p53 and Mitochondrial DNA

Abstract

The roles and actions of the tumor suppressor protein p53 have been extensively studied with regard to nuclear events, including transcription and DNA damage repair. However, the direct roles of p53 in mitochondrial DNA (mtDNA) replication and function are less well understood. Studies herein used a mitochondrial-targeted p53 (MTS-p53) to determine its effects on both mtDNA abundance and mitochondrial function. MTS-p53 decreased cellular proliferation and mtDNA abundance in HepG2 cells transfected with wild-type (WT) human p53. When MTS-p53 cells were treated with the nucleoside reverse transcriptase inhibitor (NRTI), 2′,3′-dideoxycytidine or 2′,3′-dideoxyinosine, mtDNA depletion that resembled untransfected controls was observed in both instances. p53-Overexpressing cells showed reduced mitochondrial function by oximetry, including a reduction in maximal respiratory capacity and reserve capacity. A truncated p53 (MTS-p53-290) was generated for localization exclusively to the mitochondria. MTS-p53-290 cells proliferated at control levels but displayed decreased mtDNA abundance and mitochondrial function with NRTI treatment. The MTS-p53-290 cells demonstrated that only the nuclear fraction of p53 controlled cellular proliferation, which was supported by the MTS-p53 results. Data herein indicate that overexpression of p53 in the mitochondria reduces mtDNA abundance and increases the sensitivity of mammalian cells to NRTI exposure by reducing mitochondrial function. The roles and actions of the tumor suppressor protein p53 have been extensively studied with regard to nuclear events, including transcription and DNA damage repair. However, the direct roles of p53 in mitochondrial DNA (mtDNA) replication and function are less well understood. Studies herein used a mitochondrial-targeted p53 (MTS-p53) to determine its effects on both mtDNA abundance and mitochondrial function. MTS-p53 decreased cellular proliferation and mtDNA abundance in HepG2 cells transfected with wild-type (WT) human p53. When MTS-p53 cells were treated with the nucleoside reverse transcriptase inhibitor (NRTI), 2′,3′-dideoxycytidine or 2′,3′-dideoxyinosine, mtDNA depletion that resembled untransfected controls was observed in both instances. p53-Overexpressing cells showed reduced mitochondrial function by oximetry, including a reduction in maximal respiratory capacity and reserve capacity. A truncated p53 (MTS-p53-290) was generated for localization exclusively to the mitochondria. MTS-p53-290 cells proliferated at control levels but displayed decreased mtDNA abundance and mitochondrial function with NRTI treatment. The MTS-p53-290 cells demonstrated that only the nuclear fraction of p53 controlled cellular proliferation, which was supported by the MTS-p53 results. Data herein indicate that overexpression of p53 in the mitochondria reduces mtDNA abundance and increases the sensitivity of mammalian cells to NRTI exposure by reducing mitochondrial function. Tumor suppressor protein p53 is characterized as a guardian of the genome, with various functions as a transcription factor, DNA damage repair modulator, and signaling protein.1Carson D.A. Lois A. Cancer progression and p53.Lancet. 1995; 346: 1009-1011Abstract PubMed Scopus (153) Google Scholar, 2Efeyan A. Serrano M. p53: Guardian of the genome and policeman of the oncogenes.Cell Cycle. 2007; 6: 1006-1010Crossref PubMed Scopus (283) Google Scholar, 3Tokino T. Nakamura Y. The role of p53-target genes in human cancer.Crit Rev Oncol Hematol. 2000; 33: 1-6Crossref PubMed Scopus (143) Google Scholar In addition to those nuclear functions, p53 plays an important role in mitochondrial-mediated cellular responses, including the binding of proteins localized to the outer mitochondrial membrane that initiates apoptosis.4Lozano G. Mouse models of p53 functions.Cold Spring Harb Perspect Biol. 2010; 2: a001115Crossref PubMed Scopus (75) Google Scholar, 5Vaseva A.V. Moll U.M. The mitochondrial p53 pathway.Biochim Biophys Acta. 2009; 1787: 414-420Crossref PubMed Scopus (473) Google Scholar, 6Marchenko N.D. Zaika A. Moll U.M. Death signal-induced localization of p53 protein to mitochondria: a potential role in apoptotic signaling.J Biol Chem. 2000; 275: 16202-16212Abstract Full Text Full Text PDF PubMed Scopus (787) Google Scholar, 7Mihara M. Erster S. Zaika A. Petrenko O. Chittenden T. Pancoska P. Moll U.M. p53 Has a direct apoptogenic role at the mitochondria.Mol Cell. 2003; 11: 577-590Abstract Full Text Full Text PDF PubMed Scopus (1472) Google Scholar Evidence has suggested that p53 is present and functions in the mitochondrial matrix.8Canugovi C. Maynard S. Bayne A.C. Sykora P. Tian J. de Souza-Pinto N.C. Croteau D.L. Bohr V.A. The mitochondrial transcription factor A functions in mitochondrial base excision repair.DNA Repair (Amst). 2010; 9: 1080-1089Crossref PubMed Scopus (109) Google Scholar, 9Bakhanashvili M. Grinberg S. Bonda E. Simon A.J. Moshitch-Moshkovitz S. Rahav G. p53 In mitochondria enhances the accuracy of DNA synthesis.Cell Death Differ. 2008; 15: 1865-1874Crossref PubMed Scopus (66) Google Scholar, 10de Souza-Pinto N.C. Harris C.C. Bohr V.A. p53 Functions in the incorporation step in DNA base excision repair in mouse liver mitochondria.Oncogene. 2004; 23: 6559-6568Crossref PubMed Scopus (86) Google Scholar, 11Achanta G. Sasaki R. Feng L. Carew J.S. Lu W. Pelicano H. Keating M.J. Huang P. Novel role of p53 in maintaining mitochondrial genetic stability through interaction with DNA Pol gamma.EMBO J. 2005; 24: 3482-3492Crossref PubMed Scopus (237) Google Scholar Determination of the mitochondrial matrix localization for native p53 has not been fully established. Mass spectrometry analysis of mitochondrial nucleoids failed to detect the presence of p53,12Bogenhagen D.F. Rousseau D. Burke S. The layered structure of human mitochondrial DNA nucleoids.J Biol Chem. 2008; 283: 3665-3675Abstract Full Text Full Text PDF PubMed Scopus (336) Google Scholar, 13Spelbrink J.N. Functional organization of mammalian mitochondrial DNA in nucleoids: history, recent developments, and future challenges.IUBMB Life. 2010; 62: 19-32PubMed Google Scholar whereas others8Canugovi C. Maynard S. Bayne A.C. Sykora P. Tian J. de Souza-Pinto N.C. Croteau D.L. Bohr V.A. The mitochondrial transcription factor A functions in mitochondrial base excision repair.DNA Repair (Amst). 2010; 9: 1080-1089Crossref PubMed Scopus (109) Google Scholar, 9Bakhanashvili M. Grinberg S. Bonda E. Simon A.J. Moshitch-Moshkovitz S. Rahav G. p53 In mitochondria enhances the accuracy of DNA synthesis.Cell Death Differ. 2008; 15: 1865-1874Crossref PubMed Scopus (66) Google Scholar, 10de Souza-Pinto N.C. Harris C.C. Bohr V.A. p53 Functions in the incorporation step in DNA base excision repair in mouse liver mitochondria.Oncogene. 2004; 23: 6559-6568Crossref PubMed Scopus (86) Google Scholar, 11Achanta G. Sasaki R. Feng L. Carew J.S. Lu W. Pelicano H. Keating M.J. Huang P. Novel role of p53 in maintaining mitochondrial genetic stability through interaction with DNA Pol gamma.EMBO J. 2005; 24: 3482-3492Crossref PubMed Scopus (237) Google Scholar show that p53 binds to mitochondrial DNA (mtDNA) and aids in mtDNA repair. The p53 within the cell is helpful in maintaining normal mitochondrial function because p53 in the mitochondria enhances base excision repair of mtDNA damage,9Bakhanashvili M. Grinberg S. Bonda E. Simon A.J. Moshitch-Moshkovitz S. Rahav G. p53 In mitochondria enhances the accuracy of DNA synthesis.Cell Death Differ. 2008; 15: 1865-1874Crossref PubMed Scopus (66) Google Scholar, 10de Souza-Pinto N.C. Harris C.C. Bohr V.A. p53 Functions in the incorporation step in DNA base excision repair in mouse liver mitochondria.Oncogene. 2004; 23: 6559-6568Crossref PubMed Scopus (86) Google Scholar, 11Achanta G. Sasaki R. Feng L. Carew J.S. Lu W. Pelicano H. Keating M.J. Huang P. Novel role of p53 in maintaining mitochondrial genetic stability through interaction with DNA Pol gamma.EMBO J. 2005; 24: 3482-3492Crossref PubMed Scopus (237) Google Scholar and a loss of cellular p53 reduces mitochondrial function.14Park J.Y. Wang P.Y. Matsumoto T. Sung H.J. Ma W. Choi J.W. Anderson S.A. Leary S.C. Balaban R.S. Kang J.G. Hwang P.M. p53 Improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.Circ Res. 2009; 105 (711 p following 712): 705-712Crossref PubMed Scopus (147) Google Scholar, 15Matoba S. Kang J.G. Patino W.D. Wragg A. Boehm M. Gavrilova O. Hurley P.J. Bunz F. Hwang P.M. p53 Regulates mitochondrial respiration.Science. 2006; 312: 1650-1653Crossref PubMed Scopus (1346) Google Scholar Such enhancement of mtDNA repair would have a positive impact on mitochondrial function and biogenesis. Experiments herein were designed to determine the role of p53 in the mitochondria of mammalian cells. To accomplish this, a plasmid construct containing a mitochondrial-targeting sequence (MTS) ligated to the N-terminus of the p53 protein (MTS-p53) was used to target mitochondrial translocation of p53. Because of the strong intrinsic nuclear localization of MTS-p53 as the result of the sequence located in the 291 to 393 amino acid region of p53, a second truncated construct of p53 (MTS-p53-290) was generated to reduce nuclear localization of the protein. The p53 translocated to the mitochondria in both cases, with nuclear localization of p53 only seen in the MTS-p53 construct. The mitochondrial-localized p53 overexpression resulted in depleted mtDNA abundance and a reduction in oxidative function in the face of treatment with pharmacological doses of nucleoside reverse transcriptase inhibitors (NRTIs), 2′,3′-dideoxycytidine (ddC) and 2′,3′-dideoxyinosine (ddI). Increased mitochondrial-targeted p53 negatively regulates mitochondrial function and mtDNA abundance, and our findings suggest that one new role of p53 in the mitochondria is the regulation of mitochondrial biogenesis. A CMV vector plasmid containing WT human p53 (Clontech, Mountain View, CA) was restricted with BamHI (Fermentas, Glen Burnie, MD) and Eco0109I (New England Biolabs, Ipswich, MA) to release the p53 insert and truncate the stop codon. High-fidelity PCR using Pfx (Invitrogen, Grand Island, NY) was used to engineer an N-terminal MTS and a C-terminal hemagglutinin (HA) tag onto the p53 protein. The N-terminal primer was developed to add the MTS of ornithine transcarbamylase to the N-terminus of the p53 protein (sequence, 5′-GAGAGAGTCGACGCCACCATGCTGTTTAATCTGAGGATCCTGTTAAACAATGCAGCTTTTAGAAATGGTCACAACTTCATGGTTCGAAATTTTAAGCTTATGGAGGAGCCGCAG-3′). The C-terminal primer was developed to add the HA tag to the C-terminus of the p53 protein to enable discrimination of the additional p53 from endogenous p53 (sequence, 5′-TCTCTCGTCGACTCAAGCGTAGTCTGGGACGTCGTATGGGTAGTCTGAGTCAGGCCCTTCTGTCTTGAACATGAGTTT-3′). The resulting MTS-p53 construct was gel purified and ligated back into the CMV vector plasmid using blunt-end ligation. The resulting ligation product was grown in NEB5α cells (New England Biolabs), which were clonally selected, and the purified plasmid was sequenced to ensure fidelity. The MTS-p53-290 construct was generated using the Stratagene QuikChange site-directed mutagenesis kit (Agilent, Santa Clara, CA). BsiWI restriction enzyme sites were introduced into the MTS-p53 construct at sites 290 to 291 and 391 to 392 using specially designed primers, following the recommendations of the manufacturer. The resulting plasmid was restricted with BsiWI (Fermentas) to release the 291 to 391 region of p53 and ligated back together. The resulting ligation product (termed MTS-p53-290) was grown in NEB5α cells, which were clonally selected, and the purified plasmid was sequenced to ensure fidelity. HepG2 cells were grown in Eagle's minimal essential medium (American Type Culture Collection, Manassas, VA) with 10% fetal bovine serum (American Type Culture Collection) and penicillin-streptomycin (Invitrogen) at 37°C and 5% CO2. Cells were transfected with either the MTS-p53 or the MTS-p53-290 plasmid using the Fugene 6 transfection reagent (Roche, Indianapolis, IN) in a 3:1 ratio. Vector cells received only the CMV plasmid without the MTS-p53. Cells were transfected for 24 hours, then trypsinized and reseeded in Eagle's minimal essential medium containing 600 μg/mL G418 (Lonza, Hopkinton, MA) to select for positive clones. After 14 days of G418 selection, colonies were selected using cloning cylinders and were determined positive for the insert using primers against the full-length region surrounding the MTS-p53 or MTS-p53-290 insert (forward, 5′-TGGAAAAACGCCAGCAACGCG-3′; reverse, 5′-AAGGGATTTTGCCGATTTCGGAA-3′). Positive colonies were verified for protein presence and localization by standard SDS-PAGE and Western blot protocols using an HA antibody (Sigma-Aldrich, St. Louis, MO) for the MTS-p53 protein, human p53 antibody (Novus Biologicals, Littleton, CO) for the MTS-p53-290 protein, succinate dehydrogenase subunit B (Novus Biologicals) as a mitochondrial marker, and lamin A (Sigma-Aldrich) as a nuclear marker. Subcellular fractionation was achieved through differential centrifugation after saponin treatment to permeabilize the cell membrane. The following reagents were obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, National Institute of Allergy and Infectious Diseases, NIH: ddC (zalcitabine) and ddI (didanosine). Cells were plated at 1 × 105 cells per well in a six-well dish. Cells were allowed to proliferate for 24 hours in the absence of ddC or ddI. After the initial 24 hours, ddC (1.0 or 10.0 μmol/L) or ddI (10.0 or 100.0 μmol/L) was added to the media, and the cells were collected and counted after 72 hours of additional growth. Cells were trypsinized and counted using the trypan blue exclusion assay and a hemocytometer. Cells were plated at 1 × 105 cells per well in a six-well dish. Cells were allowed to proliferate for 24 hours in the absence of ddC or ddI. After the initial 24 hours, ddC (0.1, 0.3, 1.0, 3.0, or 10.0 μmol/L) or ddI or μmol/L) was added to the media, and the cells were after or 72 hours of using one with μg/mL of (Invitrogen) and were allowed to for 24 hours at After the DNA was from using the The resulting DNA were and for mtDNA abundance using the DNA was using the nuclear (forward, reverse, and mtDNA was using the mitochondrial (forward, reverse, and analysis were using an MA) using by the manufacturer. HepG2 MTS-p53 cells, and MTS-p53-290 cells were at × cells per well into an Cells were allowed to for 24 hours in normal After the initial 24 hours, cells were treated with ddC (0.1, 1.0, or 10.0 μmol/L) or ddI or 100.0 μmol/L) for 24 or 72 After 24 or 72 hours, were from the Eagle's medium was with and 1 (Sigma-Aldrich) was added to Cells were allowed to in the new for analysis by the Cells were to (1.0 and to determine cellular and mitochondrial Data are as a of the of the from were used to determine as the and after maximal as the after and reserve capacity as the the and the were with with determined using a analysis of or a with CA). A was for with a to determine In the plasmid the MTS of ornithine transcarbamylase was ligated to the N-terminus of the WT p53 protein as used to proteins into the P. M. W. H. of by overexpression of to 2005; PubMed Scopus Google Scholar The addition of a C-terminal HA tag that p53 translocated to the mitochondria and was from endogenous p53. the construct using an HA Western blot were on The MTS-p53 protein localized to the fraction and the nuclear fraction MTS-p53 and were used to reduce of clones. The p53 were characterized by PCR and Western blot that and were positive for the MTS-p53 SDS-PAGE and Western blot analysis show that p53 and the MTS-p53 in both the nuclear and mitochondrial HA antibody was used to determine the of p53 from the MTS-p53 with succinate dehydrogenase subunit B a mitochondrial and lamin A nuclear used as protein fraction The cell and proliferation of the vector and MTS-p53 cells were determined using the trypan blue exclusion The vector and both MTS-p53 were at the initial cell and allowed to proliferate for 72 After 72 hours, both showed a in counted cells with the vector was in cell of that MTS-p53 at a with vector controls observed with the of p53 in the cells on determined the sensitivity of the to mtDNA depletion by ddC and ddI. of the have been used to with human 1 or are in were and mtDNA W. of NRTI an cellular Rev 2003; 2: PubMed Scopus Google Scholar used those used in G. M.J. T. of mitochondrial in human cells treated with with nucleoside reverse transcriptase PubMed Scopus Google Scholar and was in cellular proliferation at 72 hours after ddC or with controls and ddC ddI exposure reduced the of the cells and on a of the mitochondrial-targeted p53 to in mtDNA the mtDNA abundance of using showed a in mtDNA abundance in both of the MTS-p53 cell with the controls that overexpression of p53 negatively the mtDNA abundance in HepG2 cells. of the cells with ddC decreased mtDNA abundance in both a and of mtDNA after 24 hours of exposure at the doses of and mtDNA depletion with of A in mtDNA abundance resulted from ddI treatment after 72 hours and of MTS-p53 not mtDNA on either the of NRTI treatment or the of suggest that overexpression of p53 not cells from or mtDNA depletion at the doses mtDNA depletion not cellular or cell To determine the effects of ddC and ddI on mitochondrial used an to cellular The cells were plated and to ddC and ddI in a to the mtDNA abundance only the vector and MTS-p53 were used for that determined cellular After 24 or 72 hours of a in in the MTS-p53 was was in the absence of through the intrinsic Data suggest that mitochondrial is not and that MTS-p53 not of the cells after ddC In was a in the maximal of the MTS-p53 and in the reserve capacity of the p53 after ddC and show that p53 the cells to ddC exposure in an and that the to is reduced in MTS-p53 cells after ddC treatment. were seen with the ddI ddI a on mitochondrial on the cells, with was in or after ddI and However, ddI reduced maximal and reserve capacity in the MTS-p53 and that p53 the cells to NRTI exposure by reducing maximal and reserve capacity. To control for the nuclear localization of the MTS-p53 protein, a construct was generated to its nuclear localization The nuclear localization sequence is located in the 291 to 393 amino acid region of p53, and generated the second construct (termed MTS-p53-290) to region the and located in the 1 to 290 amino acid The nuclear of p53 is determined by the presence of a and its to the nuclear localization PubMed Scopus Google Scholar, of p53 PubMed Scopus Google Scholar construct the MTS from ornithine transcarbamylase to mitochondrial show that the MTS-p53-290 protein product was exclusively localized to the mitochondrial proliferation that the transfected cells proliferated at the as the cells, that overexpression of p53 in the nuclear was for the seen in the MTS-p53 was in cell in cells were seen in proliferation or after ddC and or ddI and that MTS-p53-290 not proliferation or the doses or proliferation and of MTS-p53-290 cells. Vector and MTS-p53-290 were allowed to proliferate for 72 hours in either the presence or the absence of ddC or ddI. MTS-p53-290 cells showed in cellular proliferation or with the cells. of cells with ddC not a in either cell proliferation or cell with controls of cells with ddI not a in cell proliferation or cell with the in mtDNA abundance were after ddC and ddI exposure in the MTS-p53-290 cells. to the MTS-p53 cells, MTS-p53-290 cells showed a reduction in mtDNA abundance in cells with cells was a reduction in mtDNA abundance in MTS-p53-290 cells with When treated with ddC or show a in mtDNA abundance with doses of ddC and and was of p53 abundance in the mitochondria B and was MTS-p53-290 mtDNA abundance after ddC or ddI treatment with doses in control cells. show that overexpression of p53 in the mitochondria not cells from or mtDNA depletion at the doses to seen in the MTS-p53 cells. were on the MTS-p53-290 cells. Experiments showed that MTS-p53-290 cells were to ddC and ddI at the doses of p53 in the mitochondria reduced maximal and reserve capacity after ddC and ddI whereas vector cells was in after ddC or ddI treatment. that p53 in the mitochondria the cells to NRTI of in mtDNA abundance, by reducing function. that overexpression of p53 negatively the normal mitochondrial in the cells, mtDNA abundance, and enhances sensitivity to that p53 Has been studied extensively in the and whereas the mitochondrial role of p53 has on a fraction and its role in apoptosis.4Lozano G. Mouse models of p53 functions.Cold Spring Harb Perspect Biol. 2010; 2: a001115Crossref PubMed Scopus (75) Google Scholar, 5Vaseva A.V. Moll U.M. The mitochondrial p53 pathway.Biochim Biophys Acta. 2009; 1787: 414-420Crossref PubMed Scopus (473) Google Scholar, 6Marchenko N.D. Zaika A. Moll U.M. Death signal-induced localization of p53 protein to mitochondria: a potential role in apoptotic signaling.J Biol Chem. 2000; 275: 16202-16212Abstract Full Text Full Text PDF PubMed Scopus (787) Google Scholar, 7Mihara M. Erster S. Zaika A. Petrenko O. Chittenden T. Pancoska P. Moll U.M. p53 Has a direct apoptogenic role at the mitochondria.Mol Cell. 2003; 11: 577-590Abstract Full Text Full Text PDF PubMed Scopus (1472) Google Scholar The used herein in were designed to overexpression of p53 in the of the cells and mitochondrial that the MTS used was not strong to the nuclear localization to The nuclear of p53 is determined by the presence of a and its to the nuclear localization PubMed Scopus Google Scholar, of p53 PubMed Scopus Google Scholar resulted in overexpression of p53 in both the nuclear and mitochondrial with fraction to the observed in the MTS-p53 of the 291 to 391 of p53, with of an localization of the MTS-p53-290 protein to the mitochondria and discrimination of the seen in the MTS-p53 The MTS-p53-290 allowed to the of the MTS-p53 into those to nuclear overexpression of p53 and mitochondrial overexpression of p53. showed that overexpression of MTS-p53 decreased cell proliferation to the nuclear fraction of the MTS-p53 protein because a in cellular proliferation was not seen in the MTS-p53-290 cells in cellular proliferation or in either p53 cell after ddC or ddI treatment. Because both of are mitochondrial and not proliferation or that the in cellular proliferation was a of the nuclear p53 and not a result of mitochondrial-localized p53. of the p53 used in decreased mtDNA abundance and The in which p53 is to reduce mtDNA abundance is J.Y. Wang P.Y. Matsumoto T. Sung H.J. Ma W. Choi J.W. Anderson S.A. Leary S.C. Balaban R.S. Kang J.G. Hwang P.M. p53 Improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.Circ Res. 2009; 105 (711 p following 712): 705-712Crossref PubMed Scopus (147) Google Scholar has that decreased levels of p53 to a in mtDNA abundance, whereas in our levels of p53 to a in mtDNA by the in functions and localization of the p53 protein. Because of transcription factor in the a loss of p53 in the would reduce mitochondrial proteins for mtDNA In our because is in nuclear p53 in the MTS-p53-290 would in the nuclear of the endogenous p53. The MTS-p53-290 cells enable for the of the mitochondrial p53 of of nuclear p53 findings would an p53 that would enable a loss of mtDNA in the MTS-p53 and MTS-p53-290 cells as a result of mitochondrial is the role of function negatively mtDNA The p53 has an intrinsic to function that used to in base excision M. Grinberg S. Bonda E. Simon A.J. Moshitch-Moshkovitz S. Rahav G. p53 In mitochondria enhances the accuracy of DNA synthesis.Cell Death Differ. 2008; 15: 1865-1874Crossref PubMed Scopus (66) Google Scholar, T. F. L. W. F. p53 Full Text Full Text PDF PubMed Scopus Google Scholar at In the p53 the repair of endogenous damage present in In of mtDNA would enable transcription of proteins to would a of mtDNA that used mtDNA but would that of mtDNA to mtDNA as seen after ddC and ddI The second is that is of of The of from E. in mitochondria of cells mitochondrial DNA repair capacity and cell after oxidative Repair (Amst). 2003; 2: PubMed Scopus Google Scholar has that overexpression of function of in the mitochondria to mtDNA depletion and cell However, not in cell and not the levels of damage present in cells. The is an mitochondrial function of p53 for negatively mtDNA demonstrated that p53 the cells to ddC and ddI treatment. in are to the mitochondrial fraction of p53. ddC and ddI are inhibitors of mtDNA the of in W. of NRTI an cellular Rev 2003; 2: PubMed Scopus Google Scholar The in the p53 after ddC and ddI a for mtDNA The MTS-p53 a in mtDNA with the vector whereas the MTS-p53-290 cells a in mtDNA with the vector clones. with ddC or ddI a depletion of mtDNA at mtDNA depletion a mitochondrial result from depleted and mitochondrial protein show that mitochondrial overexpression of p53 to decreased mitochondrial function and mtDNA The of control of mitochondrial and cellular is important for the in mitochondrial function after cellular as oxidative or the function of localized fraction of p53 determine to mtDNA abundance and oxidative in of following that are in the of The of PDF