by using or cells were with and Murr1-FLAG in 35-mm and three were for Cells were with after transfection, was by × and the was with μg/ml for 3 at of protein was added and for at The were in and in The were by using in Xenopus and or αβγENaC of with secreted alkaline phosphatase as a control or Murr1-FLAG or were into the of oocytes. oocytes were in low Na+ 15 pH at °C and or 3 after Na+ current was by the were in pH and were at a of using the oocyte and current was by the current obtained at in the of from the current obtained were at were and from at two of oocytes isolated on from and are as significance was using analysis of and were and with by for at The were for at × and the were with μg/ml to Murr1-FLAG or were isolated with protein and by using Yeast identify proteins binding to δENaC, we a yeast two-hybrid screen with the C- and N-terminal domains of δENaC. Because of the expression of δENaC in brain (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar), we to screen a human brain cDNA The δENaC C-terminal domain screen clones and and the N-terminal domain screen not The δENaC C-terminal clones that the with the C-terminal were not of expression of gene by and not with an not clones were and to a of the clones were as the human Murr1 gene. The Murr1 gene was first described by A. I. H. M. T. Mol. Cell. Biol. 1997; 17: PubMed Scopus Google Scholar), that the gene U2af1-rs1 in an of the Murr1 the Murr1 gene not to be Murr1 was as a gene that in the mouse U2af1-rs1 Murr1 has recently been implicated in copper a mutated of Murr1 is with copper in Bedlington terriers (17van de Sluis B. Rothuizen J. Pearson P.L. van Oost B.A. Wijmenga C. Hum. Mol. Genet. 2002; 11: 165-173Crossref PubMed Scopus (322) Google Scholar). However, the function of Murr1 in copper is not known. Murr1 appears to be expressed in human that δENaC (17van de Sluis B. Rothuizen J. Pearson P.L. van Oost B.A. Wijmenga C. Hum. Mol. Genet. 2002; 11: 165-173Crossref PubMed Scopus (322) Google Scholar). we the of an interaction δENaC and The Murr1 gene for a 21-kDa protein that not contain known interaction suggesting the interaction with δENaC might novel binding Murr1 with the C-terminal of of δENaC and truncations in COS7 cells resulted in the of two or of of the extracellular This is with the expression of and αENaC, and γENaC subunits (1McDonald F.J. Price M.P. Snyder P.M. Welsh M.J. Am. J. Physiol. 1995; 268: C1157-C1163Crossref PubMed Google Scholar, C.M. Snyder P.M. Welsh M.J. J. Biol. Chem. 1997; 272: 27295-27300Abstract Full Text Full Text PDF PubMed Scopus (75) Google of these subunits. The interaction Murr1 and δENaC was confirmed by GST pulldown assay (Fig. expressed in COS7 cells was bound with a Murr1·GST fusion shows that Murr1·GST bound δENaC, but GST alone To that Murr1 binds to the C- and not to the N-terminal domain of δENaC as predicted by the yeast two-hybrid we used a of N- and C-terminal δENaC truncations (Fig. in a subsequent GST pulldown from the no on the interaction Murr1 and δENaC (Fig. A of δENaC C-terminal truncations showed that of the last 23 amino acids from δENaC no on binding to Murr1 (Fig. However, deletion of either the last or the last 59 amino acids abolished the interaction Murr1 and δENaC. These results that Murr1 binds to the C-terminal domain of δENaC and that the binding site for Murr1 is located amino acids and of δENaC (Fig. To an interaction Murr1 and δENaC in cells we used coimmunoprecipitation. COS7 cells were with constructs encoding Murr1-FLAG and Murr1-FLAG and were with by protein and by using 3 shows that Murr1 and δENaC when coexpressed in Murr1 in Xenopus Because Murr1 and δENaC when coexpressed in we the interaction δENaC and Murr1 is the β-, and γENaC subunits were coexpressed with an of Murr1 in Xenopus oocytes. Murr1 the Na+ current by with the control (Fig. To test the in current was oocytes were with δβγENaC and the of Murr1 used in the The Na+ current was by and from the control and using an of Murr1 δβγENaC current in a dose-dependent manner. The results of the in interaction that Murr1 interacts with the C-terminal domain of δENaC. To test this in Xenopus oocytes and to the β and γ subunits to the inhibition of sodium current Murr1, C-terminal truncation construct were coexpressed with full-length δENaC was coexpressed with β and γ subunits missing C-terminal domains and in the or of Murr1 (Fig. Murr1 was expressed with Na+ current was by with the control Murr1 the channel when the β- and γENaC C-terminal domains were However, the inhibition was than that with δβγENaC Murr1, suggesting that Murr1 may inhibition in part the β- γENaC C-terminal domains. we coexpressed a truncated δENaC subunit missing the last 59 amino acids not bind to Murr1 in with full-length β- and Coexpression of Murr1 with the channel not in of the sodium channel 27 of This that Murr1 binds to the C-terminal domain of δENaC to channel and that the of the β and γ subunits to Murr1 inhibition is To that and Murr1 were expressed in this sodium oocytes were and after current Murr1 and were isolated by using shows that proteins were expressed in the oocytes. Therefore, Murr1 binds to the C-terminal region of δENaC to sodium current. Murr1 with β- and γENaC in Murr1 inhibited current when the C-terminal domains of the β- and γENaC subunits were (Fig. the was than that with Murr1 inhibition of Therefore, we the α-, γENaC subunits also with Murr1, using a GST pulldown α-, β-, or either or were expressed in COS7 cells for and the were with Murr1·GST or GST shows that β- and but not αENaC, bind to Murr1·GST in Because the β- and γENaC subunits bind Murr1, we Murr1 a channel by the α-, β-, and γENaC subunits. shows that Murr1 inhibited αβγENaC current by Therefore, Murr1 is to sodium channels by either δβγ or ENaC subunits. In to the αβγENaC subunits, the δENaC subunit has been The δENaC and αβγENaC is the and γ subunits are expressed in epithelial such as or (1McDonald F.J. Price M.P. Snyder P.M. Welsh M.J. Am. J. Physiol. 1995; 268: C1157-C1163Crossref PubMed Google Scholar, 2Canessa C.M. Schild L. Buell G. Thorens B. Gautschi I. Horisberger J.D. Rossier B.C. Nature. 1994; 367: 463-467Crossref PubMed Scopus (1805) Google Scholar), δENaC expression is highest in brain, testis, ovary, and (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). δENaC is expressed at low levels in (9Waldmann R. Champigny G. Bassilana F.V.N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar), is that δENaC for αENaC, loss of function in αENaC cause the (3Chang S.S. Grunder S. Hanukoglu A. Rosler A. Mathew P.M. Hanukoglu I. Schild L. Lu Y. Shimkets R.A. Nelson-Williams C. Rossier B.C. Lifton R.P. Nat. Genet. 1996; 12: 248-253Crossref PubMed Scopus (731) Google Scholar). This that in the δENaC is not expressed at a to for αENaC, that αENaC and δENaC are expressed in cell or that channels by αENaC and δENaC are and regulated by To to the function and of δENaC we a yeast two-hybrid screen with the N- and C-terminal domains of δENaC to δENaC binding binding might novel or subunits of a δENaC Murr1, a gene implicated in copper (17van de Sluis B. Rothuizen J. Pearson P.L. van Oost B.A. Wijmenga C. Hum. Mol. Genet. 2002; 11: 165-173Crossref PubMed Scopus (322) Google Scholar), was as a novel δENaC binding The Murr1 gene is mutated in copper in Bedlington showed a deletion of of the Murr1 gene (17van de Sluis B. Rothuizen J. Pearson P.L. van Oost B.A. Wijmenga C. Hum. Mol. Genet. 2002; 11: 165-173Crossref PubMed Scopus (322) Google Scholar). is by of copper into the in of copper in the J.F. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar). In copper in the I. PubMed Scopus Google Scholar), of a in to the These suggest that Murr1 might be in ion transport in In the of copper have The for this has been to the a J.F. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar). L. Wijmenga C. J.D. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google that Murr1 interacts with the N-terminal domain of the Wilson gene indicating a Murr1 and However, of 23 with copper not identify or in the Murr1 gene T. van de Sluis B. A. van E. A. A. H. H. H. J. H. I. Wijmenga C. J. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar). The function of Murr1 the protein shows no to other proteins and not contain amino acid motifs or domains. and pulldown we have that Murr1 interacts with the C-terminal domain of δENaC. N- and C-terminal truncations of δENaC, the binding site for Murr1 was located amino acids and of δENaC. The C-terminal domain of δENaC is identical to that of αENaC (Fig. and the PY motif found in the αβγENaC subunits that interaction with Nedd4 family members is not conserved in δENaC. Murr1 not contain protein interaction thus be to identify the amino acids in the interaction of δENaC and in Xenopus oocytes that Murr1 is a of δβγENaC sodium current. This might be Murr1 the of subunits to or from the might have a on channel or might be an the channel to ENaC subunit is known to be by J. C. R.A. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar, S. A. Y. Warnock D.G. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar), surface expression of ENaC by with into the R.A. H. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google Scholar), and Nedd4 family ubiquitination and internalization of ENaC P.M. 2002; PubMed Scopus Google Scholar). the C-terminal domains of β- and γENaC were Murr1 inhibited the current by the channel, this current was than obtained with δβγENaC These results suggest that Murr1 the δENaC This was confirmed by the C-terminal domain of Murr1 was to channel function. However, the β- and γENaC subunits might also be in δβγENaC channel Murr1 bound subunits in a pulldown Murr1 also αβγENaC sodium current. The of Murr1 on the αβγENaC current was than that for Murr1 not bind to αENaC. These results suggest that Murr1 may be a regulator of ENaC family members and of other channels or A sodium and copper transport has been in and evidence for copper ENaC H. 2002; PubMed Scopus Google Scholar). Murr1 δENaC appears to contain copper binding sites S. J. M. D.J. J. Biol. Chem. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar, D. S. J. J.F. J. Biol. Chem. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar), is that Murr1 the transport of sodium and copper across Alternatively, Murr1 might be for of sodium channels and copper the and proteins are to the in low copper the copper a in the of and to the or a (1McDonald F.J. Price M.P. Snyder P.M. Welsh M.J. Am. J. Physiol. 1995; 268: C1157-C1163Crossref PubMed Google Scholar, H. H. M.J. Full Text Full Text PDF PubMed Scopus Google Scholar). such as on δENaC and analysis be to the by Murr1 δβγENaC and αβγENaC channel function. and for and and Snyder for on the

References

YearCitations

Page 1